Starting /dee2/code/volunteer_pipeline.sh ERR1864456 current disk space = 3093044920320 free memory = 1445462728 ERR1864456 SRAfilesize 70a81241d3a69c9aceec662343be71aa ERR1864456.sra ERR1864456.sra file validated ERR1864456 is paired end ERR1864456 is conventional basespace ERR1864456 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864456_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.431 34.0 31.0 34.0 30.0 34.0 2 31.9335 34.0 31.0 34.0 30.0 34.0 3 32.49425 34.0 31.0 34.0 30.0 34.0 4 35.9585 37.0 37.0 37.0 35.0 37.0 5 35.8145 37.0 37.0 37.0 35.0 37.0 6 35.8025 37.0 37.0 37.0 35.0 37.0 7 35.83525 37.0 37.0 37.0 35.0 37.0 8 35.847 37.0 37.0 37.0 35.0 37.0 9 37.62375 39.0 38.0 39.0 35.0 39.0 10-11 37.5475 39.0 38.5 39.0 35.0 39.0 12-13 37.417125 39.0 38.0 39.0 35.0 39.0 14-15 38.993375 41.0 39.0 41.0 36.0 41.0 16-17 38.884875 41.0 39.0 41.0 36.0 41.0 18-19 38.8705 41.0 39.0 41.0 35.5 41.0 20-21 38.786375 41.0 39.0 41.0 35.0 41.0 22-23 38.734 41.0 39.0 41.0 35.0 41.0 24-25 38.709374999999994 41.0 39.0 41.0 35.0 41.0 26-27 38.613125 41.0 39.0 41.0 34.0 41.0 28-29 38.547875000000005 40.5 39.0 41.0 34.5 41.0 30-31 38.461625 40.0 38.0 41.0 34.0 41.0 32-33 38.338499999999996 40.0 38.0 41.0 34.0 41.0 34-35 38.067499999999995 40.0 38.0 41.0 33.5 41.0 36-37 38.128125 40.0 38.0 41.0 34.0 41.0 38-39 38.134125 40.0 38.0 41.0 34.0 41.0 40-41 37.944500000000005 40.0 38.0 41.0 33.0 41.0 42-43 37.71525 40.0 38.0 41.0 33.0 41.0 44-45 37.6315 40.0 38.0 41.0 32.5 41.0 46-47 37.87775 40.0 38.0 41.0 33.0 41.0 48-49 37.852999999999994 40.0 38.0 41.0 33.0 41.0 50-51 37.6285 40.0 37.5 41.0 33.0 41.0 52-53 37.430375 40.0 37.0 41.0 32.5 41.0 54-55 37.204 40.0 37.0 41.0 31.5 41.0 56-57 37.031 40.0 36.5 41.0 31.0 41.0 58-59 36.808 39.0 36.0 41.0 31.0 41.0 60-61 36.6085 39.0 35.5 41.0 31.0 41.0 62-63 36.373125 39.0 35.0 40.5 31.0 41.0 64-65 35.910624999999996 38.0 35.0 40.0 30.0 41.0 66-67 35.56875 37.5 35.0 40.0 30.0 41.0 68-69 35.2535 37.0 34.5 39.5 29.0 41.0 70-71 34.783625 36.5 34.0 39.0 29.0 40.5 72-73 34.30475 36.0 34.0 39.0 28.5 40.0 74-75 33.831500000000005 35.5 34.0 37.5 28.0 39.5 76-77 32.653999999999996 34.5 32.0 36.5 26.0 39.0 78-79 32.852374999999995 35.0 33.0 36.5 26.0 39.0 80-81 32.617625000000004 35.0 33.0 36.0 26.0 37.0 82-83 32.37225 35.0 33.0 36.0 26.5 37.0 84-85 32.03075 35.0 32.5 35.0 26.0 37.0 86-87 31.871875 35.0 32.0 35.0 26.0 36.0 88-89 31.661875000000002 34.5 32.0 35.0 26.0 36.0 90-91 31.323124999999997 34.0 32.0 35.0 25.0 35.5 92-93 30.988374999999998 34.0 32.0 35.0 24.0 35.0 94-95 30.765125 34.0 31.5 35.0 23.0 35.0 96-97 30.54725 34.0 31.0 35.0 20.5 35.0 98-99 30.31975 34.0 31.0 35.0 18.5 35.0 100-101 29.399124999999998 33.5 30.0 35.0 8.5 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 25.0 3 8.0 4 3.0 5 4.0 6 3.0 7 2.0 8 4.0 9 8.0 10 6.0 11 5.0 12 2.0 13 12.0 14 6.0 15 12.0 16 8.0 17 10.0 18 7.0 19 8.0 20 7.0 21 5.0 22 9.0 23 14.0 24 10.0 25 15.0 26 30.0 27 32.0 28 42.0 29 41.0 30 58.0 31 78.0 32 91.0 33 128.0 34 163.0 35 258.0 36 446.0 37 994.0 38 1292.0 39 154.