Starting /dee2/code/volunteer_pipeline.sh ERR1864452 current disk space = 3092489641984 free memory = 1572677264 ERR1864452 SRAfilesize 9df1cb17236c691daef6bfa04886b150 ERR1864452.sra ERR1864452.sra file validated ERR1864452 is paired end ERR1864452 is conventional basespace ERR1864452 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864452_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.3435 33.0 31.0 34.0 30.0 34.0 2 31.58975 34.0 31.0 34.0 28.0 34.0 3 31.784 34.0 31.0 34.0 29.0 34.0 4 35.146 37.0 35.0 37.0 32.0 37.0 5 34.8825 37.0 35.0 37.0 32.0 37.0 6 34.916 37.0 35.0 37.0 32.0 37.0 7 34.92275 37.0 35.0 37.0 32.0 37.0 8 34.9025 37.0 35.0 37.0 32.0 37.0 9 36.487 39.0 37.0 39.0 32.0 39.0 10-11 36.324124999999995 39.0 37.0 39.0 32.0 39.0 12-13 36.231 39.0 37.0 39.0 32.0 39.0 14-15 37.480374999999995 40.0 38.0 41.0 32.0 41.0 16-17 37.20425 40.0 38.0 41.0 31.0 41.0 18-19 37.29475 40.0 38.0 41.0 32.0 41.0 20-21 37.222625 40.0 38.0 41.0 31.5 41.0 22-23 37.252250000000004 40.0 38.0 41.0 31.5 41.0 24-25 37.131 40.0 38.0 41.0 31.0 41.0 26-27 36.978625 40.0 37.0 41.0 30.5 41.0 28-29 36.4825 40.0 36.5 41.0 28.5 41.0 30-31 36.528625 40.0 37.0 41.0 30.0 41.0 32-33 36.361625000000004 40.0 36.5 41.0 29.5 41.0 34-35 36.2235 40.0 36.0 41.0 29.0 41.0 36-37 36.394 40.0 37.0 41.0 30.0 41.0 38-39 36.30325 40.0 36.5 41.0 29.5 41.0 40-41 36.2025 40.0 36.0 41.0 29.5 41.0 42-43 35.928 39.0 36.0 41.0 28.0 41.0 44-45 35.75025 39.0 35.5 41.0 27.5 41.0 46-47 35.624875 39.0 35.0 41.0 27.5 41.0 48-49 35.82875 39.0 35.0 41.0 27.5 41.0 50-51 35.588875 39.0 35.0 41.0 27.0 41.0 52-53 35.494625 39.0 35.0 41.0 26.5 41.0 54-55 35.395875000000004 39.0 35.0 41.0 26.0 41.0 56-57 35.197874999999996 39.0 35.0 41.0 26.0 41.0 58-59 34.9935 39.0 34.0 41.0 26.0 41.0 60-61 34.822625 38.0 34.0 40.0 26.0 41.0 62-63 34.45725 38.0 34.0 40.0 24.0 41.0 64-65 34.128125 37.5 34.0 40.0 23.0 41.0 66-67 33.87475 37.0 33.0 40.0 23.5 41.0 68-69 33.388875 36.5 33.0 39.0 22.0 41.0 70-71 32.967875 36.0 32.5 39.0 22.0 40.5 72-73 32.34675 35.0 32.0 38.5 20.0 40.0 74-75 32.18 35.0 32.0 37.5 21.0 39.0 76-77 30.948625 34.0 30.5 36.0 18.5 39.0 78-79 31.304499999999997 35.0 31.0 36.0 19.0 39.0 80-81 31.11875 35.0 31.5 36.0 18.0 37.0 82-83 30.838 35.0 31.0 36.0 18.0 37.0 84-85 30.57375 35.0 31.0 35.0 17.0 36.5 86-87 29.97025 34.0 30.5 35.0 8.5 36.0 88-89 29.65775 34.0 30.0 35.0 4.5 36.0 90-91 29.478375 34.0 30.0 35.0 2.0 35.5 92-93 29.094 34.0 29.5 35.0 2.0 35.0 94-95 28.773875 34.0 29.0 35.0 2.0 35.0 96-97 28.51325 34.0 29.0 35.0 2.0 35.0 98-99 28.063625000000002 34.0 29.0 35.0 2.0 35.0 100-101 26.51475 32.5 25.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 74.0 3 16.0 4 13.0 5 10.0 6 9.0 7 8.0 8 6.0 9 11.0 10 14.0 11 10.0 12 11.0 13 10.0 14 12.0 15 12.0 16 17.0 17 13.0 18 16.0 19 11.0 20 11.0 21 21.0 22 21.0 23 27.0 24 28.0 25 25.0 26 32.0 27 46.0 28 45.0 29 69.0 30 90.0 31 99.0 32 112.0 33 159.0 34 211.0 35 312.0 36 471.0 37 814.0 38 1008.0 39 126.