Starting /dee2/code/volunteer_pipeline.sh ERR1864454 current disk space = 2821036085248 free memory = 1581326444 ERR1864454 SRAfilesize d1bb277b4748e64750550d6f4c91cfba ERR1864454.sra ERR1864454.sra file validated ERR1864454 is paired end ERR1864454 is conventional basespace ERR1864454 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864454_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.81625 33.0 31.0 34.0 28.0 34.0 2 31.50875 34.0 31.0 34.0 28.0 34.0 3 32.0765 34.0 31.0 34.0 29.0 34.0 4 35.46675 37.0 35.0 37.0 33.0 37.0 5 35.33675 37.0 35.0 37.0 33.0 37.0 6 35.14925 37.0 35.0 37.0 32.0 37.0 7 35.2175 37.0 35.0 37.0 33.0 37.0 8 35.2095 37.0 35.0 37.0 33.0 37.0 9 36.97275 39.0 37.0 39.0 33.0 39.0 10-11 36.903375 39.0 37.0 39.0 33.0 39.0 12-13 36.8475 39.0 37.0 39.0 33.0 39.0 14-15 38.167125 40.0 38.0 41.0 33.0 41.0 16-17 38.016875 40.0 38.0 41.0 33.0 41.0 18-19 37.96225 40.0 38.0 41.0 33.0 41.0 20-21 37.831875 40.0 38.0 41.0 32.5 41.0 22-23 37.688 40.0 38.0 41.0 32.0 41.0 24-25 37.664625 40.0 38.0 41.0 32.0 41.0 26-27 37.62425 40.0 38.0 41.0 32.0 41.0 28-29 37.43425 40.0 38.0 41.0 32.0 41.0 30-31 37.308125000000004 40.0 38.0 41.0 31.5 41.0 32-33 37.297625 40.0 37.5 41.0 31.5 41.0 34-35 37.028375 40.0 37.0 41.0 30.5 41.0 36-37 36.914625 40.0 37.0 41.0 30.0 41.0 38-39 36.798125 40.0 37.0 41.0 30.0 41.0 40-41 36.66425 40.0 37.0 41.0 30.0 41.0 42-43 36.50575 40.0 36.0 41.0 30.0 41.0 44-45 36.447874999999996 40.0 36.0 41.0 30.0 41.0 46-47 36.430625 40.0 36.0 41.0 30.0 41.0 48-49 36.32125 40.0 36.0 41.0 29.0 41.0 50-51 36.209 40.0 36.0 41.0 29.0 41.0 52-53 35.985 39.5 35.5 41.0 28.5 41.0 54-55 35.73175 39.0 35.0 41.0 28.0 41.0 56-57 35.584500000000006 39.0 35.0 41.0 28.0 41.0 58-59 35.363625 39.0 34.5 40.5 27.5 41.0 60-61 35.014125 38.5 34.5 40.0 26.0 41.0 62-63 34.687 38.0 34.0 40.0 26.5 41.0 64-65 34.21125 37.0 34.0 40.0 25.5 41.0 66-67 33.880125 37.0 33.0 40.0 25.0 41.0 68-69 33.605125 36.0 33.0 39.0 25.0 41.0 70-71 33.109625 36.0 33.0 39.0 23.5 40.5 72-73 32.626625000000004 35.0 32.0 38.0 22.5 40.0 74-75 32.0595 35.0 31.5 37.0 21.5 39.0 76-77 31.0785 34.0 30.5 36.0 20.0 39.0 78-79 31.394624999999998 35.0 31.0 36.0 20.0 38.5 80-81 31.189500000000002 35.0 31.0 36.0 20.0 37.0 82-83 30.87225 34.5 31.0 35.5 19.5 37.0 84-85 30.602125 34.0 31.0 35.0 18.0 36.5 86-87 29.886249999999997 34.0 30.0 35.0 10.5 36.0 88-89 29.76725 34.0 30.0 35.0 7.5 36.0 90-91 29.601625 34.0 30.0 35.0 4.5 35.0 92-93 29.169625 34.0 29.5 35.0 2.0 35.0 94-95 28.95825 34.0 30.0 35.0 2.0 35.0 96-97 28.69325 34.0 29.0 35.0 2.0 35.0 98-99 28.36975 34.0 29.0 35.0 2.0 35.0 100-101 27.221375000000002 33.0 27.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 34.0 3 24.0 4 8.0 5 5.0 6 12.0 7 6.0 8 6.0 9 7.0 10 6.0 11 10.0 12 7.0 13 15.0 14 15.0 15 11.0 16 20.0 17 18.0 18 22.0 19 16.0 20 24.0 21 18.0 22 19.0 23 21.0 24 17.0 25 23.0 26 37.0 27 46.0 28 44.0 29 54.0 30 74.0 31 94.0 32 121.0 33 168.0 34 228.0 35 328.0 36 450.0 37 866.0 38 992.0 39 134.