Starting /dee2/code/volunteer_pipeline.sh ERR1864448 current disk space = 2823465234432 free memory = 1581389848 ERR1864448 SRAfilesize 4afd29aa0728c7135616afc0301f765f ERR1864448.sra ERR1864448.sra file validated ERR1864448 is paired end ERR1864448 is conventional basespace ERR1864448 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864448_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.60875 34.0 31.0 34.0 30.0 34.0 2 32.07075 34.0 31.0 34.0 30.0 34.0 3 32.3815 34.0 31.0 34.0 30.0 34.0 4 35.80225 37.0 35.0 37.0 35.0 37.0 5 35.4665 37.0 35.0 37.0 33.0 37.0 6 35.57675 37.0 35.0 37.0 33.0 37.0 7 35.6315 37.0 35.0 37.0 33.0 37.0 8 35.6055 37.0 36.0 37.0 33.0 37.0 9 37.289 39.0 38.0 39.0 35.0 39.0 10-11 37.226375 39.0 38.0 39.0 33.5 39.0 12-13 37.128375 39.0 37.5 39.0 34.0 39.0 14-15 38.579625 41.0 38.5 41.0 34.0 41.0 16-17 38.5385 41.0 38.5 41.0 34.0 41.0 18-19 38.63525 41.0 39.0 41.0 34.0 41.0 20-21 38.440749999999994 41.0 39.0 41.0 34.0 41.0 22-23 38.44 41.0 39.0 41.0 34.0 41.0 24-25 38.3 40.5 38.0 41.0 34.0 41.0 26-27 38.414125 41.0 38.5 41.0 34.0 41.0 28-29 38.2535 41.0 38.0 41.0 33.5 41.0 30-31 38.24525 40.0 38.0 41.0 34.0 41.0 32-33 38.16 40.0 38.0 41.0 33.0 41.0 34-35 38.02875 40.0 38.0 41.0 33.5 41.0 36-37 37.924125000000004 40.0 38.0 41.0 33.0 41.0 38-39 37.91275 40.0 38.0 41.0 33.0 41.0 40-41 37.879000000000005 40.0 38.0 41.0 33.0 41.0 42-43 37.81875 40.0 38.0 41.0 33.0 41.0 44-45 37.697874999999996 40.0 38.0 41.0 32.5 41.0 46-47 37.55575 40.0 38.0 41.0 32.0 41.0 48-49 37.497 40.0 38.0 41.0 32.0 41.0 50-51 37.303875000000005 40.0 37.0 41.0 32.0 41.0 52-53 37.177125 40.0 37.0 41.0 31.0 41.0 54-55 36.913125 40.0 37.0 41.0 31.0 41.0 56-57 36.727000000000004 40.0 36.5 41.0 31.0 41.0 58-59 36.476875 39.0 36.0 41.0 30.0 41.0 60-61 36.257625 39.0 35.5 41.0 29.0 41.0 62-63 36.37875 39.0 36.0 41.0 30.5 41.0 64-65 36.09375 39.0 35.0 40.5 30.0 41.0 66-67 35.7995 38.0 35.0 40.0 29.0 41.0 68-69 35.422375 37.5 35.0 40.0 29.5 41.0 70-71 34.758125 37.0 34.5 39.0 28.0 41.0 72-73 34.38175 36.0 34.0 39.0 28.0 40.5 74-75 33.752875 35.5 33.5 38.5 27.0 39.5 76-77 32.093 34.5 31.5 36.5 25.5 39.0 78-79 32.94325 35.0 33.0 37.0 26.5 39.0 80-81 32.826750000000004 35.0 33.5 36.5 26.0 38.0 82-83 32.54575 35.0 33.5 36.0 26.5 37.0 84-85 32.298 35.0 33.0 36.0 26.5 37.0 86-87 32.0035 35.0 33.0 35.0 26.0 36.5 88-89 31.694625000000002 35.0 33.0 35.0 25.5 36.0 90-91 31.47925 35.0 33.0 35.0 25.0 36.0 92-93 31.262 35.0 32.5 35.0 24.5 35.5 94-95 30.93325 35.0 32.0 35.0 21.0 35.0 96-97 30.67375 35.0 32.0 35.0 19.5 35.0 98-99 30.512875 35.0 32.0 35.0 18.0 35.0 100-101 29.464624999999998 33.5 30.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 21.0 3 12.0 4 9.0 5 6.0 6 3.0 7 4.0 8 3.0 9 5.0 10 5.0 11 7.0 12 6.0 13 14.0 14 3.0 15 11.0 16 15.0 17 10.0 18 14.0 19 8.0 20 13.0 21 18.0 22 21.0 23 13.0 24 13.0 25 26.0 26 22.0 27 26.0 28 41.0 29 40.0 30 61.0 31 57.0 32 89.0 33 105.0 34 154.0 35 228.0 36 388.0 37 863.0 38 1413.0 39 253.