Starting /dee2/code/volunteer_pipeline.sh ERR1864449 current disk space = 2823687409664 free memory = 1579650916 ERR1864449 SRAfilesize 89fea6f26d7770407b0f6a582a9c91dd ERR1864449.sra ERR1864449.sra file validated ERR1864449 is paired end ERR1864449 is conventional basespace ERR1864449 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864449_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.57775 34.0 31.0 34.0 30.0 34.0 2 31.9875 34.0 31.0 34.0 30.0 34.0 3 32.25975 34.0 31.0 34.0 30.0 34.0 4 35.751 37.0 35.0 37.0 35.0 37.0 5 35.38875 37.0 35.0 37.0 33.0 37.0 6 35.46125 37.0 35.0 37.0 33.0 37.0 7 35.5455 37.0 35.0 37.0 35.0 37.0 8 35.473 37.0 35.0 37.0 33.0 37.0 9 37.18475 39.0 38.0 39.0 34.0 39.0 10-11 37.1705 39.0 37.5 39.0 34.0 39.0 12-13 36.986625000000004 39.0 37.5 39.0 33.0 39.0 14-15 38.4745 41.0 38.5 41.0 33.5 41.0 16-17 38.454875 41.0 38.0 41.0 34.0 41.0 18-19 38.477000000000004 41.0 39.0 41.0 34.0 41.0 20-21 38.309375 41.0 38.5 41.0 34.0 41.0 22-23 38.261750000000006 40.0 38.0 41.0 33.5 41.0 24-25 38.181375 40.0 38.0 41.0 33.5 41.0 26-27 38.258375 41.0 38.0 41.0 34.0 41.0 28-29 38.177125000000004 40.5 38.0 41.0 33.0 41.0 30-31 38.146375 40.0 38.0 41.0 33.5 41.0 32-33 38.006249999999994 40.0 38.0 41.0 33.0 41.0 34-35 37.84075 40.0 38.0 41.0 32.5 41.0 36-37 37.860375000000005 40.0 38.0 41.0 33.0 41.0 38-39 37.79525 40.0 38.0 41.0 33.0 41.0 40-41 37.741749999999996 40.0 38.0 41.0 33.0 41.0 42-43 37.69625 40.0 38.0 41.0 33.0 41.0 44-45 37.539125 40.0 38.0 41.0 32.0 41.0 46-47 37.440375 40.0 38.0 41.0 31.5 41.0 48-49 37.405625 40.0 37.0 41.0 32.0 41.0 50-51 37.189375 40.0 37.0 41.0 31.0 41.0 52-53 37.104 40.0 37.0 41.0 31.5 41.0 54-55 36.87475 40.0 36.5 41.0 31.0 41.0 56-57 36.6275 39.5 36.0 41.0 30.0 41.0 58-59 36.42275 39.0 36.0 41.0 30.0 41.0 60-61 36.263625 39.0 35.5 41.0 29.5 41.0 62-63 36.325125 39.0 35.0 41.0 30.5 41.0 64-65 36.04075 39.0 35.0 40.5 30.0 41.0 66-67 35.7205 38.0 35.0 40.0 29.5 41.0 68-69 35.415875 37.5 35.0 40.0 29.0 41.0 70-71 34.697874999999996 36.5 34.0 39.0 28.5 41.0 72-73 34.28 36.0 34.0 39.0 28.0 40.5 74-75 33.675375 35.5 33.5 38.0 27.0 39.5 76-77 32.049125000000004 34.5 31.5 36.0 26.0 39.0 78-79 32.831500000000005 35.0 33.0 37.0 26.0 39.0 80-81 32.748125 35.0 33.0 36.5 26.0 38.0 82-83 32.499750000000006 35.0 33.0 36.0 26.0 37.0 84-85 32.2405 35.0 33.0 36.0 26.0 37.0 86-87 31.839 35.0 33.0 35.0 25.5 36.0 88-89 31.64425 35.0 33.0 35.0 25.0 36.0 90-91 31.493125 35.0 33.0 35.0 25.0 36.0 92-93 31.25625 35.0 32.5 35.0 24.5 35.5 94-95 31.114625 35.0 32.0 35.0 24.0 35.0 96-97 30.908 35.0 32.0 35.0 23.5 35.0 98-99 30.703375 34.5 32.0 35.0 21.5 35.0 100-101 29.597875000000002 33.5 30.5 34.5 10.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 32.0 3 12.0 4 7.0 5 4.0 6 5.0 7 10.0 8 4.0 9 5.0 10 5.0 11 6.0 12 4.0 13 8.0 14 8.0 15 7.0 16 3.0 17 13.0 18 16.0 19 13.0 20 16.0 21 15.0 22 11.0 23 19.0 24 17.0 25 16.0 26 12.0 27 19.0 28 33.0 29 55.0 30 50.0 31 71.0 32 111.0 33 106.0 34 171.0 35 261.0 36 398.0 37 823.0 38 1417.0 39 217.