Starting /dee2/code/volunteer_pipeline.sh ERR1864453 current disk space = 3092673044480 free memory = 1580028328 ERR1864453 SRAfilesize 82113569d7b439ec296c228f7f7496dd ERR1864453.sra ERR1864453.sra file validated ERR1864453 is paired end ERR1864453 is conventional basespace ERR1864453 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864453_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.71025 33.0 31.0 34.0 28.0 34.0 2 31.50675 34.0 31.0 34.0 28.0 34.0 3 32.10125 34.0 31.0 34.0 28.0 34.0 4 35.40925 37.0 35.0 37.0 33.0 37.0 5 35.285 37.0 35.0 37.0 33.0 37.0 6 35.2165 37.0 35.0 37.0 32.0 37.0 7 35.16775 37.0 35.0 37.0 33.0 37.0 8 35.20475 37.0 35.0 37.0 33.0 37.0 9 36.88425 39.0 37.0 39.0 34.0 39.0 10-11 36.840999999999994 39.0 37.0 39.0 33.0 39.0 12-13 36.711625 39.0 37.0 39.0 32.5 39.0 14-15 38.03475 40.0 38.0 41.0 33.0 41.0 16-17 37.966 40.0 38.0 41.0 33.0 41.0 18-19 37.872249999999994 40.0 38.0 41.0 32.5 41.0 20-21 37.7555 40.0 38.0 41.0 33.0 41.0 22-23 37.592125 40.0 38.0 41.0 32.0 41.0 24-25 37.601124999999996 40.0 38.0 41.0 32.5 41.0 26-27 37.578625 40.0 38.0 41.0 32.0 41.0 28-29 37.4915 40.0 38.0 41.0 32.0 41.0 30-31 37.237375 40.0 38.0 41.0 31.0 41.0 32-33 37.237375 40.0 38.0 41.0 31.0 41.0 34-35 37.053124999999994 40.0 37.0 41.0 30.5 41.0 36-37 36.946 40.0 37.0 41.0 30.5 41.0 38-39 36.798625 40.0 37.0 41.0 30.0 41.0 40-41 36.6625 40.0 36.5 41.0 30.0 41.0 42-43 36.433 40.0 36.0 41.0 30.0 41.0 44-45 36.439875 40.0 36.5 41.0 30.0 41.0 46-47 36.46775 40.0 36.0 41.0 29.5 41.0 48-49 36.55375 40.0 36.0 41.0 30.0 41.0 50-51 36.254 40.0 36.0 41.0 29.0 41.0 52-53 36.008750000000006 39.5 35.0 41.0 28.5 41.0 54-55 35.76575 39.0 35.0 41.0 28.0 41.0 56-57 35.623999999999995 39.0 35.0 41.0 28.0 41.0 58-59 35.405625 39.0 35.0 41.0 27.5 41.0 60-61 35.011375 38.5 34.0 40.0 26.0 41.0 62-63 34.69175 38.0 34.0 40.0 26.0 41.0 64-65 34.2745 37.5 34.0 40.0 26.0 41.0 66-67 33.9475 37.0 33.0 40.0 25.0 41.0 68-69 33.553 36.0 33.0 39.0 24.5 41.0 70-71 33.121624999999995 36.0 33.0 39.0 24.0 40.0 72-73 32.694625 35.0 32.5 38.5 22.5 40.0 74-75 32.1075 35.0 32.0 37.0 20.0 39.0 76-77 31.20225 34.0 30.5 36.0 20.0 39.0 78-79 31.44825 35.0 31.5 36.0 20.0 38.5 80-81 31.30025 35.0 31.5 36.0 20.0 37.0 82-83 30.97525 35.0 31.0 35.5 19.0 37.0 84-85 30.637500000000003 34.5 31.0 35.0 17.0 36.5 86-87 30.022375 34.0 30.5 35.0 11.0 36.0 88-89 29.74875 34.0 30.0 35.0 7.0 36.0 90-91 29.588875 34.0 30.0 35.0 4.5 35.5 92-93 29.272624999999998 34.0 30.0 35.0 2.0 35.0 94-95 29.02825 34.0 30.0 35.0 2.0 35.0 96-97 28.662374999999997 34.0 30.0 35.0 2.0 35.0 98-99 28.162374999999997 34.0 29.0 35.0 2.0 35.0 100-101 27.037125 33.0 27.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 41.0 3 21.0 4 9.0 5 14.0 6 13.0 7 6.0 8 9.0 9 8.0 10 8.0 11 9.0 12 4.0 13 15.0 14 12.0 15 12.0 16 11.0 17 17.0 18 18.0 19 17.0 20 13.0 21 15.0 22 16.0 23 24.0 24 23.0 25 27.0 26 27.0 27 51.0 28 46.0 29 62.0 30 87.0 31 89.0 32 118.0 33 145.0 34 209.0 35 307.0 36 488.0 37 829.0 38 1045.0 39 135.