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.54255047278303 9.608995655507284 8.893432149246102 51.95502172246358 2 19.3 16.35 40.75 23.599999999999998 3 20.05 20.325 25.05 34.575 4 22.3 29.799999999999997 21.099999999999998 26.8 5 22.25 33.575 25.8 18.375 6 17.025000000000002 34.300000000000004 27.500000000000004 21.175 7 13.675 24.65 42.95 18.725 8 15.475 24.575 34.675 25.275 9 16.8 23.150000000000002 36.275 23.775 10-11 18.9 34.7125 24.175 22.2125 12-13 19.5875 26.275 29.325000000000003 24.8125 14-15 18.725 28.65 28.299999999999997 24.325 16-17 19.7125 28.7375 27.525 24.025 18-19 20.0875 28.537499999999998 28.050000000000004 23.325000000000003 20-21 19.662499999999998 28.749999999999996 27.85 23.7375 22-23 19.787499999999998 29.1875 28.325 22.7 24-25 19.825 28.65 27.3875 24.1375 26-27 19.1 29.3875 28.037499999999998 23.474999999999998 28-29 19.8 29.3375 28.0625 22.8 30-31 20.7 28.787499999999998 27.3 23.2125 32-33 19.6875 28.725 28.4375 23.150000000000002 34-35 20.225 28.8875 27.787499999999998 23.1 36-37 19.8 28.762500000000003 27.987499999999997 23.45 38-39 20.2125 28.7375 27.8375 23.2125 40-41 19.537499999999998 29.425 27.900000000000002 23.1375 42-43 19.325 28.625 27.375 24.675 44-45 19.35 28.9375 28.175 23.5375 46-47 19.8375 28.625 27.425 24.1125 48-49 19.575 28.15 27.925 24.349999999999998 50-51 19.8125 28.549999999999997 27.3625 24.275 52-53 20.375 29.0875 27.0875 23.45 54-55 19.55 28.849999999999998 28.1 23.5 56-57 20.25 28.525 27.8625 23.3625 58-59 19.625 27.975 28.599999999999998 23.799999999999997 60-61 19.6375 28.6625 27.875 23.825 62-63 20.1625 28.499999999999996 27.8875 23.45 64-65 19.625 28.6625 27.5125 24.2 66-67 19.825 28.812500000000004 27.650000000000002 23.7125 68-69 20.5375 27.55 27.8875 24.025 70-71 19.9875 28.125 27.925 23.962500000000002 72-73 20.05 27.962500000000002 28.7 23.2875 74-75 20.075000000000003 28.199999999999996 28.000000000000004 23.724999999999998 76-77 20.175 29.012500000000003 26.924999999999997 23.8875 78-79 19.975 27.537499999999998 27.800000000000004 24.6875 80-81 20.4875 28.249999999999996 27.6875 23.575 82-83 20.3875 27.487499999999997 27.975 24.15 84-85 21.0375 28.599999999999998 27.05 23.3125 86-87 20.474999999999998 28.000000000000004 27.8375 23.6875 88-89 20.1 29.299999999999997 26.5375 24.0625 90-91 19.8625 29.462500000000002 27.875 22.8 92-93 20.0125 29.775000000000002 26.400000000000002 23.8125 94-95 21.2625 28.425 26.937499999999996 23.375 96-97 21.3 28.925 26.55 23.225 98-99 20.9 28.5625 27.1125 23.425 100-101 20.5 29.525000000000002 27.0625 22.912499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 2.0 24 3.0 25 1.5 26 1.5 27 6.5 28 12.0 29 13.0 30 15.5 31 24.5 32 37.0 33 48.5 34 55.0 35 76.0 36 90.5 37 112.5 38 143.0 39 151.0 40 187.0 41 249.5 42 275.0 43 273.0 44 280.0 45 277.5 46 255.0 47 230.5 48 216.0 49 195.0 50 172.0 51 138.5 52 107.0 53 87.0 54 66.5 55 48.0 56 37.5 57 29.0 58 16.5 59 14.0 60 12.0 61 8.5 62 7.5 63 5.5 64 3.5 65 4.0 66 2.5 67 0.0 68 0.5 69 1.5 70 2.0 71 2.