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.65993352083866 10.636665814369726 8.616722065967783 51.08667859882383 2 20.025000000000002 15.975 40.849999999999994 23.150000000000002 3 18.925 20.775 25.5 34.8 4 23.45 29.625 20.625 26.3 5 21.025 34.025 25.074999999999996 19.875 6 16.325 35.175 26.974999999999998 21.525 7 12.950000000000001 25.424999999999997 42.95 18.675 8 17.299999999999997 24.15 32.5 26.05 9 17.25 23.474999999999998 35.55 23.724999999999998 10-11 19.6125 33.125 24.9875 22.275 12-13 20.2625 26.474999999999998 28.475 24.7875 14-15 18.825 27.6875 29.349999999999998 24.1375 16-17 19.5 28.512500000000003 28.325 23.6625 18-19 20.2875 27.925 27.825 23.962500000000002 20-21 19.8875 28.925 27.875 23.3125 22-23 20.0375 28.475 28.212500000000002 23.275000000000002 24-25 18.775 28.9875 28.1875 24.05 26-27 20.0125 29.4375 27.287499999999998 23.2625 28-29 20.200000000000003 28.3375 27.900000000000002 23.5625 30-31 19.675 28.5875 28.050000000000004 23.6875 32-33 20.349999999999998 28.5875 27.0625 24.0 34-35 20.2625 28.8875 27.275 23.575 36-37 19.6125 28.95 26.6625 24.775 38-39 20.45 28.199999999999996 27.925 23.425 40-41 20.3875 28.999999999999996 27.037499999999998 23.575 42-43 19.3625 28.15 27.474999999999998 25.0125 44-45 19.950000000000003 27.075 29.275000000000002 23.7 46-47 20.3 27.3375 29.062500000000004 23.3 48-49 19.9125 28.299999999999997 27.1375 24.65 50-51 19.9875 27.9125 28.5625 23.5375 52-53 20.1 29.549999999999997 27.3375 23.0125 54-55 20.05 29.025000000000002 27.5125 23.4125 56-57 20.724999999999998 28.175 27.787499999999998 23.3125 58-59 20.3125 28.225 28.349999999999998 23.1125 60-61 20.175 28.3375 28.1625 23.325000000000003 62-63 20.2375 28.575 28.3625 22.825 64-65 20.2125 28.0625 28.3875 23.3375 66-67 20.6375 28.1375 27.900000000000002 23.325000000000003 68-69 20.3 28.7375 27.0125 23.95 70-71 20.25 29.012500000000003 26.7625 23.974999999999998 72-73 20.525 28.212500000000002 28.15 23.1125 74-75 21.224999999999998 27.8125 28.0875 22.875 76-77 21.25 28.712500000000002 26.9125 23.125 78-79 19.7625 28.3875 27.750000000000004 24.099999999999998 80-81 20.9375 27.3875 27.6375 24.0375 82-83 20.0 28.6125 27.712500000000002 23.674999999999997 84-85 20.2125 28.537499999999998 26.424999999999997 24.825 86-87 20.8 28.499999999999996 26.637499999999996 24.0625 88-89 20.2875 28.375 28.4125 22.925 90-91 21.3 27.875 27.287499999999998 23.5375 92-93 20.599999999999998 28.075 27.6875 23.6375 94-95 21.4 27.6125 27.3625 23.625 96-97 20.9125 29.2 26.75 23.1375 98-99 20.6625 28.262500000000003 27.3625 23.7125 100-101 20.724999999999998 28.075 27.275 23.