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.701686121919586 4.280155642023346 7.67833981841764 38.339818417639435 2 31.1 6.525 30.25 32.125 3 30.125 9.35 20.025000000000002 40.5 4 33.35 16.275000000000002 21.275 29.099999999999998 5 31.532883220805203 20.155038759689923 26.18154538634659 22.13053263315829 6 23.305826456614152 27.00675168792198 26.60665166291573 23.080770192548137 7 19.975 21.025 43.375 15.625 8 20.330082520630157 22.85571392848212 36.1090272568142 20.705176294073517 9 20.0 21.85 37.65 20.5 10-11 21.742935733933482 31.657914478619652 29.34483620905226 17.254313578394598 12-13 23.40585146286572 25.131282820705174 31.43285821455364 20.030007501875467 14-15 21.017754438609654 27.581895473868467 30.97024256064016 20.43010752688172 16-17 23.25581395348837 27.831957989497376 28.994748687171796 19.91747936984246 18-19 22.443110777694425 27.506876719179797 29.15728932233058 20.892723180795198 20-21 22.380595148787197 27.631907976994246 29.43235808952238 20.555138784696176 22-23 22.705676419104776 27.406851712928233 28.832208052013 21.05526381595399 24-25 21.742935733933482 27.169292323080768 29.00725181295324 22.080520130032507 26-27 22.230557639409852 26.63165791447862 28.51962990747687 22.61815453863466 28-29 22.968242060515127 27.79444861215304 28.33208302075519 20.905226306576644 30-31 21.180295073768445 27.38184546136534 29.069767441860467 22.36809202300575 32-33 21.94298574643661 26.669167291822955 28.769692423105774 22.61815453863466 34-35 21.355338834708675 26.556639159789945 30.320080020005 21.767941985496375 36-37 21.66791697924481 26.994248562140534 28.882220555138783 22.455613903475868 38-39 21.555388847211805 27.68192048012003 28.75718929732433 22.005501375343837 40-41 23.018254563640912 26.694173543385848 28.68217054263566 21.605401350337583 42-43 22.50562640660165 26.894223555888974 29.094773693423353 21.50537634408602 44-45 22.455613903475868 27.419354838709676 27.494373593398347 22.630657664416105 46-47 21.99299824956239 27.84446111527882 28.40710177544386 21.75543885971493 48-49 22.930732683170792 27.74443610902726 27.206801700425103 22.118029507376843 50-51 22.405601400350086 26.494123530882717 28.857214303575894 22.2430607651913 52-53 23.49918536157413 26.319087604963027 28.211555332748468 21.970171700714374 54-55 22.705676419104776 27.11927981995499 28.89472368092023 21.280320080020005 56-57 22.693173293323333 27.38184546136534 28.069517379344838 21.85546386596649 58-59 22.655663915978995 27.981995498874717 27.581895473868467 21.780445111277817 60-61 22.943235808952238 27.319329832458116 28.069517379344838 21.66791697924481 62-63 21.975 28.3125 27.750000000000004 21.9625 64-65 22.925 28.299999999999997 27.725 21.05 66-67 21.775 27.875 27.900000000000002 22.45 68-69 22.5625 27.525 27.712500000000002 22.2 70-71 23.1125 28.025 28.0875 20.775 72-73 22.7625 28.225 