Starting /dee2/code/volunteer_pipeline.sh ERR1864455 current disk space = 3093365927936 free memory = 1462568944 ERR1864455 SRAfilesize 97d02396ced0f387c0ededdedb8f7e7e ERR1864455.sra ERR1864455.sra file validated ERR1864455 is paired end ERR1864455 is conventional basespace ERR1864455 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864455_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.8125 34.0 31.0 34.0 27.0 34.0 2 31.56675 34.0 31.0 34.0 28.0 34.0 3 32.2035 34.0 31.0 34.0 29.0 34.0 4 35.64325 37.0 35.0 37.0 33.0 37.0 5 35.56175 37.0 35.0 37.0 35.0 37.0 6 35.4795 37.0 35.0 37.0 33.0 37.0 7 35.4865 37.0 35.0 37.0 33.0 37.0 8 35.4705 37.0 35.0 37.0 33.0 37.0 9 37.179 39.0 38.0 39.0 34.0 39.0 10-11 37.1315 39.0 38.0 39.0 34.0 39.0 12-13 37.063625 39.0 38.0 39.0 33.5 39.0 14-15 38.45025 41.0 39.0 41.0 34.0 41.0 16-17 38.34375 41.0 38.5 41.0 33.0 41.0 18-19 38.329750000000004 41.0 38.5 41.0 34.0 41.0 20-21 38.262125 41.0 38.5 41.0 34.0 41.0 22-23 38.125375000000005 40.0 38.0 41.0 33.0 41.0 24-25 37.987875 40.0 38.0 41.0 33.0 41.0 26-27 38.0055 40.0 38.0 41.0 33.0 41.0 28-29 37.87325 40.0 38.0 41.0 32.5 41.0 30-31 37.719875 40.0 38.0 41.0 32.5 41.0 32-33 37.64 40.0 38.0 41.0 32.0 41.0 34-35 37.507625000000004 40.0 38.0 41.0 31.5 41.0 36-37 37.372 40.0 38.0 41.0 31.5 41.0 38-39 37.2555 40.0 38.0 41.0 31.0 41.0 40-41 37.236999999999995 40.0 38.0 41.0 31.0 41.0 42-43 36.936875 40.0 37.0 41.0 30.5 41.0 44-45 36.953625 40.0 37.0 41.0 30.5 41.0 46-47 37.019125 40.0 37.0 41.0 30.5 41.0 48-49 36.991625 40.0 37.0 41.0 30.5 41.0 50-51 36.8775 40.0 37.0 41.0 30.0 41.0 52-53 36.62375 40.0 36.5 41.0 30.0 41.0 54-55 36.38675 40.0 36.0 41.0 29.5 41.0 56-57 36.21925 39.5 36.0 41.0 29.0 41.0 58-59 35.92675 39.0 35.5 41.0 28.5 41.0 60-61 35.629125 39.0 35.0 41.0 28.0 41.0 62-63 35.329125000000005 39.0 35.0 40.0 28.0 41.0 64-65 34.941125 38.0 34.5 40.0 26.0 41.0 66-67 34.626875 37.5 34.0 40.0 26.0 41.0 68-69 34.381625 37.0 34.0 39.5 26.5 41.0 70-71 33.87775 36.0 34.0 39.0 26.0 40.5 72-73 33.401875000000004 36.0 33.5 39.0 26.0 40.0 74-75 32.78175 35.5 33.0 37.5 23.0 39.5 76-77 31.7155 34.5 31.5 36.5 23.0 39.0 78-79 31.989874999999998 35.0 32.0 36.5 23.5 39.0 80-81 31.791625 35.0 33.0 36.0 23.0 37.5 82-83 31.512625 35.0 32.0 36.0 23.0 37.0 84-85 31.23575 35.0 32.0 35.0 22.0 37.0 86-87 30.497500000000002 34.0 31.0 35.0 17.5 36.0 88-89 30.342125000000003 34.0 31.0 35.0 17.0 36.0 90-91 30.169249999999998 34.0 31.0 35.0 11.5 35.5 92-93 29.781875 34.0 30.5 35.0 4.5 35.0 94-95 29.516750000000002 34.0 31.0 35.0 2.0 35.0 96-97 29.281125 34.0 30.5 35.0 2.0 35.0 98-99 29.002125 34.0 30.0 35.0 2.0 35.0 100-101 27.927374999999998 33.5 28.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 36.0 3 8.0 4 13.0 5 8.0 6 4.0 7 4.0 8 4.0 9 9.0 10 8.0 11 15.0 12 7.0 13 20.0 14 14.0 15 15.0 16 13.0 17 17.0 18 13.0 19 20.0 20 16.0 21 20.0 22 16.0 23 21.0 24 15.0 25 19.0 26 20.0 27 34.0 28 40.0 29 43.0 30 73.0 31 79.0 32 96.0 33 112.0 34 182.0 35 278.0 36 444.0 37 882.0 38 1227.0 39 155.