Starting /dee2/code/volunteer_pipeline.sh ERR1864457 current disk space = 3092490665984 free memory = 1420628524 ERR1864457 SRAfilesize 6e4d6c8acc2f53964f65801ee5ba6b45 ERR1864457.sra ERR1864457.sra file validated ERR1864457 is paired end ERR1864457 is conventional basespace ERR1864457 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864457_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.28125 34.0 31.0 34.0 30.0 34.0 2 31.76275 34.0 31.0 34.0 28.0 34.0 3 32.33825 34.0 31.0 34.0 30.0 34.0 4 35.84125 37.0 35.0 37.0 35.0 37.0 5 35.63575 37.0 35.0 37.0 35.0 37.0 6 35.544 37.0 35.0 37.0 33.0 37.0 7 35.59225 37.0 35.0 37.0 35.0 37.0 8 35.68275 37.0 36.0 37.0 35.0 37.0 9 37.37275 39.0 38.0 39.0 35.0 39.0 10-11 37.273125 39.0 38.0 39.0 35.0 39.0 12-13 37.084375 39.0 38.0 39.0 33.0 39.0 14-15 38.632875 41.0 39.0 41.0 34.0 41.0 16-17 38.54825 41.0 39.0 41.0 34.5 41.0 18-19 38.528499999999994 41.0 39.0 41.0 34.0 41.0 20-21 38.417125 41.0 39.0 41.0 34.0 41.0 22-23 38.414 41.0 39.0 41.0 34.0 41.0 24-25 38.372 41.0 39.0 41.0 34.0 41.0 26-27 38.268625 40.0 38.0 41.0 34.0 41.0 28-29 38.24475 40.0 38.0 41.0 34.0 41.0 30-31 38.12775 40.0 38.0 41.0 33.5 41.0 32-33 38.056625 40.0 38.0 41.0 33.5 41.0 34-35 37.794375 40.0 38.0 41.0 33.0 41.0 36-37 37.771874999999994 40.0 38.0 41.0 33.0 41.0 38-39 37.7725 40.0 38.0 41.0 33.0 41.0 40-41 37.565625 40.0 38.0 41.0 33.0 41.0 42-43 37.4315 40.0 38.0 41.0 32.0 41.0 44-45 37.267 40.0 37.5 41.0 31.5 41.0 46-47 37.434250000000006 40.0 38.0 41.0 32.0 41.0 48-49 37.4035 40.0 38.0 41.0 32.0 41.0 50-51 37.238749999999996 40.0 37.0 41.0 32.0 41.0 52-53 37.091375 40.0 37.0 41.0 31.5 41.0 54-55 36.889875 40.0 36.5 41.0 31.0 41.0 56-57 36.722375 40.0 36.0 41.0 31.0 41.0 58-59 36.588750000000005 39.0 36.0 41.0 31.0 41.0 60-61 36.272375 39.0 35.0 41.0 30.0 41.0 62-63 35.943749999999994 39.0 35.0 40.0 29.0 41.0 64-65 35.49625 38.0 35.0 40.0 29.0 41.0 66-67 35.259 37.5 35.0 40.0 29.0 41.0 68-69 34.8725 37.0 34.0 39.5 28.5 41.0 70-71 34.4505 36.5 34.0 39.0 28.5 40.5 72-73 34.017875000000004 36.0 34.0 38.5 28.0 40.0 74-75 33.423375 35.0 33.5 37.5 26.5 39.0 76-77 32.308375 34.5 31.5 36.0 26.0 39.0 78-79 32.600125000000006 35.0 33.0 36.5 26.0 38.5 80-81 32.313500000000005 35.0 33.0 36.0 26.0 37.0 82-83 31.9495 35.0 32.5 35.5 25.5 37.0 84-85 31.666375000000002 35.0 32.0 35.0 25.0 36.5 86-87 31.459875 35.0 32.0 35.0 25.0 36.0 88-89 31.15 34.5 32.0 35.0 23.5 36.0 90-91 30.919375 34.0 32.0 35.0 22.0 35.0 92-93 30.670875000000002 34.0 31.0 35.0 21.5 35.0 94-95 30.297625 34.0 31.0 35.0 19.0 35.0 96-97 30.07175 34.0 31.0 35.0 15.5 35.0 98-99 29.784375 34.0 31.0 35.0 2.0 35.0 100-101 29.12825 33.5 30.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 27.0 3 12.0 4 12.0 5 3.0 6 4.0 7 9.0 8 4.0 9 7.0 10 6.0 11 5.0 12 6.0 13 7.0 14 6.0 15 5.0 16 12.0 17 14.0 18 11.0 19 11.0 20 13.0 21 12.0 22 16.0 23 12.0 24 21.0 25 29.0 26 26.0 27 27.0 28 41.0 29 48.0 30 60.0 31 74.0 32 81.0 33 121.0 34 177.0 35 250.0 36 453.0 37 972.0 38 1248.0 39 158.