27.3125 21.7 74-75 22.275 27.8125 27.6 22.3125 76-77 22.25 28.299999999999997 28.225 21.224999999999998 78-79 22.420907840440165 27.49781167937977 27.51031636863824 22.570964111541826 80-81 22.977872234029252 27.54094261782723 27.528441055131893 21.952744093011624 82-83 22.59032379047381 28.20352544068008 27.628453556694588 21.57769721215152 84-85 22.6875 28.15 27.537499999999998 21.625 86-87 22.662499999999998 28.1 27.35 21.8875 88-89 23.4875 27.725 27.037499999999998 21.75 90-91 23.65 28.6125 26.025 21.712500000000002 92-93 23.5 27.950000000000003 26.5875 21.9625 94-95 23.9 27.3875 26.950000000000003 21.762500000000003 96-97 23.125 28.549999999999997 26.400000000000002 21.925 98-99 23.400000000000002 28.675 26.387500000000003 21.5375 100-101 23.849999999999998 28.425 25.674999999999997 22.05 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.5 17 1.0 18 0.5 19 2.5 20 2.5 21 1.0 22 0.5 23 1.0 24 2.5 25 4.5 26 6.0 27 6.5 28 8.5 29 13.5 30 18.5 31 23.0 32 24.5 33 28.5 34 37.0 35 52.5 36 78.0 37 112.0 38 123.5 39 134.5 40 169.5 41 192.5 42 208.5 43 228.5 44 254.5 45 261.5 46 257.0 47 249.0 48 243.5 49 212.5 50 167.5 51 146.5 52 119.5 53 106.5 54 100.5 55 78.5 56 61.5 57 50.0 58 40.0 59 32.5 60 23.5 61 20.5 62 21.5 63 17.5 64 13.0 65 10.5 66 7.5 67 4.5 68 3.5 69 3.0 70 2.5 71 2.5 72 1.0 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.6249999999999996 2 0.0 3 0.0 4 0.0 5 0.025 6 0.025 7 0.0 8 0.025 9 0.0 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.025 38-39 0.025 40-41 0.025 42-43 0.025 44-45 0.025 46-47 0.025 48-49 0.025 50-51 0.025 52-53 0.2625 54-55 0.025 56-57 0.025 58-59 0.025 60-61 0.025 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0375 80-81 0.0125 82-83 0.0125 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.83278355747272 97.375 2 0.96422227860949 1.9 3 0.10149708195889369 0.3 4 0.07612281146917026 0.3 5 0.025374270489723422 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGCTGATCTTTCATGACAGCTCTCCAATACTCTCCAGTGTCTTTTCTAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.0625 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.1875 0.0 0.0 0.0 0.0 56-57 0.2625 0.0 0.0 0.0 0.0 58-59 0.325 0.0 0.0 0.0 0.0 60-61 0.4 0.0 0.0 0.0 0.0 62-63 0.48750000000000004 0.0 0.0 0.0 0.0 64-65 0.6 0.0 0.0 0.0 0.0 66-67 0.625 0.0 0.0 0.0 0.0 68-69 0.7375 0.0 0.0 0.0 0.0 70-71 1.0 0.0 0.0 0.0 0.0 72-73 1.25 0.0 0.0 0.0 0.0 74-75 1.5875 0.0 0.0 0.0 0.0 76-77 1.95 0.0 0.0 0.0 0.0 78-79 2.3 0.0 0.0 0.0 0.0 80-81 2.8125 0.0 0.0 0.0 0.0 82-83 3.5125 0.0 0.0 0.0 0.0 84-85 4.15 0.0 0.0 0.0 0.0 86-87 5.0625 0.0 0.0 0.0 0.0 88-89 6.