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 52.42301867743564 6.7895002523977785 3.6345280161534577 37.152953054013125 2 26.974999999999998 5.625 32.725 34.675 3 23.724999999999998 9.55 23.9 42.825 4 28.575 15.125 22.975 33.324999999999996 5 29.175 20.625 25.575 24.625 6 23.95 25.275 24.5 26.275 7 17.075000000000003 23.825 42.449999999999996 16.650000000000002 8 16.075 22.975 38.05 22.900000000000002 9 17.474999999999998 22.5 38.275 21.75 10-11 19.6 31.8625 29.45 19.0875 12-13 20.95 26.5 30.887500000000003 21.6625 14-15 20.1125 27.675 30.7125 21.5 16-17 21.9 26.937499999999996 29.012500000000003 22.15 18-19 20.525 28.025 27.987499999999997 23.4625 20-21 20.925 27.450000000000003 29.212500000000002 22.412499999999998 22-23 20.375 27.750000000000004 28.975 22.900000000000002 24-25 21.512500000000003 26.375 27.825 24.2875 26-27 21.2 27.712500000000002 28.6875 22.400000000000002 28-29 21.512500000000003 27.450000000000003 28.0875 22.95 30-31 20.1375 27.987499999999997 28.6875 23.1875 32-33 21.0125 28.025 28.349999999999998 22.6125 34-35 21.0125 27.1125 28.1125 23.7625 36-37 20.8625 27.400000000000002 27.875 23.8625 38-39 20.6375 27.450000000000003 28.487499999999997 23.425 40-41 21.025 28.1375 27.975 22.8625 42-43 20.875 28.037499999999998 28.5625 22.525000000000002 44-45 21.4375 26.487500000000004 28.712500000000002 23.3625 46-47 21.212500000000002 27.85 27.750000000000004 23.1875 48-49 21.475 27.700000000000003 27.462500000000002 23.3625 50-51 21.2375 27.700000000000003 27.962500000000002 23.1 52-53 21.2375 28.175 27.962500000000002 22.625 54-55 21.2 28.225 27.625 22.95 56-57 21.4125 27.224999999999998 28.287499999999998 23.075000000000003 58-59 21.3 27.875 27.6125 23.2125 60-61 21.4875 28.249999999999996 27.9375 22.325 62-63 21.2 28.95 27.537499999999998 22.3125 64-65 20.8125 27.8375 28.3625 22.9875 66-67 21.5 26.875 28.199999999999996 23.425 68-69 21.7 26.8 27.8625 23.6375 70-71 21.55 27.725 28.299999999999997 22.425 72-73 21.8125 28.5875 27.1625 22.4375 74-75 20.9875 27.200000000000003 28.5875 23.225 76-77 21.85 27.037499999999998 29.099999999999998 22.0125 78-79 22.1375 27.0 27.575 23.2875 80-81 22.025 26.85 28.325 22.8 82-83 21.224999999999998 27.825 27.987499999999997 22.9625 84-85 21.1625 27.950000000000003 28.1375 22.75 86-87 21.825 27.725 27.8125 22.6375 88-89 21.212500000000002 28.449999999999996 27.975 22.3625 90-91 22.3625 28.1625 26.950000000000003 22.525000000000002 92-93 21.0 28.3875 27.3625 23.25 94-95 21.1375 28.4125 28.1625 22.287499999999998 96-97 21.975 28.5875 26.575 22.8625 98-99 22.25 27.8125 27.537499999999998 22.400000000000002 100-101 22.125 28.4375 27.55 21.8875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 1.5 23 3.5 24 5.0 25 5.5 26 6.0 27 5.5 28 6.5 29 8.5 30 10.0 31 12.5 32 22.0 33 33.0 34 41.5 35 52.0 36 67.5 37 89.5 38 102.5 39 134.5 40 180.5 41 222.0 42 234.5 43 242.5 44 248.5 45 270.0 46 304.0 47 281.0 48 250.0 49 214.5 50 186.0 51 154.5 52 116.0 53 103.5 54 87.5 55 63.0 56 44.0 57 33.0 58 31.5 59 29.5 60 20.0 61 14.5 62 11.5 63 8.5 64 9.5 65 8.5 66 5.5 67 5.0 68 4.0 69 1.0 70 1.0 71 1.0 72 0.5 73 0.5 74 0.5 75 1.5 76 1.