Starting /dee2/code/volunteer_pipeline.sh ERR1864450 current disk space = 3092251250688 free memory = 1574602824 ERR1864450 SRAfilesize 6e5fb4f80bad84b4884dca1e0da89d63 ERR1864450.sra ERR1864450.sra file validated ERR1864450 is paired end ERR1864450 is conventional basespace ERR1864450 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864450_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.5905 33.0 31.0 34.0 30.0 34.0 2 31.843 34.0 31.0 34.0 30.0 34.0 3 32.15325 34.0 31.0 34.0 30.0 34.0 4 35.53275 37.0 35.0 37.0 33.0 37.0 5 35.22525 37.0 35.0 37.0 33.0 37.0 6 35.305 37.0 35.0 37.0 33.0 37.0 7 35.265 37.0 35.0 37.0 33.0 37.0 8 35.23125 37.0 35.0 37.0 33.0 37.0 9 36.8325 39.0 37.0 39.0 33.0 39.0 10-11 36.724000000000004 39.0 37.0 39.0 32.5 39.0 12-13 36.701499999999996 39.0 37.0 39.0 33.0 39.0 14-15 37.97475 40.0 38.0 41.0 33.0 41.0 16-17 37.68375 40.0 38.0 41.0 32.5 41.0 18-19 37.763875 40.0 38.0 41.0 32.5 41.0 20-21 37.652 40.0 38.0 41.0 32.0 41.0 22-23 37.650125 40.0 38.0 41.0 32.0 41.0 24-25 37.502375 40.0 38.0 41.0 32.0 41.0 26-27 37.38175 40.0 38.0 41.0 32.0 41.0 28-29 36.968125 40.0 37.5 41.0 31.0 41.0 30-31 36.910375 40.0 37.0 41.0 30.5 41.0 32-33 36.740125 40.0 37.0 41.0 30.0 41.0 34-35 36.633750000000006 40.0 36.5 41.0 30.0 41.0 36-37 36.73325 40.0 37.0 41.0 30.0 41.0 38-39 36.71725 40.0 37.0 41.0 30.0 41.0 40-41 36.57525 40.0 36.5 41.0 30.0 41.0 42-43 36.30800000000001 39.5 36.0 41.0 29.5 41.0 44-45 36.2515 39.0 36.0 41.0 29.5 41.0 46-47 35.909625 39.0 35.0 41.0 28.0 41.0 48-49 36.165 39.5 36.0 41.0 28.5 41.0 50-51 36.117625000000004 39.5 35.0 41.0 28.5 41.0 52-53 36.067625 39.0 35.5 41.0 28.0 41.0 54-55 35.88275 39.0 35.0 41.0 28.0 41.0 56-57 35.565375 39.0 35.0 41.0 27.5 41.0 58-59 35.45325 39.0 35.0 41.0 28.0 41.0 60-61 35.23725 38.5 34.5 40.0 27.5 41.0 62-63 34.8315 38.0 34.0 40.0 26.0 41.0 64-65 34.454375 38.0 34.0 40.0 26.0 41.0 66-67 34.229375 37.0 34.0 40.0 26.0 41.0 68-69 33.809875 36.5 33.5 39.0 25.5 41.0 70-71 33.321875 36.0 33.0 39.0 24.5 40.5 72-73 32.83025000000001 35.5 32.0 38.5 23.0 40.0 74-75 32.494375000000005 35.0 32.0 37.5 23.0 39.5 76-77 31.264875 34.0 30.5 36.0 20.0 39.0 78-79 31.64725 35.0 31.5 36.0 21.0 39.0 80-81 31.518500000000003 35.0 32.0 36.0 21.0 37.5 82-83 31.207375 35.0 32.0 36.0 20.5 37.0 84-85 30.855375000000002 35.0 31.0 35.0 19.0 37.0 86-87 30.3125 34.0 31.0 35.0 14.5 36.0 88-89 30.118125 34.0 31.0 35.0 14.5 36.0 90-91 29.97 34.0 30.5 35.0 9.0 35.5 92-93 29.566625000000002 34.0 30.0 35.0 4.5 35.0 94-95 29.222625 34.0 30.0 35.0 2.0 35.0 96-97 28.92925 34.0 29.5 35.0 2.0 35.0 98-99 28.558500000000002 34.0 29.0 35.0 2.0 35.0 100-101 27.1615 33.0 27.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 42.0 3 22.0 4 11.0 5 10.0 6 3.0 7 13.0 8 5.0 9 5.0 10 11.0 11 3.0 12 14.0 13 10.0 14 12.0 15 12.0 16 14.0 17 15.0 18 14.0 19 10.0 20 13.0 21 17.0 22 15.0 23 26.0 24 29.0 25 27.0 26 28.0 27 51.0 28 60.0 29 62.0 30 82.0 31 89.0 32 103.0 33 172.0 34 210.0 35 318.0 36 462.0 37 869.0 38 990.0 39 151.