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGATG 20 0.0017401327 73.05769 1 >>END_MODULE ERR1864453 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864453_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.95225 34.0 31.0 34.0 30.0 34.0 2 32.014 34.0 31.0 34.0 30.0 34.0 3 32.14375 34.0 31.0 34.0 30.0 34.0 4 35.2815 37.0 35.0 37.0 33.0 37.0 5 35.28025 37.0 35.0 37.0 33.0 37.0 6 35.36925 37.0 36.0 37.0 33.0 37.0 7 35.43125 37.0 36.0 37.0 33.0 37.0 8 35.433 37.0 36.0 37.0 33.0 37.0 9 36.94925 39.0 38.0 39.0 34.0 39.0 10-11 36.9375 39.0 38.0 39.0 33.5 39.0 12-13 36.811875 39.0 37.5 39.0 33.0 39.0 14-15 38.185874999999996 41.0 38.0 41.0 33.5 41.0 16-17 38.06225 41.0 38.0 41.0 33.0 41.0 18-19 38.143249999999995 40.5 38.0 41.0 33.5 41.0 20-21 38.076750000000004 40.0 38.0 41.0 33.5 41.0 22-23 37.845124999999996 40.0 38.0 41.0 32.5 41.0 24-25 37.842124999999996 40.0 38.0 41.0 32.5 41.0 26-27 37.790875 40.0 38.0 41.0 32.5 41.0 28-29 37.511625 40.0 38.0 41.0 32.0 41.0 30-31 37.46725 40.0 38.0 41.0 32.0 41.0 32-33 37.19175 40.0 38.0 41.0 31.0 41.0 34-35 37.216125000000005 40.0 38.0 41.0 31.0 41.0 36-37 37.01475 40.0 38.0 41.0 30.0 41.0 38-39 36.83775 40.0 37.5 41.0 30.0 41.0 40-41 36.67575 40.0 37.0 41.0 30.0 41.0 42-43 36.60724999999999 40.0 37.0 41.0 30.0 41.0 44-45 36.449375 40.0 37.0 41.0 29.5 41.0 46-47 36.18375 40.0 36.0 41.0 28.5 41.0 48-49 35.986625000000004 39.0 36.0 41.0 27.5 41.0 50-51 35.691875 38.5 35.5 40.5 28.0 41.0 52-53 35.87075 39.0 36.0 40.5 28.0 41.0 54-55 36.218125 40.0 36.0 41.0 28.5 41.0 56-57 35.93625 39.5 36.0 41.0 28.0 41.0 58-59 35.707750000000004 39.0 35.0 41.0 27.0 41.0 60-61 35.44475 39.0 35.0 41.0 27.5 41.0 62-63 35.196875 38.5 35.0 41.0 26.5 41.0 64-65 34.856624999999994 38.0 34.5 40.0 26.0 41.0 66-67 34.468 37.5 34.0 40.0 25.5 41.0 68-69 33.997 37.0 34.0 39.5 25.0 41.0 70-71 33.544875 36.0 33.5 39.0 24.5 41.0 72-73 33.055499999999995 36.0 33.0 39.0 22.5 40.5 74-75 32.620625000000004 35.0 33.0 37.5 23.0 39.0 76-77 31.82175 35.0 31.5 37.0 19.5 39.0 78-79 31.47025 35.0 31.5 36.5 20.0 39.0 80-81 31.025 35.0 31.0 36.0 18.0 37.0 82-83 30.785249999999998 35.0 31.0 35.5 16.0 37.0 84-85 30.36275 34.5 31.0 35.0 8.0 36.5 86-87 29.833 34.0 30.0 35.0 4.5 36.0 88-89 29.303375000000003 34.0 30.0 35.0 2.0 36.0 90-91 29.200499999999998 34.0 30.0 35.0 2.0 35.5 92-93 28.8945 34.0 30.0 35.0 2.0 35.0 94-95 28.5895 34.0 29.0 35.0 2.0 35.0 96-97 27.658375 34.0 27.5 35.0 2.0 35.0 98-99 26.974625 34.0 25.5 35.0 2.0 35.0 100-101 25.75575 32.5 22.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 45.0 3 12.0 4 6.0 5 8.0 6 5.0 7 10.0 8 11.0 9 6.0 10 9.0 11 11.0 12 12.0 13 16.0 14 15.0 15 13.0 16 14.0 17 12.0 18 9.0 19 15.0 20 14.0 21 21.0 22 20.0 23 25.0 24 35.0 25 45.0 26 34.0 27 50.0 28 52.0 29 70.0 30 72.0 31 92.0 32 108.0 33 140.0 34 187.0 35 263.0 36 460.0 37 870.0 38 1026.0 39 187.