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.175 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.21250000000000002 0.0 0.0 0.0 0.0 74-75 0.3125 0.0 0.0 0.0 0.0 76-77 0.3875 0.0 0.0 0.0 0.0 78-79 0.44999999999999996 0.0 0.0 0.0 0.0 80-81 0.55 0.0 0.0 0.0 0.0 82-83 0.6875 0.0 0.0 0.0 0.0 84-85 0.8375 0.0 0.0 0.0 0.0 86-87 1.0375 0.0 0.0 0.0 0.0 88-89 1.2374999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTGTCT 15 0.00997274 47.481247 40-41 >>END_MODULE ERR1864448 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864448_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.10425 33.0 31.0 34.0 30.0 34.0 2 32.17275 34.0 31.0 34.0 30.0 34.0 3 32.12 34.0 31.0 34.0 30.0 34.0 4 35.57175 37.0 35.0 37.0 33.0 37.0 5 35.59375 37.0 35.0 37.0 33.0 37.0 6 35.5955 37.0 35.0 37.0 33.0 37.0 7 35.6545 37.0 35.0 37.0 33.0 37.0 8 35.533 37.0 36.0 37.0 33.0 37.0 9 36.99975 39.0 37.0 39.0 33.0 39.0 10-11 37.181375 39.0 37.0 39.0 33.5 39.0 12-13 37.17025 39.0 37.0 39.0 33.5 39.0 14-15 38.563874999999996 41.0 38.0 41.0 34.0 41.0 16-17 38.51925 41.0 38.0 41.0 33.5 41.0 18-19 38.564750000000004 41.0 38.5 41.0 34.0 41.0 20-21 38.385125 40.0 38.0 41.0 33.5 41.0 22-23 38.434124999999995 40.0 38.0 41.0 33.5 41.0 24-25 38.122 40.0 38.0 41.0 33.0 41.0 26-27 38.042125 40.0 38.0 41.0 33.0 41.0 28-29 37.959375 40.0 38.0 41.0 32.5 41.0 30-31 37.885125 40.0 38.0 41.0 32.5 41.0 32-33 37.7695 40.0 38.0 41.0 32.0 41.0 34-35 37.69625 40.0 38.0 41.0 32.0 41.0 36-37 37.700625 40.0 38.0 41.0 32.0 41.0 38-39 37.453125 40.0 38.0 41.0 31.0 41.0 40-41 37.394375 40.0 37.5 41.0 30.5 41.0 42-43 37.233374999999995 40.0 37.0 41.0 30.0 41.0 44-45 37.379625000000004 40.0 37.0 41.0 31.0 41.0 46-47 37.084500000000006 40.0 37.0 41.0 30.0 41.0 48-49 37.123875 40.0 37.0 41.0 30.5 41.0 50-51 36.266875 39.0 36.0 40.5 29.0 40.5 52-53 36.27125 39.0 36.0 40.0 30.0 40.5 54-55 36.462375 39.0 35.5 41.0 29.5 41.0 56-57 36.209875 39.0 35.5 41.0 29.0 41.0 58-59 35.9865 39.0 35.0 41.0 28.0 41.0 60-61 35.894875 39.0 35.0 40.5 28.0 41.0 62-63 35.646 38.0 35.0 40.0 28.0 41.0 64-65 35.18537499999999 38.0 34.5 40.0 27.5 41.0 66-67 35.332125000000005 38.0 35.0 40.0 28.0 41.0 68-69 35.043625 37.0 34.5 39.5 28.0 41.0 70-71 34.397375 36.5 34.0 39.0 27.0 41.0 72-73 33.972125 36.0 34.0 39.0 26.0 40.5 74-75 32.93275 35.0 32.5 37.0 24.0 39.0 76-77 33.009375 35.0 33.0 37.0 26.0 39.0 78-79 32.328500000000005 35.0 33.0 36.5 24.0 39.0 80-81 32.250125 35.0 32.5 36.0 25.5 37.0 82-83 31.979125 35.0 33.0 36.0 24.5 37.0 84-85 31.831875 35.0 33.0 35.5 25.0 37.0 86-87 31.71875 35.0 33.0 35.0 25.0 36.0 88-89 31.504875 35.0 33.0 35.0 24.5 36.0 90-91 31.090625 35.0 32.0 35.0 22.0 36.0 92-93 30.968249999999998 35.0 32.0 35.0 21.5 35.5 94-95 30.778 35.0 32.0 35.0 20.5 35.0 96-97 30.407249999999998 35.0 32.0 35.0 17.0 35.0 98-99 30.075375 34.5 31.5 35.0 4.5 35.0 100-101 28.857875 33.5 30.