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.17900753442453 5.871654975318265 8.495713172252534 46.45362431800468 2 24.05 9.075 33.0 33.875 3 24.24924924924925 12.312312312312311 21.696696696696698 41.74174174174174 4 28.1 18.95 20.375 32.574999999999996 5 25.425425425425423 25.075075075075077 25.600600600600597 23.8988988988989 6 21.95 30.45 26.224999999999998 21.375 7 16.025 24.125 41.975 17.875 8 18.15 24.025 34.849999999999994 22.975 9 17.150000000000002 23.775 36.65 22.425 10-11 18.9625 33.525 27.250000000000004 20.2625 12-13 20.1125 26.2875 30.925000000000004 22.675 14-15 20.150000000000002 27.6 29.3375 22.912499999999998 16-17 21.2 28.3875 28.625 21.7875 18-19 20.825 27.6625 27.875 23.6375 20-21 20.375 27.9375 28.525 23.1625 22-23 20.375 27.750000000000004 29.012500000000003 22.8625 24-25 21.1375 28.3875 27.187499999999996 23.2875 26-27 20.1 27.5875 29.075 23.2375 28-29 20.1 28.375 27.700000000000003 23.825 30-31 20.4875 27.5625 27.8375 24.1125 32-33 21.337500000000002 27.05 28.512500000000003 23.1 34-35 20.4875 27.287499999999998 28.575 23.65 36-37 20.150000000000002 27.3875 28.199999999999996 24.2625 38-39 19.9625 27.675 29.1125 23.25 40-41 21.025 27.1625 27.9375 23.875 42-43 21.087500000000002 26.974999999999998 27.85 24.087500000000002 44-45 20.7625 27.8875 27.675 23.674999999999997 46-47 20.2625 28.5625 27.987499999999997 23.1875 48-49 20.424999999999997 27.525 27.650000000000002 24.4 50-51 21.0625 26.937499999999996 28.812500000000004 23.1875 52-53 20.705176294073517 27.406851712928233 27.74443610902726 24.143535883970994 54-55 20.4625 28.3125 27.625 23.599999999999998 56-57 21.0375 27.3 28.775000000000002 22.8875 58-59 20.150000000000002 27.900000000000002 28.6375 23.3125 60-61 19.9625 28.262500000000003 28.4375 23.3375 62-63 21.212500000000002 27.5625 28.237499999999997 22.9875 64-65 20.78019504876219 29.15728932233058 27.969492373093274 22.093023255813954 66-67 21.342835708927232 27.094273568392097 27.994498624656167 23.568392098024507 68-69 21.710855427713856 27.226113056528263 27.926463231615806 23.13656828414207 70-71 20.730182545636406 27.631907976994246 29.132283070767688 22.50562640660165 72-73 21.587500000000002 28.037499999999998 27.250000000000004 23.125 74-75 20.43010752688172 27.46936734183546 28.35708927231808 23.74343585896474 76-77 20.955238809702426 27.38184546136534 28.094523630907727 23.568392098024507 78-79 21.2375 28.299999999999997 27.462500000000002 23.0 80-81 21.637500000000003 27.650000000000002 27.6375 23.075000000000003 82-83 21.462500000000002 27.675 27.650000000000002 23.2125 84-85 21.25 27.987499999999997 27.675 23.0875 86-87 21.0 27.3 28.199999999999996 23.5 88-89 21.212500000000002 28.487499999999997 27.0875 23.2125 90-91 20.875 28.1 27.187499999999996 23.8375 92-93 21.31782945736434 27.769442360590148 26.944236059014752 23.968492123030757 94-95 21.202650331291412 28.391048881110137 27.415926990873857 22.99037379672459 96-97 