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.95 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21578547938275 98.05 2 0.6071338224133569 1.2 3 0.05059448520111307 0.15 4 0.07589172780166961 0.3 5 0.0 0.0 6 0.05059448520111307 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTCCTTCAAATCAATGTCATATGATTCCACACCTTCCATTTTTCCCAAA 6 0.15 No Hit GGCTGATCTTTCATGACAGCTCTCCAATACTCTCCAGTGTCTTTTCTAGC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.2875 0.0 0.0 0.0 0.0 74-75 0.325 0.0 0.0 0.0 0.0 76-77 0.3625 0.0 0.0 0.0 0.0 78-79 0.4125 0.0 0.0 0.0 0.0 80-81 0.55 0.0 0.0 0.0 0.0 82-83 0.6875 0.0 0.0 0.0 0.0 84-85 0.7625 0.0 0.0 0.0 0.0 86-87 0.9874999999999999 0.0 0.0 0.0 0.0 88-89 1.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGATTTT 15 0.009957196 47.5 86-87 GATTTTC 15 0.009957196 47.5 86-87 >>END_MODULE ERR1864452 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864452_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.073 33.0 31.0 34.0 28.0 34.0 2 31.11475 33.0 31.0 34.0 27.0 34.0 3 31.181 34.0 31.0 34.0 27.0 34.0 4 34.61375 37.0 35.0 37.0 32.0 37.0 5 34.50575 37.0 35.0 37.0 32.0 37.0 6 34.4705 37.0 35.0 37.0 32.0 37.0 7 34.40325 37.0 35.0 37.0 32.0 37.0 8 34.50475 37.0 35.0 37.0 32.0 37.0 9 36.0135 39.0 37.0 39.0 32.0 39.0 10-11 35.931875 39.0 37.0 39.0 30.5 39.0 12-13 35.73225 39.0 37.0 39.0 30.5 39.0 14-15 36.921875 40.0 37.5 41.0 30.5 41.0 16-17 36.919 40.0 37.5 41.0 30.5 41.0 18-19 36.974625 40.0 38.0 41.0 30.5 41.0 20-21 36.77525 40.0 37.5 41.0 29.5 41.0 22-23 36.805875 40.0 38.0 41.0 30.0 41.0 24-25 36.780375 40.0 37.0 41.0 30.0 41.0 26-27 36.5605 40.0 37.0 41.0 29.5 41.0 28-29 36.329499999999996 40.0 37.0 41.0 28.0 41.0 30-31 36.340875 40.0 37.0 41.0 29.0 41.0 32-33 36.102875 40.0 36.5 41.0 27.0 41.0 34-35 36.008375 40.0 36.5 41.0 27.5 41.0 36-37 35.567125000000004 39.5 36.0 41.0 25.5 41.0 38-39 35.309 39.0 35.0 41.0 24.5 41.0 40-41 35.30575 39.0 35.0 41.0 25.0 41.0 42-43 35.198125 39.0 35.0 40.5 25.0 41.0 44-45 34.99725 39.0 35.0 40.0 24.0 41.0 46-47 35.208875 39.0 35.0 41.0 24.5 41.0 48-49 34.695625 38.5 34.5 40.0 23.0 41.0 50-51 34.094 38.0 33.5 39.5 23.0 40.5 52-53 34.060625 38.0 33.5 40.0 23.0 40.5 54-55 35.018125 39.0 35.0 40.5 24.5 41.0 56-57 35.13275 39.0 35.0 41.0 24.5 41.0 58-59 34.5955 39.0 34.0 41.0 22.0 41.0 60-61 34.604625 39.0 35.0 41.0 22.5 41.0 62-63 34.46275 38.0 34.0 40.0 23.5 41.0 64-65 33.812875 37.5 33.5 40.0 20.0 41.0 66-67 33.430875 37.0 33.5 40.0 20.0 41.0 68-69 33.116875 36.5 33.0 39.0 20.0 41.0 70-71 32.77075000000001 36.0 33.0 39.0 19.0 40.5 72-73 32.3035 35.5 32.5 38.5 19.0 40.0 74-75 31.755375 35.0 31.5 37.0 15.0 39.0 76-77 31.1045 35.0 31.0 37.0 9.0 39.0 78-79 30.7195 35.0 31.0 36.0 7.0 38.0 80-81 30.39 35.0 