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.29405657928886 6.696080975862964 7.578510251751881 46.43135219309629 2 24.85 8.649999999999999 33.775 32.725 3 24.937468734367183 11.680840420210105 21.285642821410704 42.096048024012006 4 29.725 19.025 19.400000000000002 31.85 5 27.081770442610654 24.831207801950487 25.30632658164541 22.780695173793447 6 22.025 29.925 26.5 21.55 7 16.45 22.875 41.9 18.775 8 17.849999999999998 23.625 35.75 22.775000000000002 9 18.224999999999998 21.825 38.025 21.925 10-11 20.3875 32.1 27.750000000000004 19.7625 12-13 21.3125 25.7625 30.175 22.75 14-15 20.8125 26.5625 29.125 23.5 16-17 21.099999999999998 27.500000000000004 28.3375 23.0625 18-19 20.849999999999998 27.250000000000004 28.262500000000003 23.6375 20-21 20.125 28.287499999999998 27.700000000000003 23.8875 22-23 21.099999999999998 27.6875 28.1 23.1125 24-25 21.1375 27.6125 28.1125 23.1375 26-27 21.1875 27.750000000000004 27.6625 23.400000000000002 28-29 20.575 28.037499999999998 27.737499999999997 23.65 30-31 20.6625 27.525 28.050000000000004 23.7625 32-33 20.974999999999998 27.1 28.225 23.7 34-35 20.25 28.499999999999996 27.3125 23.9375 36-37 20.6125 28.199999999999996 28.549999999999997 22.6375 38-39 20.775 27.6 28.0875 23.5375 40-41 21.0125 27.5125 28.15 23.325000000000003 42-43 20.825 28.549999999999997 27.5125 23.1125 44-45 21.8625 28.375 26.924999999999997 22.8375 46-47 20.825 27.4125 28.1875 23.575 48-49 20.375 27.3625 27.6 24.6625 50-51 20.9875 27.9375 27.1 23.974999999999998 52-53 21.29548580717769 27.27272727272727 27.53532574715518 23.896461172939855 54-55 21.7875 27.650000000000002 28.15 22.412499999999998 56-57 21.2375 26.9125 28.199999999999996 23.65 58-59 20.8875 28.125 27.275 23.7125 60-61 21.625 27.6125 28.275 22.4875 62-63 20.674999999999997 28.975 27.474999999999998 22.875 64-65 20.830207551887973 26.85671417854464 27.79444861215304 24.518629657414355 66-67 19.754938734683673 27.306826706676667 29.03225806451613 23.905976494123532 68-69 21.851156973108193 27.604752970606626 27.21701063164478 23.327079424640402 70-71 21.10527631907977 27.66941735433858 27.956989247311824 23.268317079269817 72-73 20.7375 28.1125 27.8875 23.2625 74-75 21.680420105026258 27.24431107776944 27.656914228557138 23.418354588647162 76-77 21.117779444861213 27.44436109027257 27.45686421605401 23.980995248812203 78-79 20.9375 27.212500000000002 28.5625 23.2875 80-81 21.1625 28.175 27.6 23.0625 82-83 21.337500000000002 27.962500000000002 28.325 22.375 84-85 21.3 27.237499999999997 27.800000000000004 23.6625 86-87 21.725 26.4125 28.512500000000003 23.35 88-89 22.075 26.424999999999997 27.575 23.925 90-91 21.925 27.3 27.737499999999997 23.0375 92-93 21.655413853463365 27.38184546136534 27.85696424106027 23.10577644411103 94-95 21.94298574643661 27.481870467616904 27.081770442610654 23.493373343335833 96-97 23.1 28.487499999999997 26.3125 22.1 98-99 20.9375 28.050000000000004 27.212500000000002 23.799999999999997 