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.04860392967942 9.643226473629783 9.307135470527404 47.0010341261634 2 21.55 14.774999999999999 35.575 28.1 3 20.75 18.099999999999998 24.175 36.975 4 22.475 28.525 20.974999999999998 28.025 5 22.76707530647986 31.273455091318485 25.41906429822367 20.540405303977984 6 18.025 34.35 25.8 21.825 7 13.25 24.525 42.75 19.475 8 17.424999999999997 25.1 34.5 22.975 9 16.7 24.525 34.925 23.849999999999998 10-11 19.967491872968242 33.545886471617905 25.456364091022753 21.030257564391096 12-13 20.59264816204051 26.006501625406354 28.094523630907727 25.30632658164541 14-15 19.32983245811453 28.044511127781945 28.369592398099524 24.256064016004 16-17 20.980245061265315 28.732183045761438 27.369342335583895 22.918229557389346 18-19 19.879969992498125 28.482120530132534 27.33183295823956 24.306076519129782 20-21 19.379844961240313 28.882220555138783 27.66941735433858 24.06851712928232 22-23 20.142535633908476 28.482120530132534 27.91947986996749 23.455863965991497 24-25 20.4801200300075 27.93198299574894 26.91922980745186 24.668667166791696 26-27 19.554888722180543 28.08202050512628 28.557139284821204 23.80595148787197 28-29 20.180045011252815 28.782195548887223 27.70692673168292 23.330832708177045 30-31 20.355088772193046 27.7569392348087 27.19429857464366 24.69367341835459 32-33 19.954988747186796 27.35683920980245 29.094773693423353 23.593398349587396 34-35 21.06776694173543 28.032008002000502 27.294323580895224 23.605901475368842 36-37 20.042510627656913 27.44436109027257 28.86971742935734 23.643410852713178 38-39 19.767441860465116 28.857214303575894 27.556889222305575 23.818454613653415 40-41 20.10502625656414 28.66966741685421 27.694423605901473 23.53088272068017 42-43 20.392598149537385 28.632158039509875 26.994248562140534 23.980995248812203 44-45 19.46736684171043 28.644661165291325 28.032008002000502 23.85596399099775 46-47 19.967491872968242 28.382095523880967 28.107026756689173 23.543385846461614 48-49 20.605151287821954 27.85696424106027 27.956989247311824 23.58089522380595 50-51 19.654913728432106 28.469617404351087 27.70692673168292 24.168542135533883 52-53 20.879258517034067 28.45691382765531 27.354709418837675 23.309118236472944 54-55 20.442610652663166 28.182045511377847 27.094273568392097 24.281070267566893 56-57 20.865108138517314 28.328541067633456 27.87848481060132 22.927865983247905 58-59 19.91747936984246 28.81970492623156 27.53188297074269 23.730932733183295 60-61 20.342585646411603 28.28207051762941 27.93198299574894 23.443360840210055 62-63 20.5625 28.575 27.8875 22.975 64-65 20.25 28.6625 27.675 23.4125 66-67 20.125 27.8375 27.4125 24.625 68-69 20.575 27.737499999999997 28.1 23.5875 70-71 19.7125 29.049999999999997 27.6 23.6375 72-73 20.875 27.9375 27.4125 23.775 74-75 21.125 28.325 27.537499999999998 23.0125 76-77 20.962500000000002 28.762500000000003 26.825 23.45 78-79 20.517953209057925 28.56249218065808 26.38558738896534 24.533967221318655 80-81 20.94273568392098 28.769692423105774 27.51937984496124 22.768192048012004 82-83 21.1579342253345 27.822933600100036 26.997624109040892 24.02150806552457 84-85 21.2875 27.3125 27.224999999999998 24.175 86-87 21.275 29.3375 26.687499999999996 22.7 88-89 21.85 28.212500000000002 26.950000000000003 22.9875 90-91 20.5375 29.5 26.05 23.9125 92-93 20.8625 29.362500000000004 26.950000000000003 22.825 94-95 21.212500000000002 29.012500000000003 26.05 23.724999999999998 96-97 21.4 29.212500000000002 25.9875 23.400000000000002 98-99 21.75 29.1625 26.3 22.787499999999998 