31.0 36.0 7.0 37.0 82-83 30.215625 35.0 31.0 35.5 7.0 37.0 84-85 29.950499999999998 34.0 31.0 35.0 2.0 36.0 86-87 29.673625 34.0 30.0 35.0 2.0 36.0 88-89 29.41875 34.0 30.0 35.0 2.0 36.0 90-91 29.144375 34.0 30.0 35.0 2.0 35.0 92-93 28.34975 34.0 28.5 35.0 2.0 35.0 94-95 28.1505 34.0 28.5 35.0 2.0 35.0 96-97 28.113500000000002 34.0 29.0 35.0 2.0 35.0 98-99 27.820875 34.0 29.0 35.0 2.0 35.0 100-101 26.88325 33.5 25.5 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 98.0 3 14.0 4 17.0 5 14.0 6 11.0 7 12.0 8 19.0 9 12.0 10 16.0 11 13.0 12 11.0 13 9.0 14 16.0 15 10.0 16 13.0 17 11.0 18 18.0 19 18.0 20 15.0 21 23.0 22 16.0 23 22.0 24 24.0 25 29.0 26 42.0 27 39.0 28 59.0 29 64.0 30 77.0 31 109.0 32 113.0 33 123.0 34 211.0 35 312.0 36 460.0 37 855.0 38 965.0 39 110.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.675 26.950000000000003 8.275 31.1 2 26.25 25.900000000000002 32.2 15.65 3 17.8 27.650000000000002 32.7 21.85 4 21.325 33.775 25.525 19.375 5 23.599999999999998 37.05 21.725 17.625 6 20.225 39.4 22.5 17.875 7 20.825 22.1 37.1 19.975 8 21.05 24.65 29.025000000000002 25.275 9 21.75 25.0 30.75 22.5 10-11 22.375 32.225 24.175 21.224999999999998 12-13 24.0 26.424999999999997 27.125 22.45 14-15 22.1 28.5625 27.8625 21.475 16-17 23.375 28.075 25.974999999999998 22.575 18-19 22.7 29.075 26.6125 21.6125 20-21 22.95 29.099999999999998 26.5125 21.4375 22-23 22.9875 29.2375 26.3625 21.4125 24-25 22.2 28.3875 27.6375 21.775 26-27 22.6 27.987499999999997 27.500000000000004 21.912499999999998 28-29 21.987499999999997 28.6375 27.2625 22.112499999999997 30-31 22.5125 28.1 26.8375 22.55 32-33 21.6 28.8875 27.425 22.0875 34-35 22.725 29.262500000000003 26.375 21.637500000000003 36-37 22.8375 28.1625 27.6 21.4 38-39 22.412499999999998 28.537499999999998 27.0875 21.9625 40-41 22.825 28.125 27.474999999999998 21.575 42-43 22.112499999999997 27.900000000000002 28.3375 21.65 44-45 21.9625 28.512500000000003 27.900000000000002 21.625 46-47 22.6125 29.225 27.287499999999998 20.875 48-49 22.525000000000002 27.6875 28.1125 21.675 50-51 22.5125 29.062500000000004 27.537499999999998 20.8875 52-53 22.8625 28.962500000000002 26.5875 21.587500000000002 54-55 22.1375 27.1125 28.712500000000002 22.037499999999998 56-57 21.4875 28.287499999999998 27.950000000000003 22.275 58-59 22.825 27.450000000000003 28.712500000000002 21.0125 60-61 22.125 27.5125 28.599999999999998 21.762500000000003 62-63 23.3125 28.1125 27.487499999999997 21.087500000000002 64-65 22.6375 28.6125 27.462500000000002 21.2875 66-67 21.875 28.449999999999996 27.700000000000003 21.975 68-69 22.7625 28.012500000000003 27.575 21.65 70-71 23.150000000000002 27.8875 27.6 21.3625 72-73 23.0375 27.537499999999998 28.3125 21.1125 74-75 23.025000000000002 28.625 26.950000000000003 21.4 76-77 22.4875 28.787499999999998 27.487499999999997 21.2375 78-79 22.537499999999998 28.3625 27.700000000000003 21.4 80-81 22.9625 28.025 27.3375 21.675 82-83 