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 3.0 4 4.0 5 6.0 6 2.0 7 3.0 8 6.0 9 9.0 10 5.0 11 8.0 12 11.0 13 10.0 14 17.0 15 15.0 16 16.0 17 8.0 18 8.0 19 17.0 20 25.0 21 19.0 22 15.0 23 17.0 24 30.0 25 25.0 26 43.0 27 42.0 28 54.0 29 52.0 30 66.0 31 72.0 32 88.0 33 143.0 34 173.0 35 241.0 36 395.0 37 925.0 38 1202.0 39 217.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.400000000000002 16.475 15.55 40.575 2 23.325000000000003 24.75 37.65 14.274999999999999 3 20.325 28.025 29.675 21.975 4 23.674999999999997 33.975 21.625 20.724999999999998 5 24.349999999999998 36.25 23.200000000000003 16.2 6 19.950000000000003 38.125 24.075 17.849999999999998 7 18.825 18.95 40.5 21.725 8 20.65 23.175 30.025000000000002 26.150000000000002 9 22.225 23.599999999999998 30.675 23.5 10-11 23.8375 32.1125 23.9125 20.1375 12-13 24.1125 25.887500000000003 26.8375 23.1625 14-15 21.3875 28.462500000000002 28.799999999999997 21.349999999999998 16-17 23.6625 27.500000000000004 27.825 21.0125 18-19 23.825 28.037499999999998 27.3 20.837500000000002 20-21 23.1875 27.825 27.800000000000004 21.1875 22-23 23.3875 28.025 27.800000000000004 20.7875 24-25 23.225 28.499999999999996 28.725 19.55 26-27 22.475 28.9125 28.125 20.4875 28-29 22.7375 28.375 27.6625 21.224999999999998 30-31 23.2125 27.474999999999998 29.299999999999997 20.0125 32-33 23.724999999999998 28.3625 26.8625 21.05 34-35 22.9625 28.449999999999996 28.3125 20.275000000000002 36-37 23.7375 27.675 27.987499999999997 20.599999999999998 38-39 23.674999999999997 28.225 27.500000000000004 20.599999999999998 40-41 23.4375 28.375 28.0625 20.125 42-43 23.35 27.525 28.287499999999998 20.837500000000002 44-45 23.549999999999997 27.650000000000002 28.3625 20.4375 46-47 23.0375 27.187499999999996 28.999999999999996 20.775 48-49 23.4125 28.299999999999997 27.925 20.3625 50-51 23.7125 27.437499999999996 28.0625 20.7875 52-53 23.9875 27.962500000000002 27.875 20.175 54-55 23.474999999999998 27.650000000000002 28.3875 20.4875 56-57 23.150000000000002 28.625 27.8625 20.3625 58-59 23.8625 26.575 28.6375 20.925 60-61 23.7625 28.1375 27.987499999999997 20.1125 62-63 23.200000000000003 28.012500000000003 28.1 20.6875 64-65 23.375 27.85 28.549999999999997 20.225 66-67 24.2 27.55 27.8375 20.4125 68-69 24.524762381190595 27.851425712856425 27.726363181590795 19.89744872436218 70-71 23.474999999999998 28.3625 27.575 20.5875 72-73 23.775 28.199999999999996 27.9125 20.1125 74-75 24.1625 28.3875 27.750000000000004 19.7 76-77 23.5875 28.375 27.224999999999998 20.8125 78-79 24.05 27.224999999999998 27.85 20.875 80-81 24.153019127390923 27.82847855981998 28.116014501812725 19.90248781097637 82-83 23.1 28.1625 27.750000000000004 20.9875 84-85 23.4125 27.725 28.999999999999996 