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.882720680170046 20.10502625656414 13.628407101775444 35.38384596149037 2 24.88122030507627 26.85671417854464 31.38284571142786 16.879219804951237 3 20.05501375343836 28.207051762940733 30.23255813953488 21.50537634408602 4 22.80570142535634 32.03300825206302 22.55563890972743 22.605651412853213 5 23.080770192548137 35.98399599899975 22.605651412853213 18.3295823955989 6 18.125 38.2 24.15 19.525000000000002 7 18.875 20.75 39.475 20.9 8 19.854963740935233 24.88122030507627 27.93198299574894 27.33183295823956 9 20.65 25.074999999999996 30.075000000000003 24.2 10-11 22.162499999999998 31.937500000000004 23.5125 22.3875 12-13 22.294507694232454 25.547353934692858 28.012010509195544 24.146127861879144 14-15 21.312296518908088 28.412221387427998 27.73603806661658 22.539444027047335 16-17 22.961480740370185 28.264132066033014 26.863431715857928 21.91095547773887 18-19 21.390173771721464 29.628703587948497 26.478309788723593 22.502812851606453 20-21 21.25265658207276 29.428678584823103 27.128391048881113 22.190273784223027 22-23 21.675 29.037499999999998 26.887499999999996 22.400000000000002 24-25 22.0 28.4125 27.187499999999996 22.400000000000002 26-27 21.65 29.4875 26.8375 22.025 28-29 21.375 29.375 27.1375 22.112499999999997 30-31 21.512500000000003 28.825 27.125 22.537499999999998 32-33 21.349999999999998 28.962500000000002 27.1375 22.55 34-35 21.7375 29.7 26.2875 22.275 36-37 21.462500000000002 29.1625 27.5875 21.7875 38-39 22.55 27.700000000000003 27.224999999999998 22.525000000000002 40-41 22.240280035004375 27.94099262407801 26.778347293411674 23.040380047505938 42-43 21.725 27.8875 27.6 22.787499999999998 44-45 21.762500000000003 27.650000000000002 27.762500000000003 22.825 46-47 21.975 28.449999999999996 27.0125 22.5625 48-49 22.3625 28.225 27.025 22.3875 50-51 21.775 27.85 27.800000000000004 22.575 52-53 22.1875 28.525 27.0125 22.275 54-55 21.890236279534943 27.590948868608578 27.728466058257283 22.7903487935992 56-57 21.680420105026258 28.507126781695426 27.38184546136534 22.43060765191298 58-59 21.45268158519815 27.69096137017127 28.116014501812725 22.740342542817853 60-61 21.6125 27.800000000000004 27.775 22.8125 62-63 21.725 28.5625 26.75 22.9625 64-65 22.575 27.775 27.487499999999997 22.162499999999998 66-67 22.175 27.962500000000002 27.1125 22.75 68-69 22.0125 28.799999999999997 27.1125 22.075 70-71 23.1 28.349999999999998 25.974999999999998 22.575 72-73 21.1875 29.212500000000002 27.85 21.75 74-75 21.5 28.95 26.6625 22.8875 76-77 23.674999999999997 28.15 26.575 21.6 78-79 22.112499999999997 28.95 26.187500000000004 22.75 80-81 22.075 28.8875 26.0625 22.975 82-83 22.6 29.312500000000004 25.837500000000002 22.25 84-85 22.7625 28.875 26.0125 22.35 86-87 22.975 29.475 25.0375 22.5125 88-89 23.6625 29.012500000000003 24.975 22.35 90-91 22.3875 29.6875 26.337500000000002 21.587500000000002 92-93 23.275000000000002 29.25 25.525 21.95 94-95 24.2 29.049999999999997 25.074999999999996 21.675 96-97 23.4125 29.2875 24.887500000000003 22.412499999999998 98-99 23.7375 29.95 24.6625 21.65 100-101 25.45 28.675 24.212500000000002 21.6625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 1.0 21 0.5 22 0.5 23 2.0 24 4.5 25 6.0 26 4.5 27 6.5 28 9.5 29 10.5 30 15.0 31 21.0 32 31.5 33 38.0 34 45.5 35 71.5 36 103.5 37 121.5 38 134.5 39 162.5 40 185.0 41 210.0 42 249.0 43 253.0 44 241.5 45 243.5 46 249.5 47 234.5 48 207.0 49 176.0 50 155.0 51 141.5 52 115.0 53 97.0 54 77.0 55 60.5 56 50.0 57 47.0 58 47.0 59 33.5 60 26.0 61 23.5 62 15.0 63 13.5 64 10.5 65 6.5 66 6.0 67 7.5 68 7.0 69 5.0 70 4.0 71 1.