Starting /dee2/code/volunteer_pipeline.sh ERR1864451 current disk space = 3093456150528 free memory = 1439978540 ERR1864451 SRAfilesize 757159b9fd468272b5f07c89dbe84b9c ERR1864451.sra ERR1864451.sra file validated ERR1864451 is paired end ERR1864451 is conventional basespace ERR1864451 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864451_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.59375 33.0 31.0 34.0 30.0 34.0 2 31.76975 34.0 31.0 34.0 29.0 34.0 3 31.97025 34.0 31.0 34.0 30.0 34.0 4 35.369 37.0 35.0 37.0 33.0 37.0 5 35.162 37.0 35.0 37.0 33.0 37.0 6 35.1325 37.0 35.0 37.0 32.0 37.0 7 35.1195 37.0 35.0 37.0 32.0 37.0 8 35.14625 37.0 35.0 37.0 33.0 37.0 9 36.668 39.0 37.0 39.0 32.0 39.0 10-11 36.5175 39.0 37.0 39.0 32.5 39.0 12-13 36.542249999999996 39.0 37.0 39.0 32.5 39.0 14-15 37.759249999999994 40.0 38.0 41.0 32.5 41.0 16-17 37.47 40.0 38.0 41.0 32.0 41.0 18-19 37.537000000000006 40.0 38.0 41.0 32.0 41.0 20-21 37.45525 40.0 38.0 41.0 32.0 41.0 22-23 37.428875000000005 40.0 38.0 41.0 32.0 41.0 24-25 37.28775 40.0 38.0 41.0 31.5 41.0 26-27 37.189125 40.0 37.5 41.0 31.0 41.0 28-29 36.762125 40.0 37.0 41.0 30.0 41.0 30-31 36.775 40.0 37.0 41.0 30.5 41.0 32-33 36.6035 40.0 36.5 41.0 30.0 41.0 34-35 36.526875000000004 40.0 36.5 41.0 30.0 41.0 36-37 36.590625 40.0 36.5 41.0 30.0 41.0 38-39 36.5595 40.0 36.0 41.0 30.0 41.0 40-41 36.43675 40.0 36.0 41.0 29.5 41.0 42-43 36.08975 39.0 36.0 41.0 29.0 41.0 44-45 35.951750000000004 39.0 35.5 41.0 28.5 41.0 46-47 35.740875 39.0 35.0 41.0 27.0 41.0 48-49 36.00212500000001 39.5 36.0 41.0 28.5 41.0 50-51 35.7915 39.0 35.0 41.0 27.5 41.0 52-53 35.791624999999996 39.0 35.0 41.0 28.0 41.0 54-55 35.628249999999994 39.0 35.0 41.0 27.5 41.0 56-57 35.35225 39.0 34.5 41.0 26.5 41.0 58-59 35.13675 39.0 35.0 40.5 26.0 41.0 60-61 34.860125 38.0 34.0 40.0 26.0 41.0 62-63 34.51575 38.0 34.0 40.0 25.5 41.0 64-65 34.142375 37.0 34.0 40.0 25.0 41.0 66-67 33.82225 37.0 33.5 40.0 23.0 41.0 68-69 33.409375 36.0 33.0 39.0 23.0 41.0 70-71 33.005125 36.0 32.5 39.0 22.0 40.5 72-73 32.545 35.0 32.0 38.5 22.0 40.0 74-75 32.281875 35.0 32.0 37.0 21.5 39.0 76-77 31.051125 34.0 30.5 36.0 20.0 39.0 78-79 31.441375 35.0 31.5 36.0 20.5 38.5 80-81 31.2855 35.0 32.0 36.0 20.0 37.0 82-83 31.018625 35.0 32.0 35.5 19.0 37.0 84-85 30.612499999999997 35.0 31.0 35.0 16.5 36.5 86-87 30.16075 34.0 31.0 35.0 11.0 36.0 88-89 29.89025 34.0 30.5 35.0 7.0 36.0 90-91 29.693875 34.0 30.5 35.0 4.5 35.5 92-93 29.3495 34.0 30.0 35.0 2.0 35.0 94-95 29.102625 34.0 30.0 35.0 2.0 35.0 96-97 28.93875 34.0 30.0 35.0 2.0 35.0 98-99 28.311625 34.0 29.0 35.0 2.0 35.0 100-101 26.80875 33.0 26.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 49.0 3 21.0 4 12.0 5 11.0 6 9.0 7 10.0 8 6.0 9 14.0 10 10.0 11 6.0 12 11.0 13 16.0 14 12.0 15 12.0 16 17.0 17 11.0 18 9.0 19 22.0 20 14.0 21 20.0 22 17.0 23 23.0 24 25.0 25 23.0 26 37.0 27 34.0 28 65.0 29 45.0 30 74.0 31 91.0 32 134.0 33 171.0 34 214.0 35 321.0 36 481.0 37 843.0 38 969.0 39 141.