100-101 22.35 27.900000000000002 26.7625 22.9875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.0 23 0.5 24 1.0 25 2.5 26 2.0 27 1.5 28 4.0 29 8.5 30 10.5 31 13.0 32 15.5 33 20.0 34 34.5 35 55.5 36 65.5 37 88.5 38 122.0 39 147.0 40 172.0 41 200.5 42 234.0 43 272.5 44 275.0 45 267.0 46 272.0 47 248.0 48 239.5 49 225.0 50 181.5 51 169.0 52 149.5 53 106.0 54 86.5 55 67.5 56 45.0 57 32.0 58 29.5 59 30.0 60 26.5 61 23.0 62 16.5 63 9.0 64 6.0 65 5.5 66 4.5 67 2.5 68 1.0 69 2.5 70 2.5 71 0.0 72 0.5 73 1.0 74 0.5 75 0.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.675 2 0.0 3 0.05 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0375 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.025 66-67 0.025 68-69 0.0625 70-71 0.025 72-73 0.0 74-75 0.025 76-77 0.025 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.025 94-95 0.025 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19273461150352 98.3 2 0.7063572149344097 1.4000000000000001 3 0.10090817356205853 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.1125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.3 0.0 0.0 0.0 0.0 72-73 0.3375 0.0 0.0 0.0 0.0 74-75 0.425 0.0 0.0 0.0 0.0 76-77 0.5375000000000001 0.0 0.0 0.0 0.0 78-79 0.6375 0.0 0.0 0.0 0.0 80-81 0.7625 0.0 0.0 0.0 0.0 82-83 0.825 0.0 0.0 0.0 0.0 84-85 1.0 0.0 0.0 0.0 0.0 86-87 1.2125 0.0 0.0 0.0 0.0 88-89 1.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864457 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864457_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.27975 34.0 31.0 34.0 30.0 34.0 2 32.36925 34.0 31.0 34.0 31.0 34.0 3 32.38475 34.0 31.0 34.0 31.0 34.0 4 35.72225 37.0 37.0 37.0 35.0 37.0 5 35.7465 37.0 37.0 37.0 35.0 37.0 6 35.708 37.0 37.0 37.0 35.0 37.0 7 35.6605 37.0 37.0 37.0 35.0 37.0 8 35.6315 37.0 37.0 37.0 35.0 37.0 9 37.3725 39.0 38.0 39.0 35.0 39.0 10-11 37.358374999999995 39.0 38.0 39.0 35.0 39.0 12-13 37.27675 39.0 38.0 39.0 34.5 39.0 14-15 38.62425 41.0 39.0 41.0 34.0 41.0 16-17 38.571875000000006 41.0 39.0 41.0 34.0 41.0 18-19 38.532 41.0 39.0 41.0 34.0 41.0 20-21 38.327 41.0 38.5 41.0 34.0 41.0 22-23 38.372749999999996 40.5 39.0 41.0 34.0 41.0 24-25 38.172125 40.5 38.0 41.0 33.5 41.0 26-27 38.128375000000005 40.0 38.0 41.0 33.5 41.0 28-29 37.983000000000004 40.0 38.0 41.0 33.0 41.0 30-31 37.942375 40.0 38.0 41.0 33.0 41.0 32-33 37.786 40.0 38.0 41.0 33.0 41.0 34-35 37.825375 40.0 38.0 41.0 33.0 41.0 36-37 37.765125 40.0 38.0 41.0 33.0 41.0 38-39 37.64275 40.0 38.0 41.0 32.5 41.0 40-41 37.532 40.0 38.0 41.0 32.0 41.0 42-43 37.342625 40.0 38.0 41.0 31.5 41.0 44-45 37.03375 40.0 37.5 41.0 30.5 41.0 46-47 36.724375 40.0 37.0 41.0 30.0 41.0 48-49 36.790875 40.0 37.0 41.0 30.0 41.0 50-51 36.48275 39.5 36.5 40.5 30.0 41.0 52-53 36.65575 39.5 37.0 40.5 30.5 41.0 54-55 36.75675 40.0 37.0 41.0 30.5 41.0 56-57 36.80875 40.0 37.0 41.0 31.0 41.0 58-59 36.672875000000005 39.5 36.0 41.0 31.0 41.0 60-61 36.230000000000004 39.0 35.5 41.0 29.5 41.0 62-63 