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 1.5 79 1.0 80 1.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.025 5 0.025 6 0.0 7 0.0 8 0.025 9 0.0 10-11 0.0 12-13 0.08750000000000001 14-15 0.17500000000000002 16-17 0.05 18-19 0.0125 20-21 0.0125 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0125 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0125 56-57 0.025 58-59 0.0125 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44668008048289 98.85000000000001 2 0.528169014084507 1.05 3 0.0 0.0 4 0.025150905432595575 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.0625 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.1875 0.0 0.0 0.0 0.0 56-57 0.2625 0.0 0.0 0.0 0.0 58-59 0.325 0.0 0.0 0.0 0.0 60-61 0.4 0.0 0.0 0.0 0.0 62-63 0.48750000000000004 0.0 0.0 0.0 0.0 64-65 0.6 0.0 0.0 0.0 0.0 66-67 0.625 0.0 0.0 0.0 0.0 68-69 0.7125 0.0 0.0 0.0 0.0 70-71 1.0 0.0 0.0 0.0 0.0 72-73 1.275 0.0 0.0 0.0 0.0 74-75 1.6125 0.0 0.0 0.0 0.0 76-77 1.975 0.0 0.0 0.0 0.0 78-79 2.35 0.0 0.0 0.0 0.0 80-81 2.8875 0.0 0.0 0.0 0.0 82-83 3.5875 0.0 0.0 0.0 0.0 84-85 4.2625 0.0 0.0 0.0 0.0 86-87 5.0875 0.0 0.0 0.0 0.0 88-89 6.112500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGGAAG 50 0.0015149588 23.75 92-93 >>END_MODULE Read 584172 spots for ERR1864453.sra Written 584172 spots for ERR1864453.sra Read 584172 spots for ERR1864453.sra Written 584172 spots for ERR1864453.sra Read 584172 spots for ERR1864453.sra Written 584172 spots for ERR1864453.sra Read 584172 spots for ERR1864453.sra Written 584172 spots for ERR1864453.sra Read 584172 spots for ERR1864453.sra Written 584172 spots for ERR1864453.sra Read 584172 spots for ERR1864453.sra Written 584172 spots for ERR1864453.sra Read 584172 spots for ERR1864453.sra Written 584172 spots for ERR1864453.sra Read 584172 spots for ERR1864453.sra Written 584172 spots for ERR1864453.sra Read 584172 spots for ERR1864453.sra Written 584172 spots for ERR1864453.sra Read 584172 spots for ERR1864453.sra Written 584172 spots for ERR1864453.sra Read 584172 spots for ERR1864453.sra Written 584172 spots for ERR1864453.sra Read 584172 spots for ERR1864453.sra Written 584172 spots for ERR1864453.sra Read 584172 spots for ERR1864453.sra Written 584172 spots for ERR1864453.sra Read 584172 spots for ERR1864453.sra Written 584172 spots for ERR1864453.sra Read 584172 spots for ERR1864453.sra Written 584172 spots for ERR1864453.sra Read 584172 spots for ERR1864453.sra Written 584172 spots for ERR1864453.sra Read 584172 spots for ERR1864453.sra Written 584172 spots for ERR1864453.sra Read 584189 spots for ERR1864453.sra Written 584189 spots for ERR1864453.sra Read 584172 spots for ERR1864453.sra Written 584172 spots for ERR1864453.sra Read 584172 spots for ERR1864453.sra Written 584172 spots for ERR1864453.sra SRR ids: ['ERR1864453.