100-101 23.0875 28.7375 25.224999999999998 22.95 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 0.5 24 2.0 25 3.5 26 4.0 27 6.0 28 9.0 29 11.5 30 16.0 31 22.0 32 32.0 33 40.0 34 47.5 35 65.5 36 96.0 37 113.0 38 119.0 39 156.0 40 197.0 41 233.0 42 254.5 43 252.5 44 265.0 45 270.5 46 255.0 47 239.0 48 215.0 49 196.5 50 171.0 51 139.0 52 108.0 53 86.0 54 75.0 55 59.5 56 51.0 57 36.0 58 25.0 59 22.0 60 15.5 61 13.0 62 13.5 63 13.0 64 9.5 65 5.5 66 4.5 67 4.5 68 4.5 69 3.5 70 3.5 71 4.0 72 3.5 73 2.5 74 1.5 75 0.5 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.3000000000000003 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.025 38-39 0.025 40-41 0.025 42-43 0.025 44-45 0.025 46-47 0.025 48-49 0.025 50-51 0.025 52-53 0.2 54-55 0.025 56-57 0.0125 58-59 0.025 60-61 0.025 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.08750000000000001 80-81 0.025 82-83 0.0375 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.0875 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.16249999999999998 0.0 0.0 0.0 0.0 56-57 0.21250000000000002 0.0 0.0 0.0 0.0 58-59 0.2875 0.0 0.0 0.0 0.0 60-61 0.35 0.0 0.0 0.0 0.0 62-63 0.475 0.0 0.0 0.0 0.0 64-65 0.5625 0.0 0.0 0.0 0.0 66-67 0.6499999999999999 0.0 0.0 0.0 0.0 68-69 0.9125 0.0 0.0 0.0 0.0 70-71 1.1 0.0 0.0 0.0 0.0 72-73 1.4 0.0 0.0 0.0 0.0 74-75 1.7000000000000002 0.0 0.0 0.0 0.0 76-77 2.15 0.0 0.0 0.0 0.0 78-79 2.6625 0.0 0.0 0.0 0.0 80-81 3.1375 0.0 0.0 0.0 0.0 82-83 3.5875000000000004 0.0 0.0 0.0 0.0 84-85 4.325 0.0 0.0 0.0 0.0 86-87 5.137499999999999 0.0 0.0 0.0 0.0 88-89 5.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864455 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864455_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.029 34.0 31.0 34.0 30.0 34.0 2 32.1245 34.0 31.0 34.0 30.0 34.0 3 32.16725 34.0 31.0 34.0 30.0 34.0 4 35.43325 37.0 35.0 37.0 33.0 37.0 5 35.48 37.0 35.0 37.0 33.0 37.0 6 35.54825 37.0 36.0 37.0 35.0 37.0 7 35.5085 37.0 36.0 37.0 33.0 37.0 8 35.5345 37.0 36.0 37.0 33.0 37.0 9 37.1235 39.0 38.0 39.0 34.0 39.0 10-11 37.107124999999996 39.0 38.0 39.0 34.0 39.0 12-13 37.054625 39.0 38.0 39.0 33.5 39.0 14-15 38.372375000000005 41.0 38.0 41.0 33.5 41.0 16-17 38.35125 41.0 38.0 41.0 34.0 41.0 18-19 38.378375 41.0 38.5 41.0 33.5 41.0 20-21 38.253125 41.0 38.0 41.0 33.5 41.0 22-23 37.918125 40.0 38.0 41.0 32.0 41.0 24-25 37.990375 40.0 38.0 41.0 33.0 41.0 26-27 37.947 40.0 38.0 41.0 33.0 41.0 28-29 37.699 40.0 38.0 41.0 32.0 41.0 30-31 37.748000000000005 40.0 38.0 41.0 32.0 41.0 32-33 37.500875 40.0 38.0 41.0 31.5 41.0 34-35 37.416 40.0 38.0 41.0 31.0 41.0 36-37 37.190124999999995 40.0 38.0 41.0 30.5 41.0 38-39 37.108374999999995 40.0 37.5 41.0 30.5 41.0 40-41 37.023250000000004 40.0 37.0 41.0 30.0 41.0 42-43 36.894999999999996 40.0 37.0 41.0 30.0 41.0 44-45 36.781625000000005 40.0 37.0 41.0 30.0 41.0 46-47 36.4075 40.0 36.5 41.0 29.5 41.0 48-49 36.219625 39.5 36.0 41.0 28.5 41.0 50-51 36.053 39.0 36.0 40.5 29.0 41.0 52-53 36.230500000000006 39.0 36.5 40.5 29.5 41.0 54-55 36.53 40.0 36.5 41.0 29.5 41.0 56-57 36.225 40.0 36.0 41.0 28.5 41.0 58-59 36.033625 39.0 35.5 41.0 28.5 41.0 60-61 35.765 39.0 35.0 41.0 28.0 41.0 62-63 35.498125 39.0 35.0 41.0 28.0 41.0 64-65 35.139125 38.0 35.0 40.0 27.5 41.0 66-67 34.747625 