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 1.0 25 1.0 26 2.5 27 5.0 28 10.0 29 16.5 30 19.0 31 19.5 32 26.5 33 40.0 34 55.5 35 71.0 36 88.5 37 107.0 38 128.5 39 168.0 40 197.5 41 216.5 42 255.0 43 283.5 44 279.5 45 284.0 46 280.5 47 252.5 48 226.0 49 194.0 50 152.0 51 125.0 52 101.5 53 80.5 54 71.5 55 51.0 56 37.5 57 32.5 58 30.5 59 24.0 60 16.0 61 12.0 62 8.5 63 6.0 64 5.5 65 4.5 66 2.0 67 1.5 68 1.5 69 2.5 70 1.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.225 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.16249999999999998 0.0 0.0 0.0 0.0 70-71 0.1875 0.0 0.0 0.0 0.0 72-73 0.23750000000000002 0.0 0.0 0.0 0.0 74-75 0.325 0.0 0.0 0.0 0.0 76-77 0.42500000000000004 0.0 0.0 0.0 0.0 78-79 0.4875 0.0 0.0 0.0 0.0 80-81 0.5875 0.0 0.0 0.0 0.0 82-83 0.8 0.0 0.0 0.0 0.0 84-85 0.9874999999999999 0.0 0.0 0.0 0.0 86-87 1.2125 0.0 0.0 0.0 0.0 88-89 1.5499999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATCAGA 15 0.009967554 47.487495 78-79 >>END_MODULE ERR1864449 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864449_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.05575 33.0 31.0 34.0 30.0 34.0 2 32.181 34.0 31.0 34.0 30.0 34.0 3 32.059 34.0 31.0 34.0 30.0 34.0 4 35.51325 37.0 35.0 37.0 33.0 37.0 5 35.52975 37.0 35.0 37.0 33.0 37.0 6 35.57775 37.0 35.0 37.0 33.0 37.0 7 35.586 37.0 36.0 37.0 33.0 37.0 8 35.51825 37.0 36.0 37.0 33.0 37.0 9 37.03575 39.0 37.0 39.0 33.0 39.0 10-11 37.122375000000005 39.0 37.5 39.0 34.0 39.0 12-13 37.060125 39.0 37.5 39.0 33.5 39.0 14-15 38.50425 41.0 38.0 41.0 34.0 41.0 16-17 38.42075 41.0 38.0 41.0 33.5 41.0 18-19 38.428375 41.0 38.5 41.0 34.0 41.0 20-21 38.407 41.0 38.0 41.0 34.0 41.0 22-23 38.37575 40.5 38.0 41.0 34.0 41.0 24-25 37.9925 40.0 38.0 41.0 33.0 41.0 26-27 37.919624999999996 40.0 38.0 41.0 32.0 41.0 28-29 37.853125000000006 40.0 38.0 41.0 33.0 41.0 30-31 37.852125 40.0 38.0 41.0 32.5 41.0 32-33 37.7515 40.0 38.0 41.0 32.5 41.0 34-35 37.615875 40.0 38.0 41.0 31.5 41.0 36-37 37.540375 40.0 38.0 41.0 32.0 41.0 38-39 37.42325 40.0 38.0 41.0 31.5 41.0 40-41 37.430499999999995 40.0 38.0 41.0 30.5 41.0 42-43 37.20625 40.0 37.0 41.0 30.5 41.0 44-45 37.239875 40.0 37.5 41.0 31.0 41.0 46-47 37.047875 40.0 37.0 41.0 30.5 41.0 48-49 37.035 40.0 37.0 41.0 31.0 41.0 50-51 36.208375000000004 39.0 36.0 40.5 29.5 40.5 52-53 36.13775 39.0 36.0 40.0 29.5 41.0 54-55 36.48125 39.0 36.0 41.0 30.0 41.0 56-57 36.244375 39.0 35.5 41.0 28.5 41.0 58-59 36.021375000000006 39.0 35.0 41.0 28.5 41.0 60-61 35.7945 39.0 35.0 40.5 28.0 41.0 62-63 35.561 38.0 35.0 40.0 28.0 41.0 64-65 35.248625 38.0 34.5 40.0 28.0 41.0 66-67 35.20275 37.5 34.5 40.0 28.0 41.0 68-69 34.88825 37.0 35.0 39.5 28.0 41.0 70-71 34.321625 36.0 34.0 39.0 27.5 41.0 72-73 34.025375 36.0 34.0 39.0 27.0 40.5 74-75 32.865875 35.0 33.0 37.0 23.0 39.0 76-77 32.999750000000006 35.0 33.0 37.0 26.0 39.0 78-79 32.25575 35.0 32.0 36.5 24.5 38.5 80-81 32.250625 35.0 33.0 36.0 25.0 37.0 82-83 31.882749999999998 35.0 32.5 36.0 24.5 37.0 84-85 31.69175 35.0 32.5 35.0 25.0 36.5 86-87 31.65625 35.0 33.0 35.0 25.0 36.0 88-89 31.411875 35.0 33.0 35.0 24.0 36.0 90-91 31.090375 35.0 32.0 35.0 23.0 35.5 92-93 30.937375000000003 35.0 32.0 35.0 21.5 35.0 94-95 30.6935 35.0 32.0 35.0 19.0 35.0 96-97 30.374 35.0 32.0 35.0 17.0 35.0 98-99 30.050375 34.5 31.5 35.0 2.0 35.0 100-101 28.7675 33.5 29.