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.693402328589904 4.3984476067270375 7.089262613195343 39.81888745148771 2 28.875 5.800000000000001 31.775 33.550000000000004 3 30.025000000000002 8.75 21.85 39.375 4 34.875 15.075 19.8 30.25 5 32.433108277069266 19.879969992498125 24.90622655663916 22.780695173793447 6 22.230557639409852 26.556639159789945 28.68217054263566 22.53063265816454 7 18.779694923730933 20.980245061265315 44.81120280070017 15.428857214303576 8 19.154788697174293 21.780445111277817 36.33408352088022 22.73068267066767 9 19.279819954988746 20.905226306576644 38.50962740685171 21.305326331582897 10-11 21.94298574643661 31.64541135283821 28.244561140285075 18.16704176044011 12-13 22.20555138784696 25.418854713678417 33.033258314578646 19.342335583895974 14-15 21.530382595648913 27.581895473868467 31.43285821455364 19.454863715928983 16-17 22.605651412853213 27.569392348087025 29.744936234058517 20.080020005001252 18-19 22.268067016754188 27.219304826206553 29.41985496374094 21.092773193298324 20-21 22.255563890972745 26.9567391847962 29.469867466866717 21.31782945736434 22-23 22.493123280820203 28.66966741685421 29.057264316079017 19.779944986246562 24-25 23.705926481620406 26.344086021505376 27.7569392348087 22.193048262065513 26-27 21.355338834708675 28.469617404351087 29.144786196549138 21.030257564391096 28-29 22.268067016754188 26.85671417854464 29.03225806451613 21.842960740185045 30-31 22.05551387846962 26.65666416604151 29.34483620905226 21.94298574643661 32-33 22.18054513628407 26.131532883220803 28.982245561390346 22.705676419104776 34-35 22.53063265816454 27.306826706676667 28.80720180045011 21.355338834708675 36-37 21.817954488622153 26.04401100275069 29.332333083270818 22.80570142535634 38-39 21.905476369092273 27.731932983245812 28.257064266066518 22.1055263815954 40-41 21.8304576144036 26.731682920730183 29.08227056764191 22.355588897224308 42-43 22.443110777694425 26.581645411352838 28.719679919979995 22.255563890972745 44-45 21.767941985496375 27.506876719179797 28.694673668417103 22.030507626906726 46-47 22.330582645661416 27.056764191047762 28.582145536384097 22.030507626906726 48-49 21.867966991747938 27.11927981995499 28.482120530132534 22.53063265816454 50-51 20.905226306576644 27.769442360590148 28.794698674668666 22.53063265816454 52-53 22.665162341732483 27.91776357026451 27.541682336718065 21.875391751284944 54-55 22.005501375343837 28.80720180045011 27.44436109027257 21.742935733933482 56-57 22.36809202300575 27.66941735433858 27.806951737934483 22.155538884721178 58-59 22.50562640660165 27.86946736684171 27.169292323080768 22.455613903475868 60-61 22.193048262065513 28.132033008252062 27.581895473868467 22.093023255813954 62-63 22.66816704176044 27.79444861215304 27.819454863715933 21.717929482370593 64-65 23.5625 26.650000000000002 28.0625 21.725 66-67 