19.8625 86-87 23.89048631078885 27.84098012251531 28.20352544068008 20.06500812601575 88-89 23.9125 27.987499999999997 28.0875 20.0125 90-91 24.515564445555693 28.153519189898734 27.303412926615827 20.02750343792974 92-93 24.0375 28.199999999999996 27.037499999999998 20.724999999999998 94-95 24.1125 28.4 28.0875 19.400000000000002 96-97 24.490306441525952 27.27954971857411 27.604752970606626 20.62539086929331 98-99 24.175 28.775000000000002 27.2625 19.787499999999998 100-101 24.4125 28.825 27.200000000000003 19.5625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 1.0 23 1.0 24 2.0 25 3.0 26 3.0 27 5.0 28 6.0 29 7.0 30 8.5 31 15.0 32 24.0 33 36.0 34 55.0 35 78.5 36 92.0 37 104.0 38 128.0 39 166.5 40 197.0 41 241.0 42 259.5 43 259.0 44 293.5 45 280.5 46 259.0 47 260.5 48 234.0 49 196.5 50 170.5 51 138.0 52 108.5 53 89.0 54 65.5 55 51.0 56 43.0 57 36.5 58 28.0 59 17.5 60 9.5 61 4.5 62 5.5 63 5.0 64 3.0 65 2.0 66 1.0 67 0.5 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 1.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.05 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0125 82-83 0.0 84-85 0.0 86-87 0.0125 88-89 0.0 90-91 0.0125 92-93 0.0 94-95 0.0 96-97 0.0625 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79954898521673 99.575 2 0.17539463793535454 0.35000000000000003 3 0.025056376847907794 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.1875 0.0 0.0 0.0 0.0 74-75 0.2875 0.0 0.0 0.0 0.0 76-77 0.3625 0.0 0.0 0.0 0.0 78-79 0.42500000000000004 0.0 0.0 0.0 0.0 80-81 0.525 0.0 0.0 0.0 0.0 82-83 0.6625 0.0 0.0 0.0 0.0 84-85 0.8 0.0 0.0 0.0 0.0 86-87 0.9875 0.0 0.0 0.0 0.0 88-89 1.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 763094 spots for ERR1864448.sra Written 763094 spots for ERR1864448.sra Read 763094 spots for ERR1864448.sra Written 763094 spots for ERR1864448.sra Read 763094 spots for ERR1864448.sra Written 763094 spots for ERR1864448.sra Read 763094 spots for ERR1864448.sra Written 763094 spots for ERR1864448.sra Read 763094 spots for ERR1864448.sra Written 763094 spots for ERR1864448.sra Read 763094 spots for ERR1864448.sra Written 763094 spots for ERR1864448.sra Read 763094 spots for ERR1864448.sra Written 763094 spots for ERR1864448.sra Read 763108 spots for ERR1864448.sra Written 763108 spots for ERR1864448.sra Read 763094 spots for ERR1864448.sra Written 763094 spots for ERR1864448.sra Read 763094 spots for ERR1864448.sra Written 763094 spots for ERR1864448.sra Read 763094 spots for ERR1864448.sra Written 763094 spots for ERR1864448.sra Read 763094 spots for ERR1864448.sra Written 763094 spots for ERR1864448.sra Read 763094 spots for ERR1864448.sra Written 763094 spots for ERR1864448.sra Read 763094 spots for ERR1864448.sra Written 763094 spots for ERR1864448.sra Read 763094 spots for ERR1864448.sra Written 763094 spots for ERR1864448.sra Read 763094 spots for ERR1864448.sra Written 763094 spots for ERR1864448.sra Read 763094 spots for ERR1864448.sra Written 763094 spots for ERR1864448.sra Read 763094 spots for ERR1864448.sra Written 763094 spots for ERR1864448.sra Read 763094 spots for ERR1864448.sra Written 763094 spots for ERR1864448.sra Read 763094 spots for ERR1864448.sra Written 763094 spots for ERR1864448.sra SRR ids: ['ERR1864448.