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 28.0 3 4.0 4 3.0 5 3.0 6 5.0 7 3.0 8 3.0 9 9.0 10 12.0 11 11.0 12 12.0 13 4.0 14 9.0 15 11.0 16 9.0 17 8.0 18 16.0 19 16.0 20 18.0 21 12.0 22 15.0 23 21.0 24 32.0 25 22.0 26 31.0 27 28.0 28 58.0 29 47.0 30 67.0 31 91.0 32 104.0 33 121.0 34 185.0 35 248.0 36 423.0 37 932.0 38 1200.0 39 179.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.349999999999998 16.05 14.149999999999999 41.449999999999996 2 22.35 24.975 38.025 14.649999999999999 3 19.55 28.975 29.299999999999997 22.175 4 22.775000000000002 34.175 22.125 20.925 5 23.75 35.925000000000004 22.975 17.349999999999998 6 18.825 38.35 24.0 18.825 7 19.15 18.55 39.4 22.900000000000002 8 19.6 23.549999999999997 30.725 26.125 9 22.8 22.6 30.349999999999998 24.25 10-11 23.3 32.1125 23.9375 20.65 12-13 23.825 25.3125 27.275 23.5875 14-15 22.375 28.599999999999998 28.075 20.95 16-17 23.599999999999998 27.375 28.249999999999996 20.775 18-19 23.225 27.700000000000003 27.3625 21.712500000000002 20-21 22.9625 28.125 28.1125 20.8 22-23 22.875 28.199999999999996 28.025 20.9 24-25 23.0875 28.7 27.150000000000002 21.0625 26-27 23.65 29.15 27.0125 20.1875 28-29 23.5875 27.6875 28.212500000000002 20.5125 30-31 23.325000000000003 28.1375 27.5875 20.95 32-33 23.625 28.7375 27.237499999999997 20.4 34-35 23.8375 27.224999999999998 27.55 21.3875 36-37 23.575 28.875 26.987499999999997 20.5625 38-39 23.200000000000003 28.9 26.9125 20.9875 40-41 23.1875 27.375 28.050000000000004 21.3875 42-43 23.0875 27.650000000000002 27.775 21.4875 44-45 23.8125 28.425 27.712500000000002 20.05 46-47 23.849999999999998 28.6375 26.75 20.7625 48-49 23.474999999999998 27.8875 27.85 20.7875 50-51 23.6875 29.099999999999998 27.275 19.9375 52-53 24.275 26.825 28.4 20.5 54-55 22.75 27.962500000000002 28.262500000000003 21.025 56-57 24.1375 27.900000000000002 27.875 20.0875 58-59 23.5625 28.3125 27.962500000000002 20.1625 60-61 23.599999999999998 28.5625 26.724999999999998 21.1125 62-63 23.2875 26.75 28.125 21.837500000000002 64-65 23.225 28.1875 27.700000000000003 20.8875 66-67 23.5375 28.287499999999998 28.237499999999997 19.9375 68-69 23.80595148787197 27.969492373093274 27.506876719179797 20.717679419854964 70-71 24.099999999999998 27.962500000000002 27.1375 20.8 72-73 23.4875 27.3 27.400000000000002 21.8125 74-75 23.9875 28.749999999999996 27.575 19.6875 76-77 24.099999999999998 28.299999999999997 27.55 20.05 78-79 23.275000000000002 27.762500000000003 28.000000000000004 20.962500000000002 80-81 23.4625 28.5625 27.0875 20.8875 82-83 23.4875 27.0125 28.4125 21.087500000000002 84-85 23.9875 27.462500000000002 27.6 20.95 86-87 23.50587646911728 27.906976744186046 28.419604901225306 20.16754188547137 88-89 24.5 28.075 27.237499999999997 20.1875 90-91 23.35 27.962500000000002 27.875 20.8125 92-93 23.5875 28.1125 27.825 20.474999999999998 94-95 24.65 27.625 27.537499999999998 20.1875 96-97 23.518379594898725 28.33208302075519 27.419354838709676 20.730182545636406 98-99 24.8 29.049999999999997 26.7125 19.4375 100-101 24.85 28.025 27.425 19.