22.5 27.200000000000003 27.55 22.75 98-99 22.3375 27.900000000000002 26.9125 22.85 100-101 21.9 28.725 26.937499999999996 22.4375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 0.5 24 1.0 25 2.0 26 2.5 27 3.5 28 5.5 29 5.5 30 10.0 31 16.0 32 22.5 33 35.5 34 52.0 35 72.5 36 84.0 37 93.5 38 112.5 39 144.5 40 184.0 41 217.0 42 240.0 43 264.5 44 268.0 45 255.5 46 249.0 47 250.0 48 249.0 49 215.0 50 177.5 51 160.0 52 130.0 53 103.5 54 77.0 55 54.5 56 50.5 57 38.5 58 27.0 59 24.0 60 24.0 61 16.5 62 10.0 63 10.5 64 12.0 65 6.5 66 3.5 67 4.5 68 3.0 69 2.0 70 1.5 71 1.5 72 1.5 73 0.5 74 1.0 75 1.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.775 2 0.0 3 0.1 4 0.0 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.025 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.025 66-67 0.025 68-69 0.05 70-71 0.025 72-73 0.0 74-75 0.025 76-77 0.025 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.025 94-95 0.0125 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52249308871576 99.0 2 0.42724302588590096 0.8500000000000001 3 0.050263885398341285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.1375 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.21250000000000002 0.0 0.0 0.0 0.0 74-75 0.30000000000000004 0.0 0.0 0.0 0.0 76-77 0.375 0.0 0.0 0.0 0.0 78-79 0.4875 0.0 0.0 0.0 0.0 80-81 0.6 0.0 0.0 0.0 0.0 82-83 0.6875 0.0 0.0 0.0 0.0 84-85 0.8375 0.0 0.0 0.0 0.0 86-87 1.0 0.0 0.0 0.0 0.0 88-89 1.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864456 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864456_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.37675 34.0 31.0 34.0 31.0 34.0 2 32.506 34.0 31.0 34.0 31.0 34.0 3 32.46575 34.0 31.0 34.0 31.0 34.0 4 35.8115 37.0 37.0 37.0 35.0 37.0 5 35.80675 37.0 37.0 37.0 35.0 37.0 6 35.8385 37.0 37.0 37.0 35.0 37.0 7 35.81225 37.0 37.0 37.0 35.0 37.0 8 35.8515 37.0 37.0 37.0 35.0 37.0 9 37.6175 39.0 39.0 39.0 35.0 39.0 10-11 37.43775 39.0 38.0 39.0 35.0 39.0 12-13 37.429249999999996 39.0 38.0 39.0 35.0 39.0 14-15 38.856125 41.0 39.0 41.0 35.5 41.0 16-17 38.850125000000006 41.0 39.0 41.0 35.5 41.0 18-19 38.711875 41.0 39.0 41.0 34.5 41.0 20-21 38.656375 41.0 39.0 41.0 34.5 41.0 22-23 38.703125 41.0 39.0 41.0 34.5 41.0 24-25 38.492125 40.5 38.5 41.0 34.0 41.0 26-27 38.449124999999995 40.0 38.0 41.0 34.0 41.0 28-29 38.23175 40.0 38.0 41.0 34.0 41.0 30-31 38.16575 40.0 38.0 41.0 33.5 41.0 32-33 38.030625 40.0 38.0 41.0 33.5 41.0 34-35 38.064125000000004 40.0 38.0 41.0 33.5 41.0 36-37 38.075 40.0 38.0 41.0 33.5 41.0 38-39 37.9245 40.0 38.0 41.0 33.0 41.0 40-41 37.8165 40.0 38.0 41.0 33.0 41.0 42-43 37.750875 40.0 38.0 41.0 33.0 41.0 44-45 37.313625 40.0 37.5 41.0 31.0 41.0 46-47 37.047125 40.0 37.0 41.0 31.0 41.0 48-49 37.047125 40.0 37.0 41.0 31.0 41.0 50-51 36.838875 39.5 36.5 40.5 30.5 41.0 52-53 37.039500000000004 39.5 37.0 40.5 31.5 41.0 54-55 37.083749999999995 40.0 37.0 41.0 31.0 41.0 56-57 37.167 40.0 37.0 41.0 31.5 41.0 58-59 36.88125 39.5 36.5 41.0 31.0 41.0 