36.006 39.0 35.0 41.0 29.5 41.0 64-65 35.7205 38.5 35.0 40.5 29.0 41.0 66-67 35.356875 37.5 35.0 40.0 28.5 41.0 68-69 34.85425 37.0 34.5 39.5 28.0 41.0 70-71 34.465125 36.5 34.0 39.0 28.0 41.0 72-73 34.004000000000005 36.0 34.0 39.0 26.5 40.5 74-75 33.37675 35.5 34.0 37.5 26.0 39.0 76-77 33.064375 35.0 34.0 37.0 26.0 39.0 78-79 32.611375 35.0 33.0 36.5 26.0 38.5 80-81 32.211375000000004 35.0 33.0 36.0 25.5 37.0 82-83 31.622500000000002 35.0 32.0 35.5 24.0 37.0 84-85 31.4715 35.0 32.0 35.0 23.5 36.5 86-87 31.198375 35.0 32.0 35.0 21.5 36.0 88-89 30.98425 35.0 32.0 35.0 21.0 36.0 90-91 30.79 34.5 31.5 35.0 21.5 35.5 92-93 30.518375 34.0 31.0 35.0 19.0 35.0 94-95 30.356250000000003 34.0 31.0 35.0 18.0 35.0 96-97 29.991 34.0 31.0 35.0 11.0 35.0 98-99 29.628999999999998 34.0 31.0 35.0 2.0 35.0 100-101 28.555875 33.5 28.5 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 26.0 3 6.0 4 5.0 5 6.0 6 1.0 7 6.0 8 4.0 9 12.0 10 13.0 11 9.0 12 14.0 13 10.0 14 9.0 15 9.0 16 8.0 17 15.0 18 6.0 19 9.0 20 16.0 21 20.0 22 10.0 23 17.0 24 23.0 25 25.0 26 28.0 27 41.0 28 33.0 29 47.0 30 73.0 31 60.0 32 95.0 33 113.0 34 169.0 35 267.0 36 418.0 37 943.0 38 1257.0 39 177.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.9 17.424999999999997 15.45 37.225 2 24.6 22.825 35.875 16.7 3 21.475 27.150000000000002 30.099999999999998 21.275 4 22.325 32.324999999999996 23.525 21.825 5 25.55 34.375 22.400000000000002 17.675 6 20.3 38.45 23.1 18.15 7 20.175 20.3 38.7 20.825 8 21.55 25.35 30.0 23.1 9 21.75 23.825 30.349999999999998 24.075 10-11 23.400000000000002 31.612499999999997 24.087500000000002 20.9 12-13 24.1375 25.275 26.4125 24.175 14-15 22.35 29.2 26.924999999999997 21.525 16-17 23.799999999999997 27.8625 27.1625 21.175 18-19 22.825 28.962500000000002 27.0625 21.15 20-21 23.9375 28.262500000000003 26.724999999999998 21.075 22-23 23.549999999999997 28.6875 27.025 20.7375 24-25 23.200000000000003 27.287499999999998 28.025 21.4875 26-27 23.7375 28.6125 26.237500000000004 21.4125 28-29 22.825 28.237499999999997 27.025 21.912499999999998 30-31 23.05 27.5125 28.349999999999998 21.087500000000002 32-33 23.549999999999997 27.2625 27.075 22.112499999999997 34-35 22.025 29.25 28.000000000000004 20.724999999999998 36-37 23.0 28.175 27.537499999999998 21.2875 38-39 23.45 28.199999999999996 27.150000000000002 21.2 40-41 23.5875 28.512500000000003 27.3 20.599999999999998 42-43 23.2375 27.6375 27.925 21.2 44-45 23.5125 27.725 27.237499999999997 21.525 46-47 23.549999999999997 27.3375 27.8375 21.275 48-49 24.099999999999998 27.537499999999998 27.275 21.087500000000002 50-51 23.474999999999998 27.6875 27.3875 21.45 52-53 22.912499999999998 28.787499999999998 27.400000000000002 20.9 54-55 22.9375 27.950000000000003 27.575 21.5375 56-57 23.7375 27.5625 27.5875 21.1125 58-59 23.6875 27.500000000000004 27.0125 21.8 60-61 22.8125 28.1 27.275 21.8125 62-63 24.5125 28.15 26.687499999999996 20.65 64-65 22.925 27.462500000000002 27.400000000000002 22.2125 