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 52.37014624306606 6.278366111951589 3.8830055471507814 37.46848209783157 2 27.150000000000002 6.3 32.75 33.800000000000004 3 24.425 9.15 23.225 43.2 4 30.525000000000002 15.6 20.45 33.425 5 32.05 18.6 24.55 24.8 6 24.425 23.724999999999998 24.55 27.3 7 18.025 23.025000000000002 41.875 17.075000000000003 8 17.675 23.325000000000003 37.4 21.6 9 17.675 21.775 39.525 21.025 10-11 19.925 33.175 28.4375 18.462500000000002 12-13 20.549999999999997 28.000000000000004 30.325000000000003 21.125 14-15 20.5375 27.3625 30.7125 21.3875 16-17 22.1375 28.787499999999998 27.5625 21.512500000000003 18-19 21.0375 29.099999999999998 27.8625 22.0 20-21 21.8 28.525 27.55 22.125 22-23 22.0125 28.237499999999997 28.375 21.375 24-25 20.75 27.737499999999997 28.0625 23.45 26-27 21.1625 27.900000000000002 28.325 22.6125 28-29 20.8625 28.575 28.275 22.287499999999998 30-31 20.875 27.474999999999998 28.675 22.975 32-33 21.025 27.650000000000002 28.1 23.225 34-35 21.85 27.5625 27.4125 23.175 36-37 20.674999999999997 27.0875 28.599999999999998 23.6375 38-39 21.9 26.974999999999998 28.762500000000003 22.3625 40-41 21.475 27.6375 28.15 22.7375 42-43 21.7375 28.1 27.712500000000002 22.45 44-45 21.575 27.650000000000002 27.9375 22.8375 46-47 21.7375 27.6625 28.5875 22.0125 48-49 21.0625 27.425 27.950000000000003 23.5625 50-51 21.575 27.037499999999998 28.512500000000003 22.875 52-53 21.675 28.275 27.450000000000003 22.6 54-55 21.45 27.737499999999997 27.800000000000004 23.0125 56-57 21.3625 27.200000000000003 27.800000000000004 23.6375 58-59 22.0125 28.3375 27.0125 22.6375 60-61 21.425 28.262500000000003 27.750000000000004 22.5625 62-63 20.9375 28.475 27.500000000000004 23.0875 64-65 21.7 27.6125 26.8125 23.875 66-67 21.45 28.237499999999997 27.125 23.1875 68-69 21.8 26.974999999999998 28.5625 22.662499999999998 70-71 21.9375 27.6875 27.0875 23.2875 72-73 21.6 27.9125 27.6375 22.85 74-75 22.1875 27.250000000000004 28.050000000000004 22.5125 76-77 21.775 27.625 28.199999999999996 22.400000000000002 78-79 21.8125 27.6375 26.85 23.7 80-81 21.0375 26.474999999999998 28.487499999999997 24.0 82-83 21.337500000000002 28.125 27.800000000000004 22.7375 84-85 22.112499999999997 27.762500000000003 27.200000000000003 22.925 86-87 21.775 27.737499999999997 27.750000000000004 22.7375 88-89 21.9 27.4125 26.700000000000003 23.9875 90-91 21.825 28.0875 27.125 22.9625 92-93 22.9625 26.4625 28.237499999999997 22.3375 94-95 21.675 27.700000000000003 27.700000000000003 22.925 96-97 21.875 28.1625 27.1375 22.825 98-99 22.537499999999998 27.250000000000004 27.500000000000004 22.7125 100-101 22.1375 28.262500000000003 26.85 22.