60-61 36.43475 39.0 36.0 41.0 30.0 41.0 62-63 36.253874999999994 39.0 35.0 41.0 30.0 41.0 64-65 35.934 38.5 35.0 40.5 30.0 41.0 66-67 35.53075 37.5 35.0 40.0 29.0 41.0 68-69 35.133750000000006 37.0 35.0 39.5 29.0 41.0 70-71 34.75275 36.5 34.0 39.0 29.0 41.0 72-73 34.298874999999995 36.0 34.0 39.0 28.0 40.5 74-75 33.838625 35.5 34.0 37.5 28.0 39.5 76-77 33.435249999999996 35.0 34.0 37.0 27.0 39.0 78-79 33.02975 35.0 33.5 36.5 26.0 39.0 80-81 32.596374999999995 35.0 33.0 36.0 26.0 37.0 82-83 31.9315 35.0 32.5 35.5 24.5 37.0 84-85 31.74075 35.0 32.0 35.0 25.0 36.5 86-87 31.5865 35.0 32.0 35.0 25.0 36.0 88-89 31.363625 35.0 32.0 35.0 24.0 36.0 90-91 31.188875 35.0 32.0 35.0 23.5 36.0 92-93 30.835375 34.5 32.0 35.0 20.0 35.0 94-95 30.607625 34.0 31.0 35.0 20.0 35.0 96-97 30.380875000000003 34.0 31.0 35.0 18.5 35.0 98-99 29.937125 34.0 31.0 35.0 7.0 35.0 100-101 28.853125 33.5 30.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 3.0 4 3.0 5 1.0 6 1.0 7 4.0 8 7.0 9 8.0 10 10.0 11 10.0 12 11.0 13 9.0 14 3.0 15 8.0 16 7.0 17 8.0 18 17.0 19 9.0 20 10.0 21 12.0 22 18.0 23 21.0 24 13.0 25 21.0 26 35.0 27 42.0 28 47.0 29 36.0 30 57.0 31 81.0 32 98.0 33 112.0 34 154.0 35 239.0 36 420.0 37 1005.0 38 1243.0 39 197.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.45 18.3 15.8 36.449999999999996 2 24.925 22.775000000000002 35.0 17.299999999999997 3 20.05 27.775 30.625000000000004 21.55 4 22.225 32.574999999999996 25.174999999999997 20.025000000000002 5 23.95 35.775 23.175 17.1 6 20.45 37.875 23.65 18.025 7 20.75 20.275000000000002 39.324999999999996 19.650000000000002 8 21.125 26.35 28.849999999999998 23.674999999999997 9 20.849999999999998 24.025 32.1 23.025000000000002 10-11 23.0875 31.974999999999998 24.325 20.6125 12-13 24.2875 25.775 26.5625 23.375 14-15 21.825 28.050000000000004 29.025000000000002 21.099999999999998 16-17 24.05 28.249999999999996 26.087500000000002 21.6125 18-19 22.4375 28.499999999999996 27.250000000000004 21.8125 20-21 23.0375 27.9375 27.1625 21.8625 22-23 22.425 28.5875 27.5625 21.425 24-25 22.412499999999998 28.487499999999997 28.212500000000002 20.8875 26-27 23.25 27.787499999999998 28.3375 20.625 28-29 23.075000000000003 27.800000000000004 28.0625 21.0625 30-31 22.875 27.5625 27.6125 21.95 32-33 23.025000000000002 28.4125 27.787499999999998 20.775 34-35 22.775000000000002 28.175 27.787499999999998 21.2625 36-37 22.875 27.750000000000004 28.0625 21.3125 38-39 22.900000000000002 28.1875 27.2625 21.65 40-41 23.3125 27.675 27.9375 21.075 42-43 22.8375 28.037499999999998 27.1125 22.0125 44-45 22.6125 28.6875 27.075 21.625 46-47 23.1625 28.125 26.987499999999997 21.725 48-49 22.6 28.537499999999998 27.2625 21.6 50-51 23.150000000000002 28.625 26.7125 21.512500000000003 52-53 23.2125 28.225 27.3375 21.224999999999998 54-55 22.95 28.275 27.900000000000002 20.875 56-57 23.825 28.1875 26.424999999999997 21.5625 58-59 22.55 27.950000000000003 27.55 21.95 60-61 23.325000000000003 27.55 27.800000000000004 21.325 62-63 22.6 