37.5 34.5 40.0 26.0 41.0 68-69 34.255375 37.0 34.0 39.5 26.0 41.0 70-71 33.771 36.0 34.0 39.0 25.5 41.0 72-73 33.265249999999995 36.0 34.0 39.0 25.0 40.0 74-75 32.768 35.0 33.0 37.5 23.5 39.5 76-77 32.105000000000004 35.0 32.0 37.0 22.0 39.0 78-79 31.8505 35.0 32.0 36.5 21.5 39.0 80-81 31.526625 35.0 32.0 36.0 21.0 37.0 82-83 31.098625 35.0 32.0 35.5 19.5 37.0 84-85 30.729375 35.0 31.0 35.0 17.5 36.5 86-87 30.158375 34.5 30.5 35.0 11.5 36.0 88-89 29.886625000000002 34.0 30.0 35.0 9.0 36.0 90-91 29.7325 34.0 30.0 35.0 4.5 35.5 92-93 29.4075 34.0 30.5 35.0 2.0 35.0 94-95 29.087625 34.0 30.0 35.0 2.0 35.0 96-97 28.149 34.0 28.0 35.0 2.0 35.0 98-99 27.732750000000003 34.0 29.0 35.0 2.0 35.0 100-101 26.604750000000003 33.0 25.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 22.0 3 6.0 4 6.0 5 9.0 6 4.0 7 3.0 8 13.0 9 11.0 10 16.0 11 10.0 12 4.0 13 12.0 14 15.0 15 14.0 16 17.0 17 15.0 18 16.0 19 16.0 20 21.0 21 16.0 22 21.0 23 26.0 24 33.0 25 33.0 26 40.0 27 42.0 28 49.0 29 70.0 30 66.0 31 86.0 32 119.0 33 125.0 34 168.0 35 256.0 36 456.0 37 901.0 38 1096.0 39 167.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.099074305729296 16.56242181636227 14.585939454590942 36.752564423317494 2 25.66925193895422 23.71778834125594 35.30147610708031 15.31148361270953 3 21.441080810607957 27.445584188141105 28.646484863647736 22.466850137603203 4 23.5985985985986 33.708708708708706 23.04804804804805 19.644644644644647 5 25.619214410808105 34.375781836377286 23.692769577182887 16.312234175631723 6 20.9 37.824999999999996 23.9 17.375 7 19.925 19.8 41.099999999999994 19.175 8 23.036518259129565 24.437218609304654 29.33966983491746 23.186593296648326 9 22.75 24.474999999999998 31.125000000000004 21.65 10-11 23.80595148787197 31.10777694423606 24.493623405851466 20.59264816204051 12-13 24.990614441246404 24.26479789763484 27.118007758728567 23.626579902390187 14-15 22.561662701890572 27.72004507324402 29.235006886190057 20.483285338675348 16-17 23.4204929313149 27.82434630301514 27.561616414362568 21.193544351307395 18-19 24.12456228114057 27.576288144072038 28.189094547273637 20.110055027513756 20-21 23.858947105164436 28.435663373765163 26.73502563461298 20.97036388645742 22-23 24.025 27.925 27.175 20.875 24-25 22.7375 28.537499999999998 27.975 20.75 26-27 23.5625 28.000000000000004 27.625 20.8125 28-29 23.418354588647162 27.781945486371594 27.894473618404604 20.905226306576644 30-31 22.925 27.287499999999998 28.3125 21.475 32-33 23.4375 27.325 28.625 20.6125 34-35 24.0375 28.675 27.0125 20.275000000000002 36-37 23.9125 29.037499999999998 27.3875 19.662499999999998 38-39 23.474999999999998 28.4 27.625 20.5 40-41 23.133675128173063 27.747905464549206 28.09803676378642 21.02038264349131 42-43 22.925 28.525 27.9125 20.6375 44-45 23.4875 28.462500000000002 27.725 20.325 46-47 24.575 27.462500000000002 27.6 20.3625 48-49 23.9125 28.287499999999998 27.6375 20.1625 50-51 24.0125 28.6625 27.2625 20.0625 52-53 24.425 28.1875 26.700000000000003 20.6875 54-55 23.59634863073653 28.373139927472803 27.022633487557833 21.007877954232836 56-57 24.49337002752064 27.695771828871653 28.32124093069802 19.489617212909682 58-59 23.646367387770415 28.635738401900714 27.547830436413655 20.170063773915217 60-61 23.4625 28.549999999999997 