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 0.5 23 0.5 24 1.5 25 2.0 26 1.5 27 2.5 28 5.5 29 7.5 30 12.5 31 20.0 32 29.0 33 31.5 34 34.5 35 47.5 36 66.0 37 87.0 38 102.5 39 134.5 40 170.5 41 212.5 42 240.5 43 240.5 44 261.0 45 279.5 46 270.0 47 258.0 48 238.5 49 222.0 50 192.0 51 159.0 52 140.0 53 115.5 54 86.5 55 60.5 56 53.5 57 43.0 58 34.0 59 26.0 60 22.0 61 19.5 62 14.5 63 11.5 64 7.0 65 4.0 66 6.0 67 6.0 68 3.5 69 4.0 70 2.0 71 1.0 72 1.5 73 0.5 74 0.0 75 0.5 76 0.5 77 0.5 78 1.0 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8500000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14032869785082 98.02499999999999 2 0.7332490518331226 1.4500000000000002 3 0.07585335018963338 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.05056890012642225 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCGTCTTTGTTTTTGTCCATTTCATTGAAAGAAAATCTGGCATTTCTCT 6 0.15 No Hit GGCTGATCTTTCATGACAGCTCTCCAATACTCTCCAGTGTCTTTTCTAGC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.21250000000000002 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.375 0.0 0.0 0.0 0.0 82-83 0.44999999999999996 0.0 0.0 0.0 0.0 84-85 0.5625 0.0 0.0 0.0 0.0 86-87 0.8500000000000001 0.0 0.0 0.0 0.0 88-89 1.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864451 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864451_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.58775 33.0 31.0 34.0 30.0 34.0 2 31.6095 34.0 31.0 34.0 30.0 34.0 3 31.64925 34.0 31.0 34.0 28.0 34.0 4 35.065 37.0 35.0 37.0 32.0 37.0 5 35.02325 37.0 35.0 37.0 32.0 37.0 6 35.0535 37.0 35.0 37.0 32.0 37.0 7 34.98675 37.0 35.0 37.0 32.0 37.0 8 35.03875 37.0 35.0 37.0 32.0 37.0 9 36.636 39.0 37.0 39.0 32.0 39.0 10-11 36.500125 39.0 37.0 39.0 32.0 39.0 12-13 36.281875 39.0 37.0 39.0 31.5 39.0 14-15 37.49275 40.0 38.0 41.0 31.5 41.0 16-17 37.580625 40.0 38.0 41.0 32.0 41.0 18-19 37.561499999999995 40.0 38.0 41.0 31.5 41.0 20-21 37.498125 40.0 38.0 41.0 31.5 41.0 22-23 37.547250000000005 40.0 38.0 41.0 32.0 41.0 24-25 37.511875 40.0 38.0 41.0 31.5 41.0 26-27 37.314750000000004 40.0 38.0 41.0 31.5 41.0 28-29 37.11825 40.0 37.0 41.0 30.5 41.0 30-31 37.070125 40.0 37.5 41.0 30.0 41.0 32-33 36.872749999999996 40.0 37.0 41.0 30.0 41.0 34-35 36.806625 40.0 37.0 41.0 30.0 41.0 36-37 36.463499999999996 40.0 36.0 41.0 30.0 41.0 38-39 35.978125000000006 39.0 35.5 41.0 27.5 41.0 40-41 36.104875 39.0 36.0 41.0 29.0 41.0 42-43 36.03 39.0 36.0 40.5 27.0 41.0 44-45 35.7455 39.0 35.0 40.0 27.0 41.0 46-47 35.7615 39.0 35.0 41.0 27.0 41.0 48-49 35.363125 39.0 34.5 40.5 25.0 41.0 50-51 34.949875 38.5 34.0 39.5 25.0 40.5 52-53 34.819625 38.0 34.0 40.0 25.0 40.5 54-55 35.8185 39.0 36.0 40.5 27.5 41.0 56-57 35.807249999999996 39.0 36.0 41.0 28.0 41.0 58-59 35.46225 39.0 35.0 41.0 26.5 41.0 60-61 35.317375 39.0 35.0 41.0 26.5 41.0 62-63 35.1275 38.5 35.0 41.0 26.0 41.0 64-65 34.593875 38.0 34.5 40.0 25.0 41.0 66-67 34.16975 37.0 34.0 40.0 24.5 41.0 68-69 33.928125 37.0 34.0 39.0 25.5 41.0 70-71 33.597625 36.0 34.0 39.0 25.5 41.0 72-73 32.90425 35.5 32.5 38.5 22.0 40.0 74-75 32.399625 35.0 32.5 37.0 21.5 39.0 76-77 31.865625 35.0 32.0 37.0 20.0 39.0 78-79 31.389875 35.0 31.0 36.0 19.0 38.5 80-81 31.021625 35.0 31.0 36.0 18.5 37.0 82-83 30.750375 35.0 31.0 35.5 18.0 37.0 84-85 30.566 35.0 31.0 35.0 17.5 36.5 86-87 30.302625 34.0 31.0 35.0 12.0 36.0 88-89 29.880125 34.0 31.0 35.0 7.0 36.0 90-91 29.61725 34.0 30.0 35.0 2.0 35.5 92-93 28.874000000000002 34.0 29.0 35.0 2.0 35.0 94-95 28.64525 34.0 29.0 35.0 2.0 35.0 96-97 28.570124999999997 34.0 29.0 35.0 2.0 35.0 98-99 28.243499999999997 34.0 29.0 35.0 2.0 35.0 100-101 27.153125000000003 33.0 27.