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 2.0 25 2.0 26 1.0 27 4.5 28 4.5 29 6.5 30 12.0 31 19.5 32 28.0 33 33.5 34 46.0 35 63.5 36 85.0 37 109.5 38 129.0 39 166.5 40 197.5 41 217.5 42 242.5 43 267.5 44 289.5 45 298.0 46 296.5 47 260.5 48 223.0 49 187.0 50 156.5 51 138.0 52 109.5 53 86.5 54 68.0 55 49.5 56 41.0 57 32.0 58 25.0 59 22.5 60 17.5 61 15.5 62 8.5 63 6.5 64 8.0 65 5.5 66 3.5 67 3.5 68 2.0 69 1.0 70 0.5 71 1.0 72 2.0 73 1.0 74 0.5 75 0.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.025 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.025 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.025 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8246492985972 99.625 2 0.15030060120240482 0.3 3 0.0250501002004008 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.16249999999999998 0.0 0.0 0.0 0.0 70-71 0.1875 0.0 0.0 0.0 0.0 72-73 0.23750000000000002 0.0 0.0 0.0 0.0 74-75 0.325 0.0 0.0 0.0 0.0 76-77 0.42500000000000004 0.0 0.0 0.0 0.0 78-79 0.4875 0.0 0.0 0.0 0.0 80-81 0.5875 0.0 0.0 0.0 0.0 82-83 0.8 0.0 0.0 0.0 0.0 84-85 0.9625 0.0 0.0 0.0 0.0 86-87 1.2 0.0 0.0 0.0 0.0 88-89 1.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 845697 spots for ERR1864449.sra Written 845697 spots for ERR1864449.sra Read 845697 spots for ERR1864449.sra Written 845697 spots for ERR1864449.sra Read 845697 spots for ERR1864449.sra Written 845697 spots for ERR1864449.sra Read 845697 spots for ERR1864449.sra Written 845697 spots for ERR1864449.sra Read 845697 spots for ERR1864449.sra Written 845697 spots for ERR1864449.sra Read 845697 spots for ERR1864449.sra Written 845697 spots for ERR1864449.sra Read 845697 spots for ERR1864449.sra Written 845697 spots for ERR1864449.sra Read 845697 spots for ERR1864449.sra Written 845697 spots for ERR1864449.sra Read 845697 spots for ERR1864449.sra Written 845697 spots for ERR1864449.sra Read 845697 spots for ERR1864449.sra Written 845697 spots for ERR1864449.sra Read 845697 spots for ERR1864449.sra Written 845697 spots for ERR1864449.sra Read 845697 spots for ERR1864449.sra Written 845697 spots for ERR1864449.sra Read 845697 spots for ERR1864449.sra Written 845697 spots for ERR1864449.sra Read 845715 spots for ERR1864449.sra Written 845715 spots for ERR1864449.sra Read 845697 spots for ERR1864449.sra Written 845697 spots for ERR1864449.sra Read 845697 spots for ERR1864449.sra Written 845697 spots for ERR1864449.sra Read 845697 spots for ERR1864449.sra Written 845697 spots for ERR1864449.sra Read 845697 spots for ERR1864449.sra Written 845697 spots for ERR1864449.sra Read 845697 spots for ERR1864449.sra Written 845697 spots for ERR1864449.sra Read 845697 spots for ERR1864449.sra Written 845697 spots for ERR1864449.sra SRR ids: ['ERR1864449.