27.462500000000002 20.525 62-63 22.8 28.487499999999997 28.175 20.5375 64-65 23.6625 27.150000000000002 28.125 21.0625 66-67 23.775 27.2625 28.3875 20.575 68-69 23.4625 28.525 27.700000000000003 20.3125 70-71 24.2875 27.800000000000004 27.8875 20.025000000000002 72-73 24.087500000000002 27.325 27.900000000000002 20.6875 74-75 24.0 27.187499999999996 28.212500000000002 20.599999999999998 76-77 23.7625 28.475 27.175 20.5875 78-79 23.5375 27.187499999999996 28.249999999999996 21.025 80-81 23.6029503687961 28.041005125640705 27.628453556694588 20.727590948868606 82-83 24.4375 28.499999999999996 26.474999999999998 20.5875 84-85 24.9375 28.599999999999998 27.1 19.3625 86-87 25.0125 28.449999999999996 26.700000000000003 19.8375 88-89 25.6125 28.262500000000003 26.375 19.75 90-91 24.55 28.199999999999996 26.900000000000002 20.349999999999998 92-93 25.2125 28.000000000000004 27.6 19.1875 94-95 26.474999999999998 28.0625 25.4 20.0625 96-97 25.412499999999998 28.3125 26.275 20.0 98-99 26.0375 27.975 26.325 19.662499999999998 100-101 27.0 27.462500000000002 25.4875 20.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 1.0 24 0.5 25 2.5 26 4.5 27 5.5 28 7.0 29 9.5 30 15.0 31 19.5 32 26.0 33 33.5 34 43.0 35 67.0 36 85.5 37 108.5 38 138.5 39 167.0 40 192.0 41 210.5 42 249.5 43 286.5 44 279.5 45 267.0 46 265.5 47 225.5 48 202.5 49 192.5 50 159.0 51 142.5 52 123.5 53 94.0 54 72.0 55 59.0 56 49.0 57 35.5 58 23.5 59 21.0 60 21.5 61 18.0 62 11.0 63 8.0 64 7.5 65 5.5 66 4.0 67 4.0 68 5.0 69 4.0 70 5.0 71 4.0 72 2.5 73 2.0 74 0.5 75 1.0 76 0.5 77 0.5 78 1.5 79 1.0 80 0.0 81 0.5 82 0.5 83 1.0 84 1.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.075 3 0.075 4 0.1 5 0.075 6 0.0 7 0.0 8 0.05 9 0.0 10-11 0.025 12-13 0.11249999999999999 14-15 0.1625 16-17 0.08750000000000001 18-19 0.05 20-21 0.0375 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.025 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0375 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0375 56-57 0.075 58-59 0.0375 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0125 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.0875 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.16249999999999998 0.0 0.0 0.0 0.0 56-57 0.21250000000000002 0.0 0.0 0.0 0.0 58-59 0.2875 0.0 0.0 0.0 0.0 60-61 0.35 0.0 0.0 0.0 0.0 62-63 0.475 0.0 0.0 0.0 0.0 64-65 0.5625 0.0 0.0 0.0 0.0 66-67 0.625 0.0 0.0 0.0 0.0 68-69 0.8875 0.0 0.0 0.0 0.0 70-71 1.075 0.0 0.0 0.0 0.0 72-73 1.375 0.0 0.0 0.0 0.0 74-75 1.6625 0.0 0.0 0.0 0.0 76-77 2.1 0.0 0.0 0.0 0.0 78-79 2.6500000000000004 0.0 0.0 0.0 0.0 80-81 3.1375 0.0 0.0 0.0 0.0 82-83 3.6 0.0 0.0 0.0 0.0 84-85 4.3125 0.0 0.0 0.0 0.0 86-87 5.1875 0.0 0.0 0.0 0.0 88-89 5.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 640792 spots for ERR1864455.sra Written 640792 spots for ERR1864455.sra Read 640792 spots for ERR1864455.sra Written 640792 spots for ERR1864455.sra Read 640792 spots for ERR1864455.sra Written 640792 spots for ERR1864455.sra Read 640792 spots for ERR1864455.sra Written 640792 spots for ERR1864455.sra Read 640792 spots for ERR1864455.sra Written 640792 spots for ERR1864455.sra Read 640792 spots for ERR1864455.sra Written 640792 spots for ERR1864455.sra Read 640792 spots for ERR1864455.sra Written 640792 spots for