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 44.0 3 10.0 4 8.0 5 6.0 6 8.0 7 10.0 8 7.0 9 17.0 10 10.0 11 12.0 12 12.0 13 16.0 14 15.0 15 13.0 16 15.0 17 14.0 18 18.0 19 13.0 20 20.0 21 18.0 22 20.0 23 27.0 24 33.0 25 44.0 26 42.0 27 46.0 28 55.0 29 59.0 30 68.0 31 94.0 32 129.0 33 135.0 34 184.0 35 286.0 36 507.0 37 882.0 38 978.0 39 125.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.85 26.35 8.725 29.075 2 26.625 26.575 31.275 15.525 3 18.4 27.950000000000003 33.925 19.725 4 22.2 34.2 24.175 19.425 5 25.35 35.55 21.6 17.5 6 21.3 37.95 22.0 18.75 7 20.65 23.95 36.449999999999996 18.95 8 19.675 25.6 29.125 25.6 9 20.1 24.2 31.05 24.65 10-11 23.125 31.825 23.5875 21.462500000000002 12-13 23.625 26.337500000000002 27.1125 22.925 14-15 22.400000000000002 28.8625 26.5 22.237499999999997 16-17 23.5625 28.849999999999998 27.325 20.2625 18-19 23.025000000000002 28.7 26.7625 21.512500000000003 20-21 22.2 29.225 27.437499999999996 21.1375 22-23 22.6 29.375 26.650000000000002 21.375 24-25 22.25 27.825 28.3625 21.5625 26-27 22.675 28.9875 27.5125 20.825 28-29 22.7 27.712500000000002 28.15 21.4375 30-31 22.15 27.250000000000004 28.512500000000003 22.0875 32-33 22.225 27.625 27.987499999999997 22.162499999999998 34-35 22.725 28.65 26.85 21.775 36-37 21.975 28.812500000000004 27.6375 21.575 38-39 22.075 28.6875 27.250000000000004 21.987499999999997 40-41 23.674999999999997 27.6125 27.250000000000004 21.462500000000002 42-43 21.975 28.4375 27.474999999999998 22.112499999999997 44-45 22.900000000000002 28.749999999999996 26.5625 21.7875 46-47 23.275000000000002 27.762500000000003 27.8875 21.075 48-49 23.4125 27.962500000000002 27.3875 21.2375 50-51 22.9875 28.3625 27.3625 21.2875 52-53 23.25 27.3625 26.950000000000003 22.4375 54-55 22.45 28.349999999999998 26.825 22.375 56-57 23.2875 27.3875 27.737499999999997 21.587500000000002 58-59 22.787499999999998 28.725 26.6 21.8875 60-61 22.35 27.500000000000004 27.950000000000003 22.2 62-63 23.1 28.125 27.6875 21.087500000000002 64-65 23.1125 27.575 27.775 21.5375 66-67 22.8 28.775000000000002 26.4625 21.9625 68-69 22.112499999999997 28.3375 27.900000000000002 21.65 70-71 23.0375 27.287499999999998 27.625 22.05 72-73 23.825 27.237499999999997 27.212500000000002 21.725 74-75 22.9375 28.512500000000003 27.775 20.775 76-77 22.662499999999998 28.487499999999997 27.1375 21.712500000000002 78-79 23.2125 27.775 28.075 20.9375 80-81 22.5 29.2 26.237500000000004 22.0625 82-83 22.975 29.025000000000002 26.937499999999996 21.0625 84-85 22.8625 28.037499999999998 