28.962500000000002 26.737499999999997 21.7 64-65 23.849999999999998 28.4375 26.687499999999996 21.025 66-67 23.599999999999998 28.1 27.0 21.3 68-69 23.150000000000002 28.325 27.525 21.0 70-71 23.724999999999998 28.025 26.5625 21.6875 72-73 23.1875 28.525 26.9625 21.325 74-75 23.849999999999998 28.537499999999998 26.375 21.2375 76-77 23.474999999999998 29.6875 26.25 20.5875 78-79 24.099999999999998 27.425 27.725 20.75 80-81 23.4375 28.849999999999998 26.637499999999996 21.075 82-83 23.150000000000002 28.3375 27.200000000000003 21.3125 84-85 23.575 27.8625 28.000000000000004 20.5625 86-87 23.05 28.9125 27.437499999999996 20.599999999999998 88-89 23.75 27.950000000000003 27.400000000000002 20.9 90-91 23.7625 27.987499999999997 26.974999999999998 21.275 92-93 23.3 28.725 27.1625 20.8125 94-95 23.4875 28.549999999999997 27.5125 20.45 96-97 24.625 28.0625 25.924999999999997 21.3875 98-99 23.525 29.612500000000004 26.275 20.5875 100-101 24.55 28.225 25.95 21.275 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 0.5 23 1.5 24 1.5 25 1.5 26 2.5 27 3.0 28 7.5 29 12.0 30 10.0 31 12.0 32 20.0 33 36.0 34 50.5 35 68.5 36 93.0 37 100.5 38 124.0 39 164.0 40 200.0 41 220.0 42 251.5 43 279.0 44 270.0 45 263.5 46 260.5 47 253.5 48 244.5 49 203.5 50 154.5 51 137.5 52 117.0 53 93.5 54 76.0 55 62.5 56 43.5 57 26.0 58 21.0 59 19.0 60 15.5 61 15.0 62 16.0 63 13.0 64 9.0 65 6.5 66 6.0 67 4.0 68 1.5 69 0.5 70 1.0 71 1.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79954898521673 99.575 2 0.17539463793535454 0.35000000000000003 3 0.025056376847907794 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.1375 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.21250000000000002 0.0 0.0 0.0 0.0 74-75 0.2875 0.0 0.0 0.0 0.0 76-77 0.35 0.0 0.0 0.0 0.0 78-79 0.4375 0.0 0.0 0.0 0.0 80-81 0.55 0.0 0.0 0.0 0.0 82-83 0.6375 0.0 0.0 0.0 0.0 84-85 0.7875 0.0 0.0 0.0 0.0 86-87 0.95 0.0 0.0 0.0 0.0 88-89 1.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 755148 spots for ERR1864456.sra Written 755148 spots for ERR1864456.sra Read 755148 spots for ERR1864456.sra Written 755148 spots for ERR1864456.sra Read 755148 spots for ERR1864456.sra Written 755148 spots for ERR1864456.sra Read 755148 spots for ERR1864456.sra Written 755148 spots for ERR1864456.sra Read 755148 spots for ERR1864456.sra Written 755148 spots for ERR1864456.sra Read 755148 spots for ERR1864456.sra Written 755148 spots for ERR1864456.sra Read 755148 spots for ERR1864456.sra Written 755148 spots for ERR1864456.sra Read 755148 spots for ERR1864456.sra Written 755148 spots for ERR1864456.sra Read 755148 spots for ERR1864456.sra Written 755148 spots for ERR1864456.sra Read 755148 spots for ERR1864456.sra Written 755148 spots for ERR1864456.sra Read 755148 spots for ERR1864456.sra Written 755148 spots for ERR1864456.sra Read 755148 spots for ERR1864456.sra Written 755148 spots for ERR1864456.sra Read 755148 spots for ERR1864456.sra Written 755148 spots for ERR1864456.sra Read 755148 spots for