ERR1864455.sra Read 640792 spots for ERR1864455.sra Written 640792 spots for ERR1864455.sra Read 640792 spots for ERR1864455.sra Written 640792 spots for ERR1864455.sra Read 640792 spots for ERR1864455.sra Written 640792 spots for ERR1864455.sra Read 640795 spots for ERR1864455.sra Written 640795 spots for ERR1864455.sra Read 640792 spots for ERR1864455.sra Written 640792 spots for ERR1864455.sra Read 640792 spots for ERR1864455.sra Written 640792 spots for ERR1864455.sra Read 640792 spots for ERR1864455.sra Written 640792 spots for ERR1864455.sra Read 640792 spots for ERR1864455.sra Written 640792 spots for ERR1864455.sra Read 640792 spots for ERR1864455.sra Written 640792 spots for ERR1864455.sra Read 640792 spots for ERR1864455.sra Written 640792 spots for ERR1864455.sra Read 640792 spots for ERR1864455.sra Written 640792 spots for ERR1864455.sra Read 640792 spots for ERR1864455.sra Written 640792 spots for ERR1864455.sra Read 640792 spots for ERR1864455.sra Written 640792 spots for ERR1864455.sra SRR ids: ['ERR1864455.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3yc_qnff ERR1864455.sra spots: 12815843 blocks: [[1, 640792], [640793, 1281584], [1281585, 1922376], [1922377, 2563168], [2563169, 3203960], [3203961, 3844752], [3844753, 4485544], [4485545, 5126336], [5126337, 5767128], [5767129, 6407920], [6407921, 7048712], [7048713, 7689504], [7689505, 8330296], [8330297, 8971088], [8971089, 9611880], [9611881, 10252672], [10252673, 10893464], [10893465, 11534256], [11534257, 12175048], [12175049, 12815843]] ERR1864455 file size 3069621 ERR1864455 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864455 ERR1864455_1.fastq ERR1864455_2.fastq Input file: ERR1864455_1.fastq Paired file: ERR1864455_2.fastq trimmed: ERR1864455-trimmed-pair1.fastq, ERR1864455-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 11:41:09 2025 >> started Thu Feb 13 11:41:28 2025 >> done (18.288s) 12815843 read pairs processed; of these: 131350 ( 1.02%) short read pairs filtered out after trimming by size control 125232 ( 0.98%) empty read pairs filtered out after trimming by size control 12559261 (98.00%) read pairs available; of these: 3750541 (29.86%) trimmed read pairs available after processing 8808720 (70.14%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 74 0.00% 19 148 0.00% 20 221 0.00% 21 284 0.00% 22 318 0.00% 23 423 0.00% 24 556 0.00% 25 623 0.00% 26 732 0.01% 27 904 0.01% 28 1016 0.01% 29 1164 0.01% 30 1358 0.01% 31 1530 0.01% 32 1667 0.01% 33 1970 0.02% 34 2115 0.02% 35 2396 0.02% 36 2559 0.02% 37 2824 0.02% 38 3022 0.02% 39 3277 0.03% 40 3535 0.03% 41 3832 0.03% 42 4250 0.03% 43 4500 0.04% 44 4790 0.04% 45 5143 0.04% 46 5366 0.04% 47 5671 0.05% 48 6229 0.05% 49 6835 0.05% 50 7186 0.06% 51 7591 0.06% 52 8247 0.07% 53 9072 0.07% 54 9618 0.08% 55 10278 0.08% 56 11168 0.09% 57 12063 0.10% 58 13116 0.10% 59 16346 0.13% 60 19525 0.16% 61 20666 0.16% 62 21935 0.17% 63 23223 0.18% 64 24458 0.19% 65 25701 0.20% 66 26986 0.21% 67 29147 0.23% 68 30964 0.25% 69 32841 0.26% 70 34313 0.27% 71 37012 0.29% 72 39536 0.31% 73 42200 0.34% 74 45020 0.36% 75 46576 0.37% 76 48969 0.39% 77 52298 0.42% 78 55765 0.44% 79 59389 0.47% 80 63660 0.51% 81 66521 0.53% 82 70928 0.56% 83 75085 0.60% 84 80065 0.64% 85 84261 0.67% 86 88385 