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_h863x4eq ERR1864453.sra spots: 11683457 blocks: [[1, 584172], [584173, 1168344], [1168345, 1752516], [1752517, 2336688], [2336689, 2920860], [2920861, 3505032], [3505033, 4089204], [4089205, 4673376], [4673377, 5257548], [5257549, 5841720], [5841721, 6425892], [6425893, 7010064], [7010065, 7594236], [7594237, 8178408], [8178409, 8762580], [8762581, 9346752], [9346753, 9930924], [9930925, 10515096], [10515097, 11099268], [11099269, 11683457]] ERR1864453 file size 2796477 ERR1864453 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864453 ERR1864453_1.fastq ERR1864453_2.fastq Input file: ERR1864453_1.fastq Paired file: ERR1864453_2.fastq trimmed: ERR1864453-trimmed-pair1.fastq, ERR1864453-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 12:10:50 2025 >> started Thu Feb 13 12:11:01 2025 >> done (10.878s) 11683457 read pairs processed; of these: 161351 ( 1.38%) short read pairs filtered out after trimming by size control 193093 ( 1.65%) empty read pairs filtered out after trimming by size control 11329013 (96.97%) read pairs available; of these: 3571741 (31.53%) trimmed read pairs available after processing 7757272 (68.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 46 0.00% 19 92 0.00% 20 173 0.00% 21 231 0.00% 22 282 0.00% 23 364 0.00% 24 442 0.00% 25 550 0.00% 26 647 0.01% 27 762 0.01% 28 855 0.01% 29 987 0.01% 30 1178 0.01% 31 1353 0.01% 32 1515 0.01% 33 1666 0.01% 34 1870 0.02% 35 1968 0.02% 36 2244 0.02% 37 2514 0.02% 38 2563 0.02% 39 2942 0.03% 40 3126 0.03% 41 3326 0.03% 42 3611 0.03% 43 3821 0.03% 44 4021 0.04% 45 4275 0.04% 46 4678 0.04% 47 4974 0.04% 48 5414 0.05% 49 5677 0.05% 50 6255 0.06% 51 6436 0.06% 52 7060 0.06% 53 7597 0.07% 54 8086 0.07% 55 8669 0.08% 56 9442 0.08% 57 10257 0.09% 58 11381 0.10% 59 16108 0.14% 60 20046 0.18% 61 20848 0.18% 62 21272 0.19% 63 22428 0.20% 64 22930 0.20% 65 23746 0.21% 66 25126 0.22% 67 26779 0.24% 68 27983 0.25% 69 29144 0.26% 70 31175 0.28% 71 32581 0.29% 72 35053 0.31% 73 37731 0.33% 74 40316 0.36% 75 41830 0.37% 76 43834 0.39% 77 46566 0.41% 78 49293 0.44% 79 52370 0.46% 80 55919 0.49% 81 59919 0.53% 82 63854 0.56% 83 68053 0.60% 84 73541 0.65% 85 78815 0.70% 86 83222 0.73% 87 87869 0.78% 88 90528 0.80% 89 94467 0.83% 90 100509 0.89% 91 107222 0.95% 92 114007 1.01% 93 122937 1.09% 94 134219 1.18% 95 147247 1.30% 96 165210 1.46% 97 190577 1.68% 98 228332 2.02% 99 278812 2.46% 100 415973 3.67% 101 7757272 68.47% 11329013 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.91 fanout-score-rank=24 prefix-density=0.33 prefix-fanout=2.8 sequence=TTGTCATAAGATGTAGCAGTAGGCTGTGGGCCAAAATCCTTGACAAAATTATTCTTTTCATTGGACTCGGTTGTGTGGCAATCGGCTTTCTCATTGGAGACTGATGACAAT criterion=fanout-score