21.7375 28.3125 27.875 22.075 68-69 22.843210802700675 27.481870467616904 28.107026756689173 21.567891972993248 70-71 23.22790348793599 27.54094261782723 27.990998874859358 21.240155019377422 72-73 22.875 27.250000000000004 28.050000000000004 21.825 74-75 22.777847230903863 28.30353794224278 27.87848481060132 21.040130016252032 76-77 22.640330041255158 26.828353544193025 28.491061382672832 22.040255031878985 78-79 22.59194395796848 28.246184638478862 27.145359019264447 22.016512384288216 80-81 23.40292536567071 27.590948868608578 27.803475434429302 21.202650331291412 82-83 23.39042380297537 27.703462932866607 27.728466058257283 21.177647205900737 84-85 22.8875 28.1375 27.3 21.675 86-87 22.4625 27.6875 27.725 22.125 88-89 22.3625 27.287499999999998 27.8125 22.537499999999998 90-91 23.3875 27.900000000000002 26.875 21.837500000000002 92-93 23.5875 27.237499999999997 27.1125 22.0625 94-95 23.474999999999998 28.462500000000002 26.6625 21.4 96-97 23.0625 28.3375 26.200000000000003 22.400000000000002 98-99 23.4875 29.3375 26.075 21.099999999999998 100-101 23.2875 28.6625 25.412499999999998 22.6375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 2.0 20 2.5 21 1.0 22 0.5 23 2.0 24 2.0 25 2.5 26 4.0 27 5.5 28 9.5 29 12.0 30 14.0 31 21.0 32 28.5 33 36.5 34 45.0 35 58.5 36 69.0 37 84.5 38 113.5 39 150.5 40 184.5 41 200.5 42 224.0 43 249.5 44 255.5 45 268.5 46 268.5 47 236.0 48 222.0 49 206.5 50 169.0 51 142.0 52 117.5 53 106.0 54 97.5 55 75.0 56 55.5 57 43.5 58 34.5 59 31.5 60 31.0 61 26.5 62 24.5 63 18.5 64 9.5 65 7.0 66 6.0 67 6.5 68 8.0 69 5.0 70 2.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.375 2 0.0 3 0.0 4 0.0 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.025 38-39 0.025 40-41 0.025 42-43 0.025 44-45 0.025 46-47 0.025 48-49 0.025 50-51 0.025 52-53 0.2875 54-55 0.025 56-57 0.025 58-59 0.025 60-61 0.025 62-63 0.025 64-65 0.0 66-67 0.0 68-69 0.025 70-71 0.0125 72-73 0.0 74-75 0.0125 76-77 0.0125 78-79 0.075 80-81 0.0125 82-83 0.0125 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.075 #Duplication Level Percentage of deduplicated Percentage of total 1 98.47055824624013 96.575 2 1.1470813153199082 2.25 3 0.3313790466479735 0.975 4 0.05098139179199593 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.23750000000000002 0.0 0.0 0.0 0.0 60-61 0.3 0.0 0.0 0.0 0.0 62-63 0.4625 0.0 0.0 0.0 0.0 64-65 0.5874999999999999 0.0 0.0 0.0 0.0 66-67 0.7875 0.0 0.0 0.0 0.0 68-69 1.0 0.0 0.0 0.0 0.0 70-71 1.25 0.0 0.0 0.0 0.0 72-73 1.4875 0.0 0.0 0.0 0.0 74-75 1.9874999999999998 0.0 0.0 0.0 0.0 76-77 2.5875000000000004 0.0 0.0 0.0 0.0 78-79 3.15 0.0 0.0 0.0 0.0 80-81 3.7249999999999996 0.0 0.0 0.0 0.0 82-83 4.5 0.0 0.0 0.0 0.0 84-85 5.5875 0.0 0.0 0.0 0.0 86-87 6.65 0.0 0.0 0.0 0.0 88-89 7.