0.70% 87 93020 0.74% 88 96009 0.76% 89 100514 0.80% 90 106247 0.85% 91 112474 0.90% 92 119135 0.95% 93 127017 1.01% 94 137194 1.09% 95 149466 1.19% 96 166510 1.33% 97 192405 1.53% 98 230930 1.84% 99 281209 2.24% 100 408965 3.26% 101 8808720 70.14% 12559261 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.89 fanout-score-rank=23 prefix-density=0.19 prefix-fanout=2.9 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.09 sequence-density-rank=19 fanout-score=211.54 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=25.0 sequence=CTTCTTCTTTTT criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=5.01 fanout-score-rank=13 prefix-density=0.31 prefix-fanout=3.0 sequence=ATGATGGTGTCG criterion=fanout-score sequence-density=0.08 sequence-density-rank=19 fanout-score=71.92 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=14.5 sequence=GAAGAAGAGAAG ERR1864455 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 11:41:58 Started mapping on | Feb 13 11:41:59 Finished on | Feb 13 11:42:47 Mapping speed, Million of reads per hour | 941.94 Number of input reads | 12559261 Average input read length | 193 UNIQUE READS: Uniquely mapped reads number | 11678444 Uniquely mapped reads % | 92.99% Average mapped length | 193.54 Number of splices: Total | 6504424 Number of splices: Annotated (sjdb) | 6358855 Number of splices: GT/AG | 6406811 Number of splices: GC/AG | 81339 Number of splices: AT/AC | 5458 Number of splices: Non-canonical | 10816 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 2.19 Insertion rate per base | 0.01% Insertion average length | 1.94 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 348345 % of reads mapped to multiple loci | 2.77% Number of reads mapped to too many loci | 312526 % of reads mapped to too many loci | 2.49% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.55% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 547843 547843 547843 N_multimapping 348345 348345 348345 N_noFeature 377128 11549831 454125 N_ambiguous 121262 642 69202 UnstrandedReadsAssigned:11180054 PositiveStrandReadsAssigned:127971 NegativeStrandReadsAssigned:11155117 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=98 echo kmer=93 ERR1864455 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864455-trimmed-pair1.fastq ERR1864455-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,559,261 reads, 11,527,558 reads pseudoaligned [quant] estimated average fragment length: 146.247 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,021 rounds 52401 ERR1864455.ke.tsv 34699 ERR1864455.se.tsv 87100 total ==> ERR1864455.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1872.75 1101 59.8505 Potri.005G024800.1.v4.1 1035 889.753 527 60.2979 Potri.004G059700.1.v4.1 961 815.759 17 2.12152 Potri.007G009000.2.v4.1 1416 1270.75 0 0 Potri.003G141000.2.v4.1 2943 2797.75 465.188 16.927 Potri.016G087400.1.v4.1 270 131.92 568 438.326 Potri.015G069301.1.v4.1 564 418.833 0 0 Potri.010G195200.1.v4.1 1773 1627.75 180 11.2576 Potri.012G127500.1.v4.1 977 831.753 6912 846 ==> ERR1864455.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 337 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 164 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 130 ERR1864455 completed mapping pipeline successfully