23.200000000000003 27.987499999999997 27.725 21.087500000000002 84-85 22.175 27.05 28.1375 22.6375 86-87 23.0375 28.225 27.0 21.7375 88-89 23.549999999999997 28.8375 26.8625 20.75 90-91 23.375 28.549999999999997 26.8125 21.2625 92-93 23.225 29.599999999999998 26.224999999999998 20.95 94-95 23.75 28.799999999999997 26.275 21.175 96-97 24.0 29.6875 25.374999999999996 20.9375 98-99 23.8625 28.575 26.125 21.4375 100-101 24.025 29.65 25.724999999999998 20.599999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 1.0 18 1.0 19 1.0 20 1.5 21 1.5 22 1.5 23 1.0 24 2.0 25 2.5 26 4.5 27 6.0 28 9.0 29 11.5 30 13.0 31 17.0 32 22.5 33 34.5 34 47.5 35 66.0 36 90.0 37 117.0 38 139.5 39 167.0 40 203.5 41 229.0 42 243.0 43 268.0 44 281.5 45 288.5 46 284.5 47 245.0 48 203.5 49 178.0 50 165.0 51 134.0 52 100.5 53 84.5 54 62.5 55 44.5 56 39.0 57 34.0 58 30.5 59 22.5 60 14.5 61 12.5 62 10.0 63 6.5 64 6.5 65 9.0 66 8.0 67 5.5 68 4.0 69 2.0 70 2.0 71 2.0 72 1.0 73 1.0 74 1.5 75 2.5 76 2.5 77 1.0 78 0.5 79 1.0 80 1.0 81 1.0 82 0.5 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64832956543582 99.175 2 0.30143180105501133 0.6 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.025119316754584273 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTTAATTTGAGACAGAAAACATGAAATCCTCCTACACTTTCTTCATTCT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.23750000000000002 0.0 0.0 0.0 0.0 74-75 0.275 0.0 0.0 0.0 0.0 76-77 0.3125 0.0 0.0 0.0 0.0 78-79 0.3625 0.0 0.0 0.0 0.0 80-81 0.5 0.0 0.0 0.0 0.0 82-83 0.6375 0.0 0.0 0.0 0.0 84-85 0.7 0.0 0.0 0.0 0.0 86-87 0.925 0.0 0.0 0.0 0.0 88-89 1.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 815984 spots for ERR1864452.sra Written 815984 spots for ERR1864452.sra Read 815984 spots for ERR1864452.sra Written 815984 spots for ERR1864452.sra Read 815984 spots for ERR1864452.sra Written 815984 spots for ERR1864452.sra Read 815984 spots for ERR1864452.sra Written 815984 spots for ERR1864452.sra Read 815984 spots for ERR1864452.sra Written 815984 spots for ERR1864452.sra Read 815984 spots for ERR1864452.sra Written 815984 spots for ERR1864452.sra Read 815984 spots for ERR1864452.sra Written 815984 spots for ERR1864452.sra Read 815984 spots for ERR1864452.sra Read 815984 spots for ERR1864452.sra Written 815984 spots for ERR1864452.sra Written 815984 spots for ERR1864452.sra Read 815984 spots for ERR1864452.sra Written 815984 spots for ERR1864452.sra Read 815984 spots for ERR1864452.sra Written 815984 spots for ERR1864452.sra Read 815984 spots for ERR1864452.sra Written 815984 spots for ERR1864452.sra Read 816001 spots for ERR1864452.sra Written 816001 spots for ERR1864452.sra Read 815984 spots for ERR1864452.sra Written 815984 spots for ERR1864452.sra Read 815984 spots for ERR1864452.sra Written 815984 spots for ERR1864452.sra Read 815984 spots for ERR1864452.sra Written 815984 spots for ERR1864452.sra Read 815984 spots for ERR1864452.sra Written 815984 spots for ERR1864452.sra Read 815984 spots for ERR1864452.sra Written 815984 spots for ERR1864452.sra Read 815984 spots for ERR1864452.sra Written 815984 spots for ERR1864452.sra Read 815984 spots for ERR1864452.sra Written 815984 spots for ERR1864452.sra SRR ids: ['ERR1864452.