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864454 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864454_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.9655 34.0 31.0 34.0 30.0 34.0 2 31.98675 34.0 31.0 34.0 30.0 34.0 3 32.15025 34.0 31.0 34.0 30.0 34.0 4 35.36725 37.0 35.0 37.0 33.0 37.0 5 35.36475 37.0 35.0 37.0 33.0 37.0 6 35.479 37.0 36.0 37.0 33.0 37.0 7 35.42425 37.0 36.0 37.0 33.0 37.0 8 35.344 37.0 36.0 37.0 33.0 37.0 9 36.954 39.0 37.0 39.0 33.0 39.0 10-11 37.046 39.0 38.0 39.0 34.0 39.0 12-13 36.94025 39.0 37.5 39.0 33.5 39.0 14-15 38.281625 41.0 38.0 41.0 34.0 41.0 16-17 38.161 41.0 38.0 41.0 33.0 41.0 18-19 38.187375 41.0 38.5 41.0 33.5 41.0 20-21 38.108125 40.5 38.5 41.0 33.5 41.0 22-23 37.81075 40.0 38.0 41.0 32.0 41.0 24-25 37.81425 40.0 38.0 41.0 32.5 41.0 26-27 37.708375000000004 40.0 38.0 41.0 32.5 41.0 28-29 37.539 40.0 38.0 41.0 31.5 41.0 30-31 37.467625 40.0 38.0 41.0 32.0 41.0 32-33 37.2705 40.0 38.0 41.0 31.0 41.0 34-35 37.260625000000005 40.0 38.0 41.0 31.0 41.0 36-37 37.088125000000005 40.0 38.0 41.0 30.5 41.0 38-39 36.937749999999994 40.0 37.5 41.0 30.0 41.0 40-41 36.925125 40.0 37.0 41.0 30.0 41.0 42-43 36.849999999999994 40.0 37.0 41.0 30.0 41.0 44-45 36.698875 40.0 37.0 41.0 30.0 41.0 46-47 36.396125 40.0 36.5 41.0 29.5 41.0 48-49 36.2505 39.5 36.0 41.0 29.5 41.0 50-51 35.86275 39.0 36.0 40.5 28.5 41.0 52-53 36.03225 39.0 36.0 40.5 29.0 41.0 54-55 36.3125 40.0 36.0 41.0 28.5 41.0 56-57 36.256375 40.0 36.0 41.0 29.0 41.0 58-59 36.0275 39.5 35.5 41.0 28.5 41.0 60-61 35.738625 39.0 35.0 41.0 28.0 41.0 62-63 35.430125000000004 39.0 35.0 41.0 28.0 41.0 64-65 35.105999999999995 38.0 35.0 40.0 27.5 41.0 66-67 34.74375 37.5 34.5 40.0 26.5 41.0 68-69 34.325125 37.0 34.0 39.5 26.0 41.0 70-71 33.799499999999995 36.5 34.0 39.0 26.0 41.0 72-73 33.244 36.0 33.5 39.0 24.0 40.0 74-75 32.823 35.0 33.0 37.5 23.5 39.5 76-77 32.076875 35.0 32.5 37.0 22.0 39.0 78-79 31.82325 35.0 32.0 36.0 21.5 39.0 80-81 31.466625 35.0 32.0 36.0 20.0 37.0 82-83 31.0515 35.0 31.5 35.5 19.0 37.0 84-85 30.654875 35.0 31.0 35.0 17.5 36.5 86-87 30.202875 34.0 30.5 35.0 12.5 36.0 88-89 29.8335 34.0 30.5 35.0 7.0 36.0 90-91 29.75225 34.0 30.5 35.0 4.5 35.5 92-93 29.42425 34.0 30.0 35.0 2.0 35.0 94-95 29.024749999999997 34.0 30.0 35.0 2.0 35.0 96-97 28.148125 34.0 28.0 35.0 2.0 35.0 98-99 27.545875 34.0 27.0 35.0 2.0 35.0 100-101 26.23775 32.5 25.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 34.0 3 12.0 4 9.0 5 6.0 6 3.0 7 16.0 8 7.0 9 7.0 10 12.0 11 12.0 12 8.0 13 16.0 14 11.0 15 15.0 16 7.0 17 17.0 18 18.0 19 8.0 20 16.0 21 22.0 22 31.0 23 20.0 24 23.0 25 35.0 26 37.0 27 39.0 28 50.0 29 46.0 30 74.0 31 75.0 32 117.0 33 117.0 34 193.0 35 273.0 36 491.0 37 867.0 38 1100.0 39 156.