26.8125 22.287499999999998 86-87 23.525 28.4125 26.674999999999997 21.3875 88-89 22.787499999999998 29.1375 26.825 21.25 90-91 23.6375 28.125 26.887499999999996 21.349999999999998 92-93 23.1 28.625 27.425 20.849999999999998 94-95 23.75 29.1375 25.85 21.2625 96-97 23.225 27.6875 27.200000000000003 21.8875 98-99 22.9625 28.0625 27.0625 21.912499999999998 100-101 23.599999999999998 29.062500000000004 25.874999999999996 21.462500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 1.5 21 2.0 22 1.5 23 1.5 24 2.0 25 2.5 26 2.0 27 3.5 28 4.5 29 7.5 30 12.0 31 19.5 32 24.5 33 30.0 34 40.0 35 53.5 36 83.5 37 123.5 38 144.5 39 161.5 40 192.5 41 221.0 42 255.5 43 269.5 44 266.5 45 281.5 46 272.0 47 240.0 48 230.0 49 201.0 50 164.0 51 144.5 52 111.0 53 84.5 54 70.5 55 53.5 56 41.5 57 35.5 58 29.5 59 24.0 60 17.5 61 13.0 62 13.5 63 9.5 64 4.0 65 4.5 66 4.0 67 2.5 68 2.5 69 2.0 70 3.5 71 2.5 72 0.5 73 0.5 74 0.5 75 1.0 76 0.5 77 0.0 78 0.5 79 0.5 80 0.5 81 1.0 82 0.5 83 0.5 84 0.5 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72389558232932 99.325 2 0.25100401606425704 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0251004016064257 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTTAATTTGAGACAGAAAACATGAAATCCTCCTACACTTTCTTCATTCT 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.1125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.1875 0.0 0.0 0.0 0.0 72-73 0.2625 0.0 0.0 0.0 0.0 74-75 0.3125 0.0 0.0 0.0 0.0 76-77 0.35 0.0 0.0 0.0 0.0 78-79 0.3875 0.0 0.0 0.0 0.0 80-81 0.44999999999999996 0.0 0.0 0.0 0.0 82-83 0.525 0.0 0.0 0.0 0.0 84-85 0.6375 0.0 0.0 0.0 0.0 86-87 0.8999999999999999 0.0 0.0 0.0 0.0 88-89 1.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 801147 spots for ERR1864451.sra Written 801147 spots for ERR1864451.sra Read 801147 spots for ERR1864451.sra Written 801147 spots for ERR1864451.sra Read 801147 spots for ERR1864451.sra Written 801147 spots for ERR1864451.sra Read 801147 spots for ERR1864451.sra Written 801147 spots for ERR1864451.sra Read 801147 spots for ERR1864451.sra Written 801147 spots for ERR1864451.sra Read 801147 spots for ERR1864451.sra Written 801147 spots for ERR1864451.sra Read 801147 spots for ERR1864451.sra Written 801147 spots for ERR1864451.sra Read 801147 spots for ERR1864451.sra Written 801147 spots for ERR1864451.sra Read 801147 spots for ERR1864451.sra Written 801147 spots for ERR1864451.sra Read 801147 spots for ERR1864451.sra Written 801147 spots for ERR1864451.sra Read 801147 spots for ERR1864451.sra Written 801147 spots for ERR1864451.sra Read 801147 spots for ERR1864451.sra Written 801147 spots for ERR1864451.sra Read 801147 spots for ERR1864451.sra Written 801147 spots for ERR1864451.sra Read 801147 spots for ERR1864451.sra Written 801147 spots for ERR1864451.sra Read 801147 spots for ERR1864451.sra Written 801147 spots for ERR1864451.sra Read 801147 spots for ERR1864451.sra Written 801147 spots for ERR1864451.sra Read 801156 spots for ERR1864451.sra Written 801156 spots for ERR1864451.sra Read 801147 spots for ERR1864451.sra Written 801147 spots for ERR1864451.sra Read 801147 spots for ERR1864451.sra Written 801147 spots for ERR1864451.sra Read 801147 spots for ERR1864451.sra Written 801147 spots for ERR1864451.sra SRR ids: ['ERR1864451.