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fatsxbut ERR1864452.sra spots: 16319697 blocks: [[1, 815984], [815985, 1631968], [1631969, 2447952], [2447953, 3263936], [3263937, 4079920], [4079921, 4895904], [4895905, 5711888], [5711889, 6527872], [6527873, 7343856], [7343857, 8159840], [8159841, 8975824], [8975825, 9791808], [9791809, 10607792], [10607793, 11423776], [11423777, 12239760], [12239761, 13055744], [13055745, 13871728], [13871729, 14687712], [14687713, 15503696], [15503697, 16319697]] ERR1864452 file size 3914789 ERR1864452 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864452 ERR1864452_1.fastq ERR1864452_2.fastq Input file: ERR1864452_1.fastq Paired file: ERR1864452_2.fastq trimmed: ERR1864452-trimmed-pair1.fastq, ERR1864452-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 12:18:03 2025 >> started Thu Feb 13 12:18:18 2025 >> done (14.285s) 16319697 read pairs processed; of these: 406971 ( 2.49%) short read pairs filtered out after trimming by size control 591024 ( 3.62%) empty read pairs filtered out after trimming by size control 15321702 (93.88%) read pairs available; of these: 3898628 (25.45%) trimmed read pairs available after processing 11423074 (74.55%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 119 0.00% 19 257 0.00% 20 402 0.00% 21 535 0.00% 22 681 0.00% 23 906 0.01% 24 1016 0.01% 25 1208 0.01% 26 1553 0.01% 27 1721 0.01% 28 1982 0.01% 29 2271 0.01% 30 2589 0.02% 31 2912 0.02% 32 3289 0.02% 33 3517 0.02% 34 3944 0.03% 35 4258 0.03% 36 4396 0.03% 37 4946 0.03% 38 5298 0.03% 39 5725 0.04% 40 5926 0.04% 41 6286 0.04% 42 6481 0.04% 43 6874 0.04% 44 7236 0.05% 45 7664 0.05% 46 8126 0.05% 47 8521 0.06% 48 8737 0.06% 49 9334 0.06% 50 9533 0.06% 51 10191 0.07% 52 10680 0.07% 53 11289 0.07% 54 11689 0.08% 55 12517 0.08% 56 13235 0.09% 57 14039 0.09% 58 14967 0.10% 59 23327 0.15% 60 30271 0.20% 61 29904 0.20% 62 29509 0.19% 63 29528 0.19% 64 29795 0.19% 65 30299 0.20% 66 30562 0.20% 67 31173 0.20% 68 32148 0.21% 69 32740 0.21% 70 34399 0.22% 71 35240 0.23% 72 36804 0.24% 73 38380 0.25% 74 38617 0.25% 75 40174 0.26% 76 39597 0.26% 77 41565 0.27% 78 43173 0.28% 79 45895 0.30% 80 48314 0.32% 81 50807 0.33% 82 53930 0.35% 83 57257 0.37% 84 60804 0.40% 85 64735 0.42% 86 68708 0.45% 87 73292 0.48% 88 74063 0.48% 89 77420 0.51% 90 85875 0.56% 91 94724 0.62% 92 105271 0.69% 93 119197 0.78% 94 134856 0.88% 95 152768 1.00% 96 182339 1.19% 97 223767 1.46% 98 289351 1.89% 99 383991 2.51% 100 537209 3.51% 101 11423074 74.55% 15321702 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=3.27 fanout-score-rank=16 prefix-density=0.30 prefix-fanout=3.0 sequence=TTGTCATAAGATGTAGCAGTAGGCTGTGGGCCAAAATCCTTG