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.90772693173293 20.655163790947736 13.553388347086774 34.883720930232556 2 24.193144858643983 25.193895421566175 32.12409306980235 18.48886664998749 3 19.379844961240313 27.081770442610654 30.107526881720432 23.43085771442861 4 21.491118338754063 33.600200150112585 22.692019014260694 22.216662496872654 5 22.58064516129032 36.809202300575144 22.95573893473368 17.65441360340085 6 20.175 39.074999999999996 22.525000000000002 18.224999999999998 7 19.05 19.625 37.974999999999994 23.35 8 19.254813703425857 24.756189047261813 30.55763940985246 25.431357839459867 9 19.925 24.099999999999998 29.45 26.525 10-11 22.152769096137018 32.57907238404801 23.49043630453807 21.77772221527691 12-13 22.31952958838984 26.485674965594896 26.54822970098836 24.646565745026898 14-15 20.766533066132265 29.020541082164332 27.59268537074148 22.62024048096192 16-17 21.56347717323327 29.380863039399625 26.19136960600375 22.86429018136335 18-19 20.745279479804925 28.635738401900714 27.58534450418907 23.03363761410529 20-21 21.752719089886234 29.47868483560445 26.815851981497683 21.952744093011624 22-23 22.0625 28.812500000000004 26.5875 22.537499999999998 24-25 22.55 29.375 26.3625 21.712500000000002 26-27 21.2375 29.1875 27.712500000000002 21.8625 28-29 22.152769096137018 27.715964495561945 27.765970746343292 22.365295661957745 30-31 22.3 28.549999999999997 27.0125 22.1375 32-33 21.475 28.875 27.200000000000003 22.45 34-35 22.2625 29.075 26.437500000000004 22.225 36-37 21.45 28.299999999999997 27.2625 22.9875 38-39 21.912499999999998 29.4375 27.125 21.525 40-41 21.377672209026127 27.86598324790599 27.565945743217902 23.19039879984998 42-43 22.0625 28.712500000000002 27.6375 21.587500000000002 44-45 22.0125 28.175 27.900000000000002 21.912499999999998 46-47 21.0375 29.225 27.224999999999998 22.5125 48-49 21.2875 28.599999999999998 27.3625 22.75 50-51 22.325 28.8625 26.7125 22.1 52-53 22.3625 28.075 27.4125 22.15 54-55 21.790223777972244 28.86610826353294 27.165895736967123 22.177772221527693 56-57 21.635817908954476 28.58929464732366 27.07603801900951 22.698849424712357 58-59 22.315289411176398 28.50356294536817 27.340917614701837 21.840230028753595 60-61 23.2875 27.9375 26.05 22.725 62-63 22.1 28.175 27.250000000000004 22.475 64-65 22.5125 27.737499999999997 26.875 22.875 66-67 21.5 29.4375 26.724999999999998 22.3375 68-69 21.65 29.6875 26.974999999999998 21.6875 70-71 22.325 28.849999999999998 26.900000000000002 21.925 72-73 22.4375 28.749999999999996 26.887499999999996 21.925 74-75 21.8875 28.6125 27.0125 22.4875 76-77 22.8375 29.25 26.2125 21.7 78-79 21.75 28.925 26.625 22.7 80-81 22.4875 29.037499999999998 25.8125 22.662499999999998 82-83 23.0125 29.349999999999998 25.35 22.287499999999998 84-85 22.375 28.3625 27.200000000000003 22.0625 86-87 22.7125 28.449999999999996 25.775 23.0625 88-89 23.425 28.525 25.324999999999996 22.725 90-91 23.9375 28.8875 24.962500000000002 22.2125 92-93 24.1125 30.125 24.9125 20.849999999999998 94-95 24.95 29.099999999999998 25.0 20.95 96-97 24.9875 28.9875 24.887500000000003 21.1375 98-99 24.9875 29.4375 24.3 21.275 100-101 25.825 28.475 24.1875 21.512500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 0.5 22 0.0 23 0.5 24 2.5 25 4.5 26 5.0 27 4.5 28 5.5 29 13.0 30 15.0 31 19.0 32 33.5 33 43.5 34 57.0 35 68.5 36 79.0 37 107.0 38 135.0 39 154.0 40 194.0 41 231.0 42 249.0 43 257.0 44 256.0 45 252.5 46 248.0 47 243.0 48 205.5 49 174.5 50 157.5 51 123.5 52 109.5 53 107.0 54 93.5 55 66.5 56 48.0 57 45.5 58 40.0 59 29.0 60 21.0 61 18.5 62 15.5 63 14.0 64 10.5 65 7.5 66 6.5 67 4.5 68 4.0 69 5.0 70 3.5 71 1.0 72 0.0 73 1.0 74 1.5 75 1.0 76 0.5 77 0.0 78 0.0 79 1.0 80 1.