sequence-density=0.09 sequence-density-rank=16 fanout-score=223.46 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=25.3 sequence=TTCTTCTTCTTT criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=3.85 fanout-score-rank=28 prefix-density=0.37 prefix-fanout=2.8 sequence=ATGATGGTGTCG criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=328.85 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=15.4 sequence=AAGAAAGAAATACACAATGGCAGGAATCATGCACAAGATTGAGGAGACTCTGAACATTGGAGGCAAGAAAGATGAGCGCAAGGGTGAGACACAAGGTGGGTACAACCAACAAGAGCA ERR1864453 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 12:11:31 Started mapping on | Feb 13 12:11:34 Finished on | Feb 13 12:12:11 Mapping speed, Million of reads per hour | 1102.28 Number of input reads | 11329013 Average input read length | 193 UNIQUE READS: Uniquely mapped reads number | 10642071 Uniquely mapped reads % | 93.94% Average mapped length | 193.31 Number of splices: Total | 5263909 Number of splices: Annotated (sjdb) | 5142647 Number of splices: GT/AG | 5182880 Number of splices: GC/AG | 66817 Number of splices: AT/AC | 4798 Number of splices: Non-canonical | 9414 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 2.34 Insertion rate per base | 0.01% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 393951 % of reads mapped to multiple loci | 3.48% Number of reads mapped to too many loci | 27556 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.32% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 322842 322842 322842 N_multimapping 393951 393951 393951 N_noFeature 399561 10434726 554826 N_ambiguous 114500 965 61634 UnstrandedReadsAssigned:10128010 PositiveStrandReadsAssigned:206380 NegativeStrandReadsAssigned:10025611 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=97 echo kmer=93 ERR1864453 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864453-trimmed-pair1.fastq ERR1864453-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,329,013 reads, 10,258,023 reads pseudoaligned [quant] estimated average fragment length: 138.726 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,137 rounds 52401 ERR1864453.ke.tsv 34699 ERR1864453.se.tsv 87100 total ==> ERR1864453.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1880.27 882 56.224 Potri.005G024800.1.v4.1 1035 897.274 203 27.1172 Potri.004G059700.1.v4.1 961 823.28 23 3.34853 Potri.007G009000.2.v4.1 1416 1278.27 0 0 Potri.003G141000.2.v4.1 2943 2805.27 376.205 16.074 Potri.016G087400.1.v4.1 270 136.414 305 267.988 Potri.015G069301.1.v4.1 564 426.327 0 0 Potri.010G195200.1.v4.1 1773 1635.27 164 12.0206 Potri.012G127500.1.v4.1 977 839.28 5883 840.169 ==> ERR1864453.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 299 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 197 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 18 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 104 ERR1864453 completed mapping pipeline successfully