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jb22q6n9 ERR1864449.sra spots: 16913958 blocks: [[1, 845697], [845698, 1691394], [1691395, 2537091], [2537092, 3382788], [3382789, 4228485], [4228486, 5074182], [5074183, 5919879], [5919880, 6765576], [6765577, 7611273], [7611274, 8456970], [8456971, 9302667], [9302668, 10148364], [10148365, 10994061], [10994062, 11839758], [11839759, 12685455], [12685456, 13531152], [13531153, 14376849], [14376850, 15222546], [15222547, 16068243], [16068244, 16913958]] ERR1864449 file size 4058131 ERR1864449 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864449 ERR1864449_1.fastq ERR1864449_2.fastq Input file: ERR1864449_1.fastq Paired file: ERR1864449_2.fastq trimmed: ERR1864449-trimmed-pair1.fastq, ERR1864449-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Apr 10 13:15:58 2025 >> started Thu Apr 10 13:16:14 2025 >> done (15.128s) 16913958 read pairs processed; of these: 182999 ( 1.08%) short read pairs filtered out after trimming by size control 211025 ( 1.25%) empty read pairs filtered out after trimming by size control 16519934 (97.67%) read pairs available; of these: 4071041 (24.64%) trimmed read pairs available after processing 12448893 (75.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 117 0.00% 19 216 0.00% 20 344 0.00% 21 428 0.00% 22 595 0.00% 23 715 0.00% 24 831 0.01% 25 1076 0.01% 26 1258 0.01% 27 1429 0.01% 28 1656 0.01% 29 1875 0.01% 30 2249 0.01% 31 2575 0.02% 32 2851 0.02% 33 3123 0.02% 34 3383 0.02% 35 3744 0.02% 36 4064 0.02% 37 4476 0.03% 38 4737 0.03% 39 5201 0.03% 40 5533 0.03% 41 5837 0.04% 42 6144 0.04% 43 6566 0.04% 44 7145 0.04% 45 7489 0.05% 46 7771 0.05% 47 8104 0.05% 48 8649 0.05% 49 9082 0.05% 50 9443 0.06% 51 9832 0.06% 52 10202 0.06% 53 10847 0.07% 54 11219 0.07% 55 11897 0.07% 56 12522 0.08% 57 13265 0.08% 58 14086 0.09% 59 17040 0.10% 60 19523 0.12% 61 20592 0.12% 62 21243 0.13% 63 21997 0.13% 64 22969 0.14% 65 23915 0.14% 66 25210 0.15% 67 25990 0.16% 68 27519 0.17% 69 28717 0.17% 70 29938 0.18% 71 31504 0.19% 72 33490 0.20% 73 35577 0.22% 74 36989 0.22% 75 38837 0.24% 76 38329 0.23% 77 40680 0.25% 78 42059 0.25% 79 44259 0.27% 80 45813 0.28% 81 48292 0.29% 82 51408 0.31% 83 54962 0.33% 84 58094 0.35% 85 64001 0.39% 86 67239 0.41% 87 73412 0.44% 88 74445 0.45% 89 78221 0.47% 90 86478 0.52% 91 95380 0.58% 92 105561 0.64% 93 117840 0.71% 94 133718 0.81% 95 154640 0.94% 96 183871 1.11% 97 227708 1.38% 98 301229 1.82% 99 418596 2.53% 100 781180 4.73% 101 12448893 75.36% 16519934 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=4.29 fanout-score-rank=22 prefix-density=0.26 prefix-fanout=2.8 sequence=TCCTTGTCCTGGATCTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=12 fanout-score=310.00 