ERR1864456.sra Written 755148 spots for ERR1864456.sra Read 755148 spots for ERR1864456.sra Written 755148 spots for ERR1864456.sra Read 755148 spots for ERR1864456.sra Written 755148 spots for ERR1864456.sra Read 755148 spots for ERR1864456.sra Written 755148 spots for ERR1864456.sra Read 755148 spots for ERR1864456.sra Written 755148 spots for ERR1864456.sra Read 755148 spots for ERR1864456.sra Written 755148 spots for ERR1864456.sra Read 755153 spots for ERR1864456.sra Written 755153 spots for ERR1864456.sra SRR ids: ['ERR1864456.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9ts3yhzx ERR1864456.sra spots: 15102965 blocks: [[1, 755148], [755149, 1510296], [1510297, 2265444], [2265445, 3020592], [3020593, 3775740], [3775741, 4530888], [4530889, 5286036], [5286037, 6041184], [6041185, 6796332], [6796333, 7551480], [7551481, 8306628], [8306629, 9061776], [9061777, 9816924], [9816925, 10572072], [10572073, 11327220], [11327221, 12082368], [12082369, 12837516], [12837517, 13592664], [13592665, 14347812], [14347813, 15102965]] ERR1864456 file size 3621299 ERR1864456 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864456 ERR1864456_1.fastq ERR1864456_2.fastq Input file: ERR1864456_1.fastq Paired file: ERR1864456_2.fastq trimmed: ERR1864456-trimmed-pair1.fastq, ERR1864456-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 11:53:36 2025 >> started Thu Feb 13 11:53:49 2025 >> done (13.383s) 15102965 read pairs processed; of these: 175354 ( 1.16%) short read pairs filtered out after trimming by size control 191486 ( 1.27%) empty read pairs filtered out after trimming by size control 14736125 (97.57%) read pairs available; of these: 3411687 (23.15%) trimmed read pairs available after processing 11324438 (76.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 77 0.00% 19 202 0.00% 20 323 0.00% 21 378 0.00% 22 480 0.00% 23 612 0.00% 24 749 0.01% 25 818 0.01% 26 1074 0.01% 27 1235 0.01% 28 1428 0.01% 29 1685 0.01% 30 1909 0.01% 31 2234 0.02% 32 2330 0.02% 33 2720 0.02% 34 2915 0.02% 35 3223 0.02% 36 3385 0.02% 37 3868 0.03% 38 4087 0.03% 39 4431 0.03% 40 4594 0.03% 41 5054 0.03% 42 5302 0.04% 43 5705 0.04% 44 5926 0.04% 45 6296 0.04% 46 6593 0.04% 47 6914 0.05% 48 7229 0.05% 49 7731 0.05% 50 8032 0.05% 51 8447 0.06% 52 8829 0.06% 53 9455 0.06% 54 9896 0.07% 55 10380 0.07% 56 11103 0.08% 57 11607 0.08% 58 12489 0.08% 59 16038 0.11% 60 19220 0.13% 61 19720 0.13% 62 20418 0.14% 63 20963 0.14% 64 21470 0.15% 65 22814 0.15% 66 23943 0.16% 67 24805 0.17% 68 26163 0.18% 69 27088 0.18% 70 28391 0.19% 71 29546 0.20% 72 31306 0.21% 73 32601 0.22% 74 33686 0.23% 75 34360 0.23% 76 35184 0.24% 77 36989 0.25% 78 39084 0.27% 79 41469 0.28% 80 43952 0.30% 81 46133 0.31% 82 48463 0.33% 83 51606 0.35% 84 54385 0.37% 85 57314 0.39% 86 61135 0.41% 87 64138 0.44% 88 66309 0.45% 89 70456 0.48% 90 77394 0.53% 91 85509 0.58% 92 94383 0.64% 93 104763 0.71% 94 118956 0.81% 95 136683 0.93% 96 161773 1.10% 97 199585 1.35% 98 258845 1.76% 99 345752 2.35% 