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m3cvkyv0 ERR1864448.sra spots: 15261894 blocks: [[1, 763094], [763095, 1526188], [1526189, 2289282], [2289283, 3052376], [3052377, 3815470], [3815471, 4578564], [4578565, 5341658], [5341659, 6104752], [6104753, 6867846], [6867847, 7630940], [7630941, 8394034], [8394035, 9157128], [9157129, 9920222], [9920223, 10683316], [10683317, 11446410], [11446411, 12209504], [12209505, 12972598], [12972599, 13735692], [13735693, 14498786], [14498787, 15261894]] ERR1864448 file size 3659635 ERR1864448 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864448 ERR1864448_1.fastq ERR1864448_2.fastq Input file: ERR1864448_1.fastq Paired file: ERR1864448_2.fastq trimmed: ERR1864448-trimmed-pair1.fastq, ERR1864448-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Apr 10 14:25:18 2025 >> started Thu Apr 10 14:25:32 2025 >> done (13.847s) 15261894 read pairs processed; of these: 166103 ( 1.09%) short read pairs filtered out after trimming by size control 181839 ( 1.19%) empty read pairs filtered out after trimming by size control 14913952 (97.72%) read pairs available; of these: 3695293 (24.78%) trimmed read pairs available after processing 11218659 (75.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 92 0.00% 19 218 0.00% 20 314 0.00% 21 411 0.00% 22 506 0.00% 23 669 0.00% 24 788 0.01% 25 1025 0.01% 26 1161 0.01% 27 1355 0.01% 28 1574 0.01% 29 1790 0.01% 30 1994 0.01% 31 2387 0.02% 32 2532 0.02% 33 2911 0.02% 34 3281 0.02% 35 3580 0.02% 36 3918 0.03% 37 4082 0.03% 38 4555 0.03% 39 4846 0.03% 40 5145 0.03% 41 5470 0.04% 42 5845 0.04% 43 6327 0.04% 44 6522 0.04% 45 6824 0.05% 46 7424 0.05% 47 7545 0.05% 48 8047 0.05% 49 8403 0.06% 50 8830 0.06% 51 9299 0.06% 52 9731 0.07% 53 10059 0.07% 54 10508 0.07% 55 11186 0.08% 56 11666 0.08% 57 12383 0.08% 58 13042 0.09% 59 15672 0.11% 60 18302 0.12% 61 18851 0.13% 62 19311 0.13% 63 20300 0.14% 64 21067 0.14% 65 22160 0.15% 66 23052 0.15% 67 23959 0.16% 68 25046 0.17% 69 26205 0.18% 70 27383 0.18% 71 28510 0.19% 72 30727 0.21% 73 32549 0.22% 74 33710 0.23% 75 35236 0.24% 76 34698 0.23% 77 36729 0.25% 78 37861 0.25% 79 39370 0.26% 80 40965 0.27% 81 43187 0.29% 82 45953 0.31% 83 48492 0.33% 84 52126 0.35% 85 56377 0.38% 86 59987 0.40% 87 65356 0.44% 88 65371 0.44% 89 68996 0.46% 90 76828 0.52% 91 84923 0.57% 92 94834 0.64% 93 105335 0.71% 94 119618 0.80% 95 139001 0.93% 96 166076 1.11% 97 205327 1.38% 98 276635 1.85% 99 383791 2.57% 100 717172 4.81% 101 11218659 75.22% 14913952 