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 54.05815423514538 6.599241466498104 3.919089759797725 35.423514538558784 2 27.175 6.425 32.175 34.225 3 24.375 9.575 24.7 41.349999999999994 4 29.9 14.399999999999999 22.7 33.0 5 31.05 19.85 23.65 25.45 6 23.724999999999998 26.35 24.4 25.525 7 18.075 22.375 42.55 17.0 8 17.974999999999998 23.65 36.95 21.425 9 16.75 21.8 39.074999999999996 22.375 10-11 19.8625 32.875 29.299999999999997 17.962500000000002 12-13 20.962500000000002 27.450000000000003 31.1 20.4875 14-15 21.1125 26.875 30.587500000000002 21.425 16-17 22.3 27.037499999999998 29.25 21.4125 18-19 21.325 27.55 29.475 21.65 20-21 21.2375 28.6125 28.4125 21.7375 22-23 21.5625 28.349999999999998 27.775 22.3125 24-25 21.475 27.6125 27.962500000000002 22.95 26-27 21.212500000000002 27.0125 28.6375 23.1375 28-29 20.8625 27.787499999999998 28.9125 22.4375 30-31 21.1125 27.537499999999998 28.475 22.875 32-33 21.15 27.85 28.425 22.575 34-35 21.525 27.1625 28.6625 22.650000000000002 36-37 21.1375 27.6125 28.525 22.725 38-39 22.112499999999997 26.787499999999998 28.375 22.725 40-41 21.9375 27.3375 28.512500000000003 22.2125 42-43 21.4 27.6625 28.175 22.7625 44-45 20.7875 28.749999999999996 28.1125 22.35 46-47 21.462500000000002 28.237499999999997 27.762500000000003 22.537499999999998 48-49 21.3625 27.6375 28.425 22.575 50-51 20.9125 27.0875 28.549999999999997 23.45 52-53 21.1875 27.875 28.1375 22.8 54-55 22.037499999999998 27.2625 28.15 22.55 56-57 21.625 26.474999999999998 28.6875 23.2125 58-59 21.0125 28.1375 28.487499999999997 22.3625 60-61 20.925 27.425 27.750000000000004 23.9 62-63 21.2375 27.987499999999997 27.750000000000004 23.025000000000002 64-65 21.025 27.6875 27.8625 23.425 66-67 20.2625 27.8875 28.625 23.225 68-69 21.75 26.487500000000004 28.199999999999996 23.5625 70-71 21.7 26.75 28.237499999999997 23.3125 72-73 20.9125 27.875 28.4375 22.775000000000002 74-75 21.3875 27.8375 28.549999999999997 22.225 76-77 21.625 27.400000000000002 27.8375 23.1375 78-79 21.8875 27.0125 28.037499999999998 23.0625 80-81 21.349999999999998 26.924999999999997 28.0625 23.6625 82-83 21.224999999999998 27.900000000000002 28.962500000000002 21.912499999999998 84-85 21.4125 28.012500000000003 27.375 23.200000000000003 86-87 20.974999999999998 27.6375 27.3875 24.0 88-89 21.3875 27.700000000000003 28.575 22.3375 90-91 22.537499999999998 26.9625 28.1625 22.3375 92-93 21.425 28.237499999999997 27.2625 23.075000000000003 94-95 22.0 27.0625 28.4125 22.525000000000002 96-97 21.7 28.499999999999996 26.7125 23.0875 98-99 21.212500000000002 28.1625 27.462500000000002 23.1625 100-101 21.7375 28.050000000000004 27.1625 23.