100 487150 3.31% 101 11324438 76.85% 14736125 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=5.67 fanout-score-rank=17 prefix-density=0.25 prefix-fanout=3.4 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.08 sequence-density-rank=19 fanout-score=272.45 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=26.0 sequence=CTTCTTCTTTTT criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=5.08 fanout-score-rank=20 prefix-density=0.20 prefix-fanout=2.9 sequence=AAGACCATCACCCTTGAGGTGGAAAGCTCTGACAC criterion=fanout-score sequence-density=0.07 sequence-density-rank=13 fanout-score=328.64 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=28.7 sequence=AAGAAGAAGAAG ERR1864456 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 11:54:21 Started mapping on | Feb 13 11:54:21 Finished on | Feb 13 11:55:13 Mapping speed, Million of reads per hour | 1020.19 Number of input reads | 14736125 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 14017174 Uniquely mapped reads % | 95.12% Average mapped length | 195.82 Number of splices: Total | 8051403 Number of splices: Annotated (sjdb) | 7893879 Number of splices: GT/AG | 7923797 Number of splices: GC/AG | 106409 Number of splices: AT/AC | 8606 Number of splices: Non-canonical | 12591 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 2.44 Insertion rate per base | 0.01% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 363462 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 82010 % of reads mapped to too many loci | 0.56% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.81% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 373420 373420 373420 N_multimapping 363462 363462 363462 N_noFeature 445879 13866132 529539 N_ambiguous 124853 776 56947 UnstrandedReadsAssigned:13446442 PositiveStrandReadsAssigned:150266 NegativeStrandReadsAssigned:13430688 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864456 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864456-trimmed-pair1.fastq ERR1864456-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,736,125 reads, 13,617,089 reads pseudoaligned [quant] estimated average fragment length: 158.93 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,087 rounds 52401 ERR1864456.ke.tsv 34699 ERR1864456.se.tsv 87100 total ==> ERR1864456.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1860.07 1645 71.0298 Potri.005G024800.1.v4.1 1035 877.07 465 42.5816 Potri.004G059700.1.v4.1 961 803.07 18 1.80021 Potri.007G009000.2.v4.1 1416 1258.07 0 0 Potri.003G141000.2.v4.1 2943 2785.07 677.319 19.5326 Potri.016G087400.1.v4.1 270 118.458 708.583 480.429 Potri.015G069301.1.v4.1 564 406.137 0 0 Potri.010G195200.1.v4.1 1773 1615.07 289.876 14.4154 Potri.012G127500.1.v4.1 977 819.07 18342 1798.58 ==> ERR1864456.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 141 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 332 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 129 ERR1864456 completed mapping pipeline successfully