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x4o1t5pm ERR1864451.sra spots: 16022949 blocks: [[1, 801147], [801148, 1602294], [1602295, 2403441], [2403442, 3204588], [3204589, 4005735], [4005736, 4806882], [4806883, 5608029], [5608030, 6409176], [6409177, 7210323], [7210324, 8011470], [8011471, 8812617], [8812618, 9613764], [9613765, 10414911], [10414912, 11216058], [11216059, 12017205], [12017206, 12818352], [12818353, 13619499], [13619500, 14420646], [14420647, 15221793], [15221794, 16022949]] ERR1864451 file size 3843210 ERR1864451 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864451 ERR1864451_1.fastq ERR1864451_2.fastq Input file: ERR1864451_1.fastq Paired file: ERR1864451_2.fastq trimmed: ERR1864451-trimmed-pair1.fastq, ERR1864451-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 11:39:08 2025 >> started Thu Feb 13 11:39:24 2025 >> done (15.807s) 16022949 read pairs processed; of these: 311346 ( 1.94%) short read pairs filtered out after trimming by size control 367375 ( 2.29%) empty read pairs filtered out after trimming by size control 15344228 (95.76%) read pairs available; of these: 3738918 (24.37%) trimmed read pairs available after processing 11605310 (75.63%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 131 0.00% 19 274 0.00% 20 441 0.00% 21 592 0.00% 22 711 0.00% 23 901 0.01% 24 1093 0.01% 25 1272 0.01% 26 1527 0.01% 27 1759 0.01% 28 2034 0.01% 29 2343 0.02% 30 2716 0.02% 31 2981 0.02% 32 3425 0.02% 33 3738 0.02% 34 4135 0.03% 35 4481 0.03% 36 4640 0.03% 37 5141 0.03% 38 5511 0.04% 39 5827 0.04% 40 6237 0.04% 41 6515 0.04% 42 6931 0.05% 43 7294 0.05% 44 7595 0.05% 45 8063 0.05% 46 8484 0.06% 47 8829 0.06% 48 9260 0.06% 49 9808 0.06% 50 9769 0.06% 51 10326 0.07% 52 10888 0.07% 53 11334 0.07% 54 12088 0.08% 55 12473 0.08% 56 13237 0.09% 57 13946 0.09% 58 14863 0.10% 59 20503 0.13% 60 24835 0.16% 61 25122 0.16% 62 25100 0.16% 63 25832 0.17% 64 26157 0.17% 65 26693 0.17% 66 27457 0.18% 67 28557 0.19% 68 29041 0.19% 69 30064 0.20% 70 31931 0.21% 71 32969 0.21% 72 34304 0.22% 73 35404 0.23% 74 36336 0.24% 75 37705 0.25% 76 37701 0.25% 77 39458 0.26% 78 40975 0.27% 79 43034 0.28% 80 45339 0.30% 81 47559 0.31% 82 50036 0.33% 83 52827 0.34% 84 56491 0.37% 85 60284 0.39% 86 64711 0.42% 87 68693 0.45% 88 69128 0.45% 89 72231 0.47% 90 79923 0.52% 91 89001 0.58% 92 99497 0.65% 93 112498 0.73% 94 127731 0.83% 95 146161 0.95% 96 175585 1.14% 97 217895 1.42% 98 283447 1.85% 99 378848 2.47% 100 538242 3.51% 101 11605310 75.63% 15344228 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=3.73 fanout-score-rank=16 prefix-density=0.31 prefix-fanout=3.3 