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=4.77 fanout-score-rank=20 prefix-density=0.26 prefix-fanout=3.1 sequence=TCCTTGTCCTGGATCTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=13 fanout-score=310.42 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=31.2 sequence=TTCTTCTTCTTTTT criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=29 prefix-density=0.14 prefix-fanout=2.0 sequence=CCAGACCAGCAGAGG criterion=fanout-score sequence-density=0.07 sequence-density-rank=15 fanout-score=353.50 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=30.0 sequence=AAGAAGAAGAAG ERR1864448 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 10 14:26:04 Started mapping on | Apr 10 14:26:04 Finished on | Apr 10 14:26:46 Mapping speed, Million of reads per hour | 1278.34 Number of input reads | 14913952 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 14267269 Uniquely mapped reads % | 95.66% Average mapped length | 195.76 Number of splices: Total | 8179225 Number of splices: Annotated (sjdb) | 7995248 Number of splices: GT/AG | 8040930 Number of splices: GC/AG | 114145 Number of splices: AT/AC | 11506 Number of splices: Non-canonical | 12644 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 2.15 Insertion rate per base | 0.01% Insertion average length | 1.74 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 361945 % of reads mapped to multiple loci | 2.43% Number of reads mapped to too many loci | 44965 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.58% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 300353 300353 300353 N_multimapping 361945 361945 361945 N_noFeature 419733 14109467 516682 N_ambiguous 119789 752 58419 UnstrandedReadsAssigned:13727747 PositiveStrandReadsAssigned:157050 NegativeStrandReadsAssigned:13692168 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864448 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864448-trimmed-pair1.fastq ERR1864448-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,913,952 reads, 13,876,758 reads pseudoaligned [quant] estimated average fragment length: 168.948 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,043 rounds 52401 ERR1864448.ke.tsv 34699 ERR1864448.se.tsv 87100 total ==> ERR1864448.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1850.05 1218 49.8951 Potri.005G024800.1.v4.1 1035 867.052 542 47.375 Potri.004G059700.1.v4.1 961 793.052 52 4.96931 Potri.007G009000.2.v4.1 1416 1248.05 0 0 Potri.003G141000.2.v4.1 2943 2775.05 949 25.9173 Potri.016G087400.1.v4.1 270 113.997 1205.41 801.379 Potri.015G069301.1.v4.1 564 396.322 0 0 Potri.010G195200.1.v4.1 1773 1605.05 88 4.15517 Potri.012G127500.1.v4.1 977 809.052 4513 422.75 ==> ERR1864448.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 135 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 186 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 44 ERR1864448 completed mapping pipeline successfully