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.5 22 1.5 23 1.0 24 3.5 25 3.5 26 2.0 27 6.0 28 8.5 29 11.0 30 13.5 31 18.5 32 22.0 33 28.0 34 41.0 35 52.0 36 72.5 37 101.0 38 122.0 39 152.0 40 176.0 41 206.5 42 222.5 43 236.5 44 256.0 45 260.5 46 277.0 47 264.5 48 238.5 49 225.0 50 195.0 51 157.5 52 129.0 53 104.0 54 81.5 55 62.5 56 48.5 57 34.5 58 30.0 59 29.0 60 28.0 61 18.0 62 9.5 63 9.5 64 8.5 65 7.0 66 5.5 67 5.5 68 3.0 69 1.5 70 1.5 71 2.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29471032745592 98.55000000000001 2 0.654911838790932 1.3 3 0.05037783375314861 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.07500000000000001 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.375 0.0 0.0 0.0 0.0 80-81 0.575 0.0 0.0 0.0 0.0 82-83 0.625 0.0 0.0 0.0 0.0 84-85 0.825 0.0 0.0 0.0 0.0 86-87 0.9874999999999999 0.0 0.0 0.0 0.0 88-89 1.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864450 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864450_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.5535 33.0 31.0 34.0 30.0 34.0 2 31.6805 34.0 31.0 34.0 30.0 34.0 3 31.736 34.0 31.0 34.0 30.0 34.0 4 35.20925 37.0 35.0 37.0 33.0 37.0 5 35.24075 37.0 35.0 37.0 33.0 37.0 6 35.157 37.0 35.0 37.0 32.0 37.0 7 35.1445 37.0 35.0 37.0 33.0 37.0 8 35.241 37.0 35.0 37.0 33.0 37.0 9 36.818 39.0 37.0 39.0 33.0 39.0 10-11 36.6045 39.0 37.0 39.0 32.5 39.0 12-13 36.475125000000006 39.0 37.0 39.0 32.0 39.0 14-15 37.737875 40.0 38.0 41.0 32.0 41.0 16-17 37.691 40.0 38.0 41.0 32.0 41.0 18-19 37.826125000000005 40.0 38.0 41.0 32.5 41.0 20-21 37.60075 40.0 38.0 41.0 32.0 41.0 22-23 37.69925 40.0 38.0 41.0 32.0 41.0 24-25 37.679500000000004 40.0 38.0 41.0 32.0 41.0 26-27 37.360625 40.0 38.0 41.0 31.5 41.0 28-29 37.279 40.0 38.0 41.0 31.0 41.0 30-31 37.24250000000001 40.0 37.5 41.0 31.0 41.0 32-33 37.12425 40.0 37.0 41.0 31.0 41.0 34-35 36.969125000000005 40.0 37.0 41.0 30.0 41.0 36-37 36.493750000000006 40.0 36.0 41.0 30.0 41.0 38-39 36.199875 39.0 36.0 41.0 29.5 41.0 40-41 36.249875 39.0 36.0 41.0 29.5 41.0 42-43 36.186375 39.0 36.0 41.0 29.0 41.0 44-45 35.83225 39.0 35.0 40.0 27.0 41.0 46-47 35.8665 39.0 35.5 40.5 27.5 41.0 48-49 35.456500000000005 39.0 34.5 40.0 26.0 41.0 50-51 34.910124999999994 38.0 34.0 39.5 26.5 40.5 52-53 34.90475 38.0 34.0 40.0 26.0 40.5 54-55 35.887125 39.0 35.5 40.5 28.0 41.0 56-57 35.958 39.0 35.5 41.0 28.0 41.0 58-59 35.36725 39.0 35.0 41.0 26.5 41.0 60-61 35.33862499999999 39.0 35.0 41.0 26.5 41.0 62-63 35.197 38.5 35.0 40.5 26.5 41.0 64-65 34.666875000000005 37.5 34.5 40.0 26.0 41.0 66-67 34.32825 37.0 34.0 39.5 26.0 41.0 68-69 33.950374999999994 36.5 34.0 39.0 26.0 41.0 70-71 33.564625 36.0 33.5 39.0 25.5 40.5 72-73 32.891875 35.5 32.5 38.5 23.0 40.0 74-75 32.448875 35.0 32.5 37.0 22.5 39.0 76-77 31.95375 35.0 32.0 37.0 21.0 39.0 78-79 31.5215 35.0 32.0 36.0 20.0 38.0 80-81 31.007375 35.0 31.0 36.0 18.5 37.0 82-83 30.769750000000002 35.0 31.0 35.0 18.5 37.0 84-85 30.560875 34.0 31.0 35.0 18.0 36.0 86-87 30.338 34.0 31.0 35.0 17.0 36.0 88-89 30.054625 34.0 31.0 35.0 10.5 36.0 90-91 29.699375 34.0 30.5 35.0 4.5 35.0 92-93 28.815875 34.0 29.0 35.0 2.0 35.0 94-95 28.537 34.0 29.0 35.0 2.0 35.0 96-97 28.541375000000002 34.0 29.0 35.0 2.0 35.0 98-99 28.147 34.0 29.0 35.0 2.0 35.0 100-101 27.11375 33.0 27.