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.075 3 0.025 4 0.075 5 0.025 6 0.0 7 0.0 8 0.025 9 0.0 10-11 0.0125 12-13 0.08750000000000001 14-15 0.2 16-17 0.0625 18-19 0.0375 20-21 0.0125 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0125 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0125 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0125 56-57 0.05 58-59 0.0125 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77420973406925 99.425 2 0.2007024586051179 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025087807325639738 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTTAATTTGAGACAGAAAACATGAAATCCTCCTACACTTTCTTCATTCT 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.25 0.0 0.0 0.0 0.0 60-61 0.325 0.0 0.0 0.0 0.0 62-63 0.48750000000000004 0.0 0.0 0.0 0.0 64-65 0.6125 0.0 0.0 0.0 0.0 66-67 0.7875 0.0 0.0 0.0 0.0 68-69 1.0 0.0 0.0 0.0 0.0 70-71 1.25 0.0 0.0 0.0 0.0 72-73 1.475 0.0 0.0 0.0 0.0 74-75 1.95 0.0 0.0 0.0 0.0 76-77 2.55 0.0 0.0 0.0 0.0 78-79 3.125 0.0 0.0 0.0 0.0 80-81 3.7 0.0 0.0 0.0 0.0 82-83 4.3875 0.0 0.0 0.0 0.0 84-85 5.5 0.0 0.0 0.0 0.0 86-87 6.525 0.0 0.0 0.0 0.0 88-89 7.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 527949 spots for ERR1864454.sra Written 527949 spots for ERR1864454.sra Read 527949 spots for ERR1864454.sra Written 527949 spots for ERR1864454.sra Read 527949 spots for ERR1864454.sra Written 527949 spots for ERR1864454.sra Read 527949 spots for ERR1864454.sra Written 527949 spots for ERR1864454.sra Read 527949 spots for ERR1864454.sra Written 527949 spots for ERR1864454.sra Read 527949 spots for ERR1864454.sra Written 527949 spots for ERR1864454.sra Read 527949 spots for ERR1864454.sra Written 527949 spots for ERR1864454.sra Read 527949 spots for ERR1864454.sra Written 527949 spots for ERR1864454.sra Read 527949 spots for ERR1864454.sra Written 527949 spots for ERR1864454.sra Read 527949 spots for ERR1864454.sra Written 527949 spots for ERR1864454.sra Read 527949 spots for ERR1864454.sra Written 527949 spots for ERR1864454.sra Read 527949 spots for ERR1864454.sra Written 527949 spots for ERR1864454.sra Read 527959 spots for ERR1864454.sra Written 527959 spots for ERR1864454.sra Read 527949 spots for ERR1864454.sra Written 527949 spots for ERR1864454.sra Read 527949 spots for ERR1864454.sra Written 527949 spots for ERR1864454.sra Read 527949 spots for ERR1864454.sra Written 527949 spots for ERR1864454.sra Read 527949 spots for ERR1864454.sra Written 527949 spots for ERR1864454.sra Read 527949 spots for ERR1864454.sra Written 527949 spots for ERR1864454.sra Read 527949 spots for ERR1864454.sra Written 527949 spots for ERR1864454.sra Read 527949 spots for ERR1864454.sra Written 527949 spots for ERR1864454.sra SRR ids: ['ERR1864454.