sequence=TTGTCATAAGATGTAGCAGTAGGCTGTGGGCCAAAATCCTTGACAAAATTATTCTTTTCATTGGACTCGGTTGTGTGGCAATCGGCTTTCTCATTGGAGACTGATGACAAT criterion=fanout-score sequence-density=0.08 sequence-density-rank=21 fanout-score=331.33 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=29.3 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=3.79 fanout-score-rank=27 prefix-density=0.17 prefix-fanout=3.0 sequence=ATTCAGAAGGAGT criterion=fanout-score sequence-density=0.07 sequence-density-rank=15 fanout-score=408.04 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=32.1 sequence=AAGAAGAAGAGAAG ERR1864451 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 11:40:07 Started mapping on | Feb 13 11:40:07 Finished on | Feb 13 11:40:50 Mapping speed, Million of reads per hour | 1284.63 Number of input reads | 15344228 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 14462027 Uniquely mapped reads % | 94.25% Average mapped length | 195.16 Number of splices: Total | 8391327 Number of splices: Annotated (sjdb) | 8242728 Number of splices: GT/AG | 8263197 Number of splices: GC/AG | 106039 Number of splices: AT/AC | 9037 Number of splices: Non-canonical | 13054 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.01% Deletion average length | 2.38 Insertion rate per base | 0.01% Insertion average length | 2.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 551016 % of reads mapped to multiple loci | 3.59% Number of reads mapped to too many loci | 21370 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.00% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 376815 376815 376815 N_multimapping 551016 551016 551016 N_noFeature 347942 14318481 416075 N_ambiguous 139527 784 63706 UnstrandedReadsAssigned:13974558 PositiveStrandReadsAssigned:142762 NegativeStrandReadsAssigned:13982246 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864451 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864451-trimmed-pair1.fastq ERR1864451-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,344,228 reads, 14,302,920 reads pseudoaligned [quant] estimated average fragment length: 157.924 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,074 rounds 52401 ERR1864451.ke.tsv 34699 ERR1864451.se.tsv 87100 total ==> ERR1864451.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1861.08 1739 68.0247 Potri.005G024800.1.v4.1 1035 878.076 932 77.2707 Potri.004G059700.1.v4.1 961 804.082 96 8.69165 Potri.007G009000.2.v4.1 1416 1259.08 0 0 Potri.003G141000.2.v4.1 2943 2786.08 607 15.8609 Potri.016G087400.1.v4.1 270 119.203 1448.34 884.538 Potri.015G069301.1.v4.1 564 407.185 0 0 Potri.010G195200.1.v4.1 1773 1616.08 125 5.63092 Potri.012G127500.1.v4.1 977 820.076 7007 622.027 ==> ERR1864451.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 473 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 354 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 35 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 160 ERR1864451 completed mapping pipeline successfully