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 33.0 3 10.0 4 9.0 5 6.0 6 7.0 7 8.0 8 6.0 9 14.0 10 12.0 11 8.0 12 15.0 13 16.0 14 18.0 15 10.0 16 14.0 17 16.0 18 15.0 19 19.0 20 14.0 21 21.0 22 18.0 23 26.0 24 29.0 25 31.0 26 38.0 27 49.0 28 53.0 29 64.0 30 82.0 31 103.0 32 127.0 33 151.0 34 230.0 35 292.0 36 489.0 37 919.0 38 919.0 39 109.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.375 27.0 7.725 29.9 2 25.55 25.974999999999998 32.125 16.35 3 18.475 28.575 33.525 19.425 4 22.85 33.4 24.05 19.7 5 25.5 36.4 20.7 17.4 6 20.0 39.525 21.95 18.525 7 21.325 23.325000000000003 35.85 19.5 8 20.424999999999997 26.3 28.525 24.75 9 20.525 23.674999999999997 31.825 23.974999999999998 10-11 22.8875 32.525 24.099999999999998 20.4875 12-13 23.2125 26.974999999999998 26.8375 22.975 14-15 23.0875 28.375 27.675 20.8625 16-17 23.9375 28.1875 26.650000000000002 21.224999999999998 18-19 22.537499999999998 28.675 27.175 21.6125 20-21 23.1875 28.962500000000002 26.1125 21.7375 22-23 21.637500000000003 29.3375 27.250000000000004 21.775 24-25 22.55 28.6125 27.6 21.2375 26-27 22.412499999999998 29.037499999999998 27.450000000000003 21.099999999999998 28-29 22.85 28.599999999999998 26.5125 22.037499999999998 30-31 22.125 28.599999999999998 27.737499999999997 21.5375 32-33 21.775 29.65 26.7625 21.8125 34-35 22.662499999999998 28.725 26.4125 22.2 36-37 22.6 28.262500000000003 27.55 21.587500000000002 38-39 22.35 28.9125 26.7125 22.025 40-41 22.325 29.012500000000003 27.175 21.4875 42-43 23.275000000000002 27.975 27.237499999999997 21.512500000000003 44-45 23.2375 28.212500000000002 27.187499999999996 21.3625 46-47 22.9375 28.0625 27.3875 21.6125 48-49 22.575 27.8125 28.375 21.2375 50-51 22.3875 28.037499999999998 27.775 21.8 52-53 23.425 27.500000000000004 28.262500000000003 20.8125 54-55 22.400000000000002 28.375 27.775 21.45 56-57 23.325000000000003 28.275 27.500000000000004 20.9 58-59 22.9375 28.549999999999997 27.4125 21.099999999999998 60-61 22.875 27.8125 27.9125 21.4 62-63 22.325 27.787499999999998 28.3125 21.575 64-65 22.925 28.537499999999998 27.5125 21.025 66-67 22.175 29.1875 27.3875 21.25 68-69 22.325 29.175 27.325 21.175 70-71 23.0125 28.425 27.1625 21.4 72-73 22.4875 28.487499999999997 27.325 21.7 74-75 23.3125 28.5875 27.275 20.825 76-77 22.5125 28.237499999999997 27.3 21.95 78-79 22.787499999999998 28.3875 27.55 21.275 80-81 23.8125 28.475 26.5875 21.125 82-83 23.0875 28.199999999999996 27.325 21.3875 84-85 22.912499999999998 27.900000000000002 28.037499999999998 21.15 86-87 22.4625 28.3375 27.825 21.375 88-89 22.9375 28.262500000000003 27.175 21.625 90-91 23.0875 28.975 26.450000000000003 21.4875 92-93 23.7375 28.0875 26.437500000000004 21.7375 94-95 24.3625 27.437499999999996 27.175 21.025 96-97 23.3 28.599999999999998 26.3125 21.7875 98-99 22.5125 29.1875 27.275 21.025 100-101 23.5625 28.425 26.3125 21.