66-67 22.825 28.725 26.8125 21.637500000000003 68-69 23.849999999999998 28.9 27.1125 20.1375 70-71 23.3375 28.525 26.55 21.587500000000002 72-73 23.9 27.487499999999997 27.775 20.837500000000002 74-75 22.925 28.0875 27.525 21.462500000000002 76-77 23.95 27.5625 27.5625 20.925 78-79 23.9125 27.5125 27.0875 21.4875 80-81 24.224999999999998 28.075 27.325 20.375 82-83 24.025 28.4375 26.5375 21.0 84-85 23.7125 27.975 27.400000000000002 20.9125 86-87 23.9 27.900000000000002 27.1 21.099999999999998 88-89 23.4875 28.775000000000002 27.200000000000003 20.5375 90-91 23.2625 28.95 27.187499999999996 20.599999999999998 92-93 23.6125 29.25 27.025 20.1125 94-95 25.35 27.925 26.4125 20.3125 96-97 23.9 28.749999999999996 26.75 20.599999999999998 98-99 23.8125 28.0875 26.875 21.224999999999998 100-101 24.837500000000002 28.537499999999998 26.3 20.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 0.5 23 1.0 24 0.5 25 1.5 26 2.5 27 3.0 28 5.5 29 6.5 30 10.5 31 14.0 32 17.5 33 26.5 34 37.0 35 52.0 36 67.0 37 79.5 38 124.0 39 190.0 40 211.0 41 220.5 42 248.0 43 258.0 44 270.0 45 285.0 46 284.5 47 264.5 48 224.5 49 198.5 50 172.0 51 135.0 52 123.0 53 105.5 54 80.5 55 63.5 56 51.0 57 43.5 58 29.0 59 19.5 60 17.5 61 15.5 62 9.0 63 5.5 64 5.5 65 3.5 66 2.5 67 2.5 68 3.0 69 2.0 70 1.0 71 0.5 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74924774322969 99.45 2 0.20060180541624875 0.4 3 0.05015045135406219 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.1125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.3 0.0 0.0 0.0 0.0 72-73 0.3375 0.0 0.0 0.0 0.0 74-75 0.425 0.0 0.0 0.0 0.0 76-77 0.5375000000000001 0.0 0.0 0.0 0.0 78-79 0.6125 0.0 0.0 0.0 0.0 80-81 0.7124999999999999 0.0 0.0 0.0 0.0 82-83 0.775 0.0 0.0 0.0 0.0 84-85 0.95 0.0 0.0 0.0 0.0 86-87 1.15 0.0 0.0 0.0 0.0 88-89 1.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTCTTA 15 0.009957196 47.5 20-21 >>END_MODULE Read 784959 spots for ERR1864457.sra Written 784959 spots for ERR1864457.sra Read 784959 spots for ERR1864457.sra Written 784959 spots for ERR1864457.sra Read 784959 spots for ERR1864457.sra Written 784959 spots for ERR1864457.sra Read 784959 spots for ERR1864457.sra Written 784959 spots for ERR1864457.sra Read 784959 spots for ERR1864457.sra Written 784959 spots for ERR1864457.sra Read 784959 spots for ERR1864457.sra Written 784959 spots for ERR1864457.sra Read 784959 spots for ERR1864457.sra Written 784959 spots for ERR1864457.sra Read 784959 spots for ERR1864457.sra Written 784959 spots for ERR1864457.sra Read 784959 spots for ERR1864457.sra Written 784959 spots for ERR1864457.sra Read 784959 spots for ERR1864457.sra Written 784959 spots for ERR1864457.sra Read 784959 spots for ERR1864457.sra Written 784959 spots for ERR1864457.sra Read 784959 spots for ERR1864457.sra Written 784959 spots for ERR1864457.sra Read 784959 spots for ERR1864457.sra Written 784959 spots for ERR1864457.sra Read 784959 spots for ERR1864457.sra Written 784959 spots for