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=27.2 sequence=CTTCTTCTTCTC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=3.48 fanout-score-rank=20 prefix-density=0.22 prefix-fanout=3.0 sequence=GGTGCTGAGAATGGCTGCAAGTGTGGATCAAACTGCACCTGTGATCCATGCTCCTGCAAATGAGGACACATGGACATGGTTCCAACAAAGCAGTAGTTAATCTATCAGTTGGTCAGCTCATGTTTGTATAATGGTGCTTGTTGTTAAATAATAATAAACAGCAAAGGGTTCCT criterion=fanout-score sequence-density=0.06 sequence-density-rank=18 fanout-score=372.03 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=30.2 sequence=AAGAAGAAGAAG ERR1864449 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 10 13:16:52 Started mapping on | Apr 10 13:16:52 Finished on | Apr 10 13:17:38 Mapping speed, Million of reads per hour | 1292.86 Number of input reads | 16519934 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 15799609 Uniquely mapped reads % | 95.64% Average mapped length | 195.81 Number of splices: Total | 9044169 Number of splices: Annotated (sjdb) | 8847745 Number of splices: GT/AG | 8892583 Number of splices: GC/AG | 125356 Number of splices: AT/AC | 12133 Number of splices: Non-canonical | 14097 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.02% Deletion average length | 2.19 Insertion rate per base | 0.01% Insertion average length | 1.76 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 415868 % of reads mapped to multiple loci | 2.52% Number of reads mapped to too many loci | 49858 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.51% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 321239 321239 321239 N_multimapping 415868 415868 415868 N_noFeature 462746 15636563 559305 N_ambiguous 133094 830 66059 UnstrandedReadsAssigned:15203769 PositiveStrandReadsAssigned:162216 NegativeStrandReadsAssigned:15174245 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864449 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864449-trimmed-pair1.fastq ERR1864449-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,519,934 reads, 15,385,432 reads pseudoaligned [quant] estimated average fragment length: 166.154 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,045 rounds 52401 ERR1864449.ke.tsv 34699 ERR1864449.se.tsv 87100 total ==> ERR1864449.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1852.85 1499 55.1568 Potri.005G024800.1.v4.1 1035 869.846 644 50.4755 Potri.004G059700.1.v4.1 961 795.851 34 2.91262 Potri.007G009000.2.v4.1 1416 1250.85 0 0 Potri.003G141000.2.v4.1 2943 2777.85 1079.66 26.4981 Potri.016G087400.1.v4.1 270 115.773 1411 830.915 Potri.015G069301.1.v4.1 564 399.026 0 0 Potri.010G195200.1.v4.1 1773 1607.85 95 4.02825 Potri.012G127500.1.v4.1 977 811.851 5311 446.002 ==> ERR1864449.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 118 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 225 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 63 ERR1864449 completed mapping pipeline successfully