criterion=fanout-score sequence-density=0.09 sequence-density-rank=14 fanout-score=264.14 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=28.5 sequence=CTTCTTCTTCTC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=4.69 fanout-score-rank=17 prefix-density=0.29 prefix-fanout=3.4 sequence=CAAGGATTTTGGCCCACAGCCTACTGCTACATCTTATGACAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=19 fanout-score=405.09 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=32.9 sequence=AAGAAGAAGAGAAG ERR1864452 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 12:18:51 Started mapping on | Feb 13 12:18:51 Finished on | Feb 13 12:19:35 Mapping speed, Million of reads per hour | 1253.59 Number of input reads | 15321702 Average input read length | 194 UNIQUE READS: Uniquely mapped reads number | 14452546 Uniquely mapped reads % | 94.33% Average mapped length | 194.76 Number of splices: Total | 8493563 Number of splices: Annotated (sjdb) | 8346672 Number of splices: GT/AG | 8364417 Number of splices: GC/AG | 107421 Number of splices: AT/AC | 8958 Number of splices: Non-canonical | 12767 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.01% Deletion average length | 2.40 Insertion rate per base | 0.01% Insertion average length | 2.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 559726 % of reads mapped to multiple loci | 3.65% Number of reads mapped to too many loci | 17835 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.89% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 385478 385478 385478 N_multimapping 559726 559726 559726 N_noFeature 329311 14321852 390745 N_ambiguous 132955 699 63294 UnstrandedReadsAssigned:13990280 PositiveStrandReadsAssigned:129995 NegativeStrandReadsAssigned:13998507 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864452 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864452-trimmed-pair1.fastq ERR1864452-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,321,702 reads, 14,338,247 reads pseudoaligned [quant] estimated average fragment length: 152.852 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,050 rounds 52401 ERR1864452.ke.tsv 34699 ERR1864452.se.tsv 87100 total ==> ERR1864452.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1866.15 1756.61 72.5257 Potri.005G024800.1.v4.1 1035 883.148 698 60.8955 Potri.004G059700.1.v4.1 961 809.148 48 4.57063 Potri.007G009000.2.v4.1 1416 1264.15 0 0 Potri.003G141000.2.v4.1 2943 2791.15 598.249 16.5144 Potri.016G087400.1.v4.1 270 123.534 1111 692.932 Potri.015G069301.1.v4.1 564 412.232 0 0 Potri.010G195200.1.v4.1 1773 1621.15 150.761 7.16521 Potri.012G127500.1.v4.1 977 825.148 9499 886.971 ==> ERR1864452.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 440 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 353 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 48 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 174 ERR1864452 completed mapping pipeline successfully