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.5 15 1.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 1.0 23 2.0 24 1.0 25 1.5 26 3.5 27 5.5 28 7.5 29 9.5 30 13.5 31 18.5 32 22.5 33 28.5 34 38.0 35 59.0 36 91.0 37 113.5 38 145.5 39 182.5 40 201.0 41 236.5 42 263.0 43 271.5 44 268.0 45 258.0 46 266.0 47 248.5 48 218.0 49 197.0 50 163.0 51 133.0 52 109.0 53 90.5 54 74.0 55 54.5 56 45.5 57 39.5 58 29.0 59 17.0 60 15.0 61 14.0 62 9.5 63 7.5 64 6.0 65 4.5 66 3.5 67 2.5 68 2.0 69 1.0 70 0.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67377666248431 99.3 2 0.301129234629862 0.6 3 0.0 0.0 4 0.02509410288582183 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.07500000000000001 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.3625 0.0 0.0 0.0 0.0 80-81 0.5625 0.0 0.0 0.0 0.0 82-83 0.625 0.0 0.0 0.0 0.0 84-85 0.825 0.0 0.0 0.0 0.0 86-87 0.9874999999999999 0.0 0.0 0.0 0.0 88-89 1.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 866511 spots for ERR1864450.sra Written 866511 spots for ERR1864450.sra Read 866511 spots for ERR1864450.sra Written 866511 spots for ERR1864450.sra Read 866511 spots for ERR1864450.sra Written 866511 spots for ERR1864450.sra Read 866511 spots for ERR1864450.sra Written 866511 spots for ERR1864450.sra Read 866511 spots for ERR1864450.sra Written 866511 spots for ERR1864450.sra Read 866511 spots for ERR1864450.sra Written 866511 spots for ERR1864450.sra Read 866511 spots for ERR1864450.sra Written 866511 spots for ERR1864450.sra Read 866511 spots for ERR1864450.sra Written 866511 spots for ERR1864450.sra Read 866511 spots for ERR1864450.sra Written 866511 spots for ERR1864450.sra Read 866511 spots for ERR1864450.sra Written 866511 spots for ERR1864450.sra Read 866511 spots for ERR1864450.sra Written 866511 spots for ERR1864450.sra Read 866511 spots for ERR1864450.sra Written 866511 spots for ERR1864450.sra Read 866511 spots for ERR1864450.sra Written 866511 spots for ERR1864450.sra Read 866511 spots for ERR1864450.sra Written 866511 spots for ERR1864450.sra Read 866511 spots for ERR1864450.sra Written 866511 spots for ERR1864450.sra Read 866516 spots for ERR1864450.sra Written 866516 spots for ERR1864450.sra Read 866511 spots for ERR1864450.sra Written 866511 spots for ERR1864450.sra Read 866511 spots for ERR1864450.sra Written 866511 spots for ERR1864450.sra Read 866511 spots for ERR1864450.sra Written 866511 spots for ERR1864450.sra Read 866511 spots for ERR1864450.sra Written 866511 spots for ERR1864450.sra SRR ids: ['ERR1864450.