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_631skios ERR1864454.sra spots: 10558990 blocks: [[1, 527949], [527950, 1055898], [1055899, 1583847], [1583848, 2111796], [2111797, 2639745], [2639746, 3167694], [3167695, 3695643], [3695644, 4223592], [4223593, 4751541], [4751542, 5279490], [5279491, 5807439], [5807440, 6335388], [6335389, 6863337], [6863338, 7391286], [7391287, 7919235], [7919236, 8447184], [8447185, 8975133], [8975134, 9503082], [9503083, 10031031], [10031032, 10558990]] ERR1864454 file size 2525243 ERR1864454 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864454 ERR1864454_1.fastq ERR1864454_2.fastq Input file: ERR1864454_1.fastq Paired file: ERR1864454_2.fastq trimmed: ERR1864454-trimmed-pair1.fastq, ERR1864454-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Apr 10 15:06:36 2025 >> started Thu Apr 10 15:06:45 2025 >> done (9.340s) 10558990 read pairs processed; of these: 132879 ( 1.26%) short read pairs filtered out after trimming by size control 145890 ( 1.38%) empty read pairs filtered out after trimming by size control 10280221 (97.36%) read pairs available; of these: 3439987 (33.46%) trimmed read pairs available after processing 6840234 (66.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 55 0.00% 19 116 0.00% 20 198 0.00% 21 269 0.00% 22 317 0.00% 23 358 0.00% 24 451 0.00% 25 590 0.01% 26 676 0.01% 27 831 0.01% 28 916 0.01% 29 1036 0.01% 30 1240 0.01% 31 1302 0.01% 32 1530 0.01% 33 1768 0.02% 34 1875 0.02% 35 2037 0.02% 36 2313 0.02% 37 2480 0.02% 38 2681 0.03% 39 2892 0.03% 40 3143 0.03% 41 3288 0.03% 42 3747 0.04% 43 3697 0.04% 44 4014 0.04% 45 4177 0.04% 46 4740 0.05% 47 5027 0.05% 48 5359 0.05% 49 5842 0.06% 50 6179 0.06% 51 6718 0.07% 52 7133 0.07% 53 7660 0.07% 54 8051 0.08% 55 8738 0.08% 56 9681 0.09% 57 10447 0.10% 58 11628 0.11% 59 15295 0.15% 60 18034 0.18% 61 19223 0.19% 62 19924 0.19% 63 21111 0.21% 64 21942 0.21% 65 23290 0.23% 66 24545 0.24% 67 25972 0.25% 68 26875 0.26% 69 29062 0.28% 70 31079 0.30% 71 32910 0.32% 72 35691 0.35% 73 37742 0.37% 74 40165 0.39% 75 42196 0.41% 76 44629 0.43% 77 46715 0.45% 78 49879 0.49% 79 53314 0.52% 80 56679 0.55% 81 60232 0.59% 82 65001 0.63% 83 68750 0.67% 84 73814 0.72% 85 78561 0.76% 86 82462 0.80% 87 87332 0.85% 88 89855 0.87% 89 93163 0.91% 90 98865 0.96% 91 105429 1.03% 92 110638 1.08% 93 119423 1.16% 94 128086 1.25% 95 140820 1.37% 96 156141 1.52% 97 178959 1.74% 98 210274 2.05% 99 254223 2.47% 100 376487 3.66% 101 6840234 66.54% 10280221 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=35 prefix-density=0.24 prefix-fanout=1.9 sequence=TGCACCGGTGGTATCTTAGGAGGATACTTTGGTGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=14 