ERR1864457.sra Read 784959 spots for ERR1864457.sra Written 784959 spots for ERR1864457.sra Read 784959 spots for ERR1864457.sra Written 784959 spots for ERR1864457.sra Read 784959 spots for ERR1864457.sra Written 784959 spots for ERR1864457.sra Read 784959 spots for ERR1864457.sra Written 784959 spots for ERR1864457.sra Read 784959 spots for ERR1864457.sra Written 784959 spots for ERR1864457.sra Read 784959 spots for ERR1864457.sra Written 784959 spots for ERR1864457.sra SRR ids: ['ERR1864457.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5dz2ltyp ERR1864457.sra spots: 15699180 blocks: [[1, 784959], [784960, 1569918], [1569919, 2354877], [2354878, 3139836], [3139837, 3924795], [3924796, 4709754], [4709755, 5494713], [5494714, 6279672], [6279673, 7064631], [7064632, 7849590], [7849591, 8634549], [8634550, 9419508], [9419509, 10204467], [10204468, 10989426], [10989427, 11774385], [11774386, 12559344], [12559345, 13344303], [13344304, 14129262], [14129263, 14914221], [14914222, 15699180]] ERR1864457 file size 3765113 ERR1864457 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864457 ERR1864457_1.fastq ERR1864457_2.fastq Input file: ERR1864457_1.fastq Paired file: ERR1864457_2.fastq trimmed: ERR1864457-trimmed-pair1.fastq, ERR1864457-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 12:17:49 2025 >> started Thu Feb 13 12:18:03 2025 >> done (14.515s) 15699180 read pairs processed; of these: 220677 ( 1.41%) short read pairs filtered out after trimming by size control 248350 ( 1.58%) empty read pairs filtered out after trimming by size control 15230153 (97.01%) read pairs available; of these: 3639632 (23.90%) trimmed read pairs available after processing 11590521 (76.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 99 0.00% 19 269 0.00% 20 360 0.00% 21 487 0.00% 22 608 0.00% 23 763 0.01% 24 933 0.01% 25 1158 0.01% 26 1343 0.01% 27 1514 0.01% 28 1744 0.01% 29 2028 0.01% 30 2251 0.01% 31 2711 0.02% 32 3077 0.02% 33 3319 0.02% 34 3608 0.02% 35 3933 0.03% 36 4319 0.03% 37 4529 0.03% 38 5042 0.03% 39 5333 0.04% 40 5704 0.04% 41 6195 0.04% 42 6441 0.04% 43 6679 0.04% 44 7051 0.05% 45 7376 0.05% 46 8110 0.05% 47 8176 0.05% 48 8735 0.06% 49 9089 0.06% 50 9737 0.06% 51 9894 0.06% 52 10493 0.07% 53 11107 0.07% 54 11571 0.08% 55 12161 0.08% 56 12806 0.08% 57 13428 0.09% 58 14432 0.09% 59 17936 0.12% 60 21330 0.14% 61 21679 0.14% 62 22531 0.15% 63 23710 0.16% 64 24018 0.16% 65 25719 0.17% 66 26625 0.17% 67 27545 0.18% 68 28636 0.19% 69 30077 0.20% 70 31038 0.20% 71 32377 0.21% 72 34160 0.22% 73 35503 0.23% 74 36787 0.24% 75 37688 0.25% 76 38019 0.25% 77 40278 0.26% 78 42626 0.28% 79 44975 0.30% 80 47169 0.31% 81 49380 0.32% 82 52509 0.34% 83 55488 0.36% 84 58375 0.38% 85 61727 0.41% 86 65764 0.43% 87 70083 0.46% 88 70648 0.46% 89 75304 0.49% 90 82721 0.54% 91 90544 0.59% 92 99410 0.65% 93 110721 0.73% 94 124884 0.82% 95 144919 0.95% 96 171421 1.13% 97 209515 1.38% 98 269052 1.77% 99 359214 2.36% 100 498914 3.28% 101 11590521 