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_utk7oo37 ERR1864450.sra spots: 17330225 blocks: [[1, 866511], [866512, 1733022], [1733023, 2599533], [2599534, 3466044], [3466045, 4332555], [4332556, 5199066], [5199067, 6065577], [6065578, 6932088], [6932089, 7798599], [7798600, 8665110], [8665111, 9531621], [9531622, 10398132], [10398133, 11264643], [11264644, 12131154], [12131155, 12997665], [12997666, 13864176], [13864177, 14730687], [14730688, 15597198], [15597199, 16463709], [16463710, 17330225]] ERR1864450 file size 4158539 ERR1864450 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864450 ERR1864450_1.fastq ERR1864450_2.fastq Input file: ERR1864450_1.fastq Paired file: ERR1864450_2.fastq trimmed: ERR1864450-trimmed-pair1.fastq, ERR1864450-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 12:26:40 2025 >> started Thu Feb 13 12:26:56 2025 >> done (15.973s) 17330225 read pairs processed; of these: 278897 ( 1.61%) short read pairs filtered out after trimming by size control 309846 ( 1.79%) empty read pairs filtered out after trimming by size control 16741482 (96.60%) read pairs available; of these: 4004770 (23.92%) trimmed read pairs available after processing 12736712 (76.08%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 120 0.00% 19 245 0.00% 20 359 0.00% 21 479 0.00% 22 727 0.00% 23 855 0.01% 24 1051 0.01% 25 1269 0.01% 26 1368 0.01% 27 1722 0.01% 28 2017 0.01% 29 2258 0.01% 30 2611 0.02% 31 2960 0.02% 32 3225 0.02% 33 3685 0.02% 34 4053 0.02% 35 4292 0.03% 36 4581 0.03% 37 5095 0.03% 38 5455 0.03% 39 5847 0.03% 40 5968 0.04% 41 6467 0.04% 42 6939 0.04% 43 7300 0.04% 44 7496 0.04% 45 8005 0.05% 46 8433 0.05% 47 8952 0.05% 48 9148 0.05% 49 9674 0.06% 50 10174 0.06% 51 10485 0.06% 52 11049 0.07% 53 11472 0.07% 54 12180 0.07% 55 12659 0.08% 56 13366 0.08% 57 14195 0.08% 58 15239 0.09% 59 20405 0.12% 60 24784 0.15% 61 25311 0.15% 62 25549 0.15% 63 26019 0.16% 64 26542 0.16% 65 27216 0.16% 66 28259 0.17% 67 29506 0.18% 68 30106 0.18% 69 31640 0.19% 70 33225 0.20% 71 34505 0.21% 72 36223 0.22% 73 37323 0.22% 74 38507 0.23% 75 40040 0.24% 76 39452 0.24% 77 41484 0.25% 78 42919 0.26% 79 45972 0.27% 80 48064 0.29% 81 50360 0.30% 82 53722 0.32% 83 56688 0.34% 84 60249 0.36% 85 63845 0.38% 86 68164 0.41% 87 72335 0.43% 88 73956 0.44% 89 77113 0.46% 90 85934 0.51% 91 95194 0.57% 92 106231 0.63% 93 121020 0.72% 94 137271 0.82% 95 157682 0.94% 96 190009 1.13% 97 237363 1.42% 98 310774 1.86% 99 417035 2.49% 100 593299 3.54% 101 12736712 76.08% 16741482 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=3.65 fanout-score-rank=15 prefix-density=0.37 prefix-fanout=3.3 sequence=TTGTCATAAGATGTAGCAGTAGGCTGTGGGCCAAAATCCTTGACAAAATTATTCTTTTCATTGGACTCGGTTGTGTGGCAATCGGCTTTCTCATTGGAGACTGATGACAAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=324.39 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=12.7 