fanout-score=240.87 fanout-score-rank=1 prefix-density=0.95 prefix-fanout=23.3 sequence=CTTCTTCTTCTTT criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=5.01 fanout-score-rank=26 prefix-density=0.32 prefix-fanout=3.3 sequence=ATGATGGTGTCG criterion=fanout-score sequence-density=0.08 sequence-density-rank=16 fanout-score=281.85 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=25.0 sequence=AAGAAGAAGAGTTACTTTGAGCAAGCCAAGGACATGATACCAGCATATAAGAAAACTGAAGA ERR1864454 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 10 15:07:23 Started mapping on | Apr 10 15:07:23 Finished on | Apr 10 15:07:55 Mapping speed, Million of reads per hour | 1156.52 Number of input reads | 10280221 Average input read length | 192 UNIQUE READS: Uniquely mapped reads number | 9654337 Uniquely mapped reads % | 93.91% Average mapped length | 192.61 Number of splices: Total | 4635363 Number of splices: Annotated (sjdb) | 4525288 Number of splices: GT/AG | 4563201 Number of splices: GC/AG | 59601 Number of splices: AT/AC | 4481 Number of splices: Non-canonical | 8080 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 2.34 Insertion rate per base | 0.01% Insertion average length | 2.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 355531 % of reads mapped to multiple loci | 3.46% Number of reads mapped to too many loci | 26031 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.35% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 288250 288250 288250 N_multimapping 355531 355531 355531 N_noFeature 372927 9479306 500074 N_ambiguous 106464 690 58044 UnstrandedReadsAssigned:9174946 PositiveStrandReadsAssigned:174341 NegativeStrandReadsAssigned:9096219 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=95 echo kmer=91 ERR1864454 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864454-trimmed-pair1.fastq ERR1864454-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,280,221 reads, 9,301,186 reads pseudoaligned [quant] estimated average fragment length: 135.534 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,064 rounds 52401 ERR1864454.ke.tsv 34699 ERR1864454.se.tsv 87100 total ==> ERR1864454.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1883.47 729 51.1906 Potri.005G024800.1.v4.1 1035 900.466 223 32.7535 Potri.004G059700.1.v4.1 961 826.471 26 4.1607 Potri.007G009000.2.v4.1 1416 1281.47 0 0 Potri.003G141000.2.v4.1 2943 2808.47 351 16.5294 Potri.016G087400.1.v4.1 270 139.018 262 249.258 Potri.015G069301.1.v4.1 564 429.517 0 0 Potri.010G195200.1.v4.1 1773 1638.47 155 12.5116 Potri.012G127500.1.v4.1 977 842.466 5118 803.467 ==> ERR1864454.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 183 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 146 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 16 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 136 ERR1864454 completed mapping pipeline successfully