76.10% 15230153 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=4.15 fanout-score-rank=18 prefix-density=0.27 prefix-fanout=2.9 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.08 sequence-density-rank=14 fanout-score=295.55 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=27.5 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=5.58 fanout-score-rank=16 prefix-density=0.23 prefix-fanout=4.1 sequence=TGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTGCAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=13 fanout-score=318.47 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=28.8 sequence=AAGAAGAAGAAA ERR1864457 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 12:18:33 Started mapping on | Feb 13 12:18:34 Finished on | Feb 13 12:19:22 Mapping speed, Million of reads per hour | 1142.26 Number of input reads | 15230153 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 14502683 Uniquely mapped reads % | 95.22% Average mapped length | 195.40 Number of splices: Total | 8377325 Number of splices: Annotated (sjdb) | 8237064 Number of splices: GT/AG | 8253205 Number of splices: GC/AG | 104388 Number of splices: AT/AC | 8179 Number of splices: Non-canonical | 11553 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 2.44 Insertion rate per base | 0.01% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 388652 % of reads mapped to multiple loci | 2.55% Number of reads mapped to too many loci | 53407 % of reads mapped to too many loci | 0.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.84% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 358416 358416 358416 N_multimapping 388652 388652 388652 N_noFeature 356810 14361756 427890 N_ambiguous 130286 661 60005 UnstrandedReadsAssigned:14015587 PositiveStrandReadsAssigned:140266 NegativeStrandReadsAssigned:14014788 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864457 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864457-trimmed-pair1.fastq ERR1864457-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,230,153 reads, 14,222,994 reads pseudoaligned [quant] estimated average fragment length: 153.513 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,080 rounds 52401 ERR1864457.ke.tsv 34699 ERR1864457.se.tsv 87100 total ==> ERR1864457.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1865.49 2042 84.5808 Potri.005G024800.1.v4.1 1035 882.487 512 44.8301 Potri.004G059700.1.v4.1 961 808.487 26 2.4849 Potri.007G009000.2.v4.1 1416 1263.49 0 0 Potri.003G141000.2.v4.1 2943 2790.49 750.292 20.7758 Potri.016G087400.1.v4.1 270 122.228 784.614 496.014 Potri.015G069301.1.v4.1 564 411.55 0 0 Potri.010G195200.1.v4.1 1773 1620.49 240 11.4439 Potri.012G127500.1.v4.1 977 824.487 12226 1145.8 ==> ERR1864457.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 248 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 402 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 84 ERR1864457 completed mapping pipeline successfully