sequence=CATCACCAATATCAGTACTTATGCCTTCAAGATCACTACTAGTTATGCCTGCAACTTGCAGTCCCTTTTTAAGGATGTTAAGCACCTTGGTTCGCTTCTGAATGGGGGCCGCTTGTGTCGCGCTCCTGCTTCGACAAAGTAAAGTATAGTTATCGCAGAAGATGTGCCCATCGTTGTGTCTGAACTTTTTACCACCATAACAATCACAACAAACATCAAAGGTGCTAACTGAATCATCATCATTGAAGAAACACTGAGAGCAAGTGAAGTATGCTCCTGCCAAGAACGTCTTACAAGACTGGCAAATTATAGCCCTTCCACTCTGCATGATGTAGTACAAGACGATTGCTTCATCAAAATCCAAGGTTCCATTGCC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=32 prefix-density=0.19 prefix-fanout=2.0 sequence=CTCAGTTGTTCCTTTACAATGATGGTGTCGTTAAAGGAGAGAGATCCTTTGC criterion=fanout-score sequence-density=0.07 sequence-density-rank=19 fanout-score=425.58 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=32.2 sequence=AAGAAGAAGAAG ERR1864450 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 12:27:30 Started mapping on | Feb 13 12:27:30 Finished on | Feb 13 12:28:23 Mapping speed, Million of reads per hour | 1137.16 Number of input reads | 16741482 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 15620711 Uniquely mapped reads % | 93.31% Average mapped length | 195.49 Number of splices: Total | 9084209 Number of splices: Annotated (sjdb) | 8923504 Number of splices: GT/AG | 8944827 Number of splices: GC/AG | 115750 Number of splices: AT/AC | 9305 Number of splices: Non-canonical | 14327 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 2.41 Insertion rate per base | 0.01% Insertion average length | 2.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 590234 % of reads mapped to multiple loci | 3.53% Number of reads mapped to too many loci | 20255 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.03% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 574095 574095 574095 N_multimapping 590234 590234 590234 N_noFeature 366584 15460111 448585 N_ambiguous 147927 923 68806 UnstrandedReadsAssigned:15106200 PositiveStrandReadsAssigned:159677 NegativeStrandReadsAssigned:15103320 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864450 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864450-trimmed-pair1.fastq ERR1864450-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,741,482 reads, 15,456,874 reads pseudoaligned [quant] estimated average fragment length: 159.665 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,094 rounds 52401 ERR1864450.ke.tsv 34699 ERR1864450.se.tsv 87100 total ==> ERR1864450.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1859.33 1965 73.7239 Potri.005G024800.1.v4.1 1035 876.335 872 69.4144 Potri.004G059700.1.v4.1 961 802.34 68 5.91226 Potri.007G009000.2.v4.1 1416 1257.33 0 0 Potri.003G141000.2.v4.1 2943 2784.33 644 16.135 Potri.016G087400.1.v4.1 270 117.929 1243.27 735.441 Potri.015G069301.1.v4.1 564 405.398 0 0 Potri.010G195200.1.v4.1 1773 1614.33 109 4.71017 Potri.012G127500.1.v4.1 977 818.34 6971 594.244 ==> ERR1864450.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 421 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 374 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 40 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 182 ERR1864450 completed mapping pipeline successfully