Starting /dee2/code/volunteer_pipeline.sh ERR1864458 current disk space = 3092490092544 free memory = 1424088020 ERR1864458 SRAfilesize bf2e530f9e6f25d28e822367622febda ERR1864458.sra ERR1864458.sra file validated ERR1864458 is paired end ERR1864458 is conventional basespace ERR1864458 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864458_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.17875 34.0 31.0 34.0 30.0 34.0 2 31.7415 34.0 31.0 34.0 28.0 34.0 3 32.37825 34.0 31.0 34.0 30.0 34.0 4 35.82125 37.0 35.0 37.0 35.0 37.0 5 35.7115 37.0 37.0 37.0 35.0 37.0 6 35.57325 37.0 36.0 37.0 35.0 37.0 7 35.6895 37.0 37.0 37.0 35.0 37.0 8 35.70025 37.0 37.0 37.0 35.0 37.0 9 37.45175 39.0 38.0 39.0 35.0 39.0 10-11 37.384875 39.0 38.0 39.0 35.0 39.0 12-13 37.225750000000005 39.0 38.0 39.0 34.5 39.0 14-15 38.830625 41.0 39.0 41.0 35.5 41.0 16-17 38.725750000000005 41.0 39.0 41.0 35.5 41.0 18-19 38.761250000000004 41.0 39.0 41.0 35.5 41.0 20-21 38.566874999999996 41.0 39.0 41.0 34.5 41.0 22-23 38.557249999999996 41.0 39.0 41.0 34.5 41.0 24-25 38.463625 41.0 39.0 41.0 34.5 41.0 26-27 38.408625 40.5 39.0 41.0 34.0 41.0 28-29 38.337374999999994 40.0 39.0 41.0 34.0 41.0 30-31 38.215375 40.0 38.0 41.0 34.0 41.0 32-33 38.185375 40.0 38.0 41.0 34.0 41.0 34-35 37.913624999999996 40.0 38.0 41.0 33.0 41.0 36-37 37.919375 40.0 38.0 41.0 33.0 41.0 38-39 37.891999999999996 40.0 38.0 41.0 33.0 41.0 40-41 37.759375 40.0 38.0 41.0 33.0 41.0 42-43 37.56275 40.0 38.0 41.0 33.0 41.0 44-45 37.423375 40.0 38.0 41.0 32.5 41.0 46-47 37.568375 40.0 38.0 41.0 32.5 41.0 48-49 37.608999999999995 40.0 38.0 41.0 33.0 41.0 50-51 37.39125 40.0 37.5 41.0 32.5 41.0 52-53 37.203625 40.0 37.0 41.0 32.0 41.0 54-55 37.002125 40.0 36.5 41.0 31.5 41.0 56-57 36.859625 39.5 36.5 41.0 31.5 41.0 58-59 36.608875 39.0 36.0 41.0 31.0 41.0 60-61 36.416250000000005 39.0 35.5 41.0 31.0 41.0 62-63 36.117125 39.0 35.0 40.0 30.0 41.0 64-65 35.64725 38.0 35.0 40.0 29.5 41.0 66-67 35.37475 37.5 35.0 40.0 29.0 41.0 68-69 34.998000000000005 37.0 34.0 39.5 29.0 41.0 70-71 34.560625 36.5 34.0 39.0 29.0 40.5 72-73 34.020624999999995 36.0 34.0 38.5 27.5 40.0 74-75 33.494375 35.0 33.5 37.5 26.5 39.5 76-77 32.404250000000005 35.0 32.0 36.5 25.5 39.0 78-79 32.670874999999995 35.0 33.0 36.5 26.0 39.0 80-81 32.379374999999996 35.0 33.0 36.0 26.0 37.5 82-83 32.048125 35.0 33.0 36.0 25.5 37.0 84-85 31.766375 35.0 33.0 35.0 25.0 37.0 86-87 31.480125 35.0 32.0 35.0 24.5 36.0 88-89 31.27125 34.5 32.0 35.0 24.0 36.0 90-91 30.9155 34.0 32.0 35.0 22.0 35.5 92-93 30.75725 34.0 32.0 35.0 22.5 35.0 94-95 30.539375 34.0 31.0 35.0 21.0 35.0 96-97 30.218625000000003 34.0 31.0 35.0 17.0 35.0 98-99 29.913 34.0 31.0 35.0 4.5 35.0 100-101 29.168750000000003 34.0 30.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 32.0 3 7.0 4 7.0 5 7.0 6 5.0 7 8.0 8 6.0 9 1.0 10 7.0 11 6.0 12 8.0 13 14.0 14 6.0 15 9.0 16 9.0 17 7.0 18 9.0 19 8.0 20 10.0 21 15.0 22 24.0 23 14.0 24 13.0 25 13.0 26 17.0 27 30.0 28 33.0 29 47.0 30 48.0 31 75.0 32 86.0 33 118.0 34 157.0 35 302.0 36 428.0 37 950.0 38 1310.0 39 154.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.83672404799165 6.311945748565467 7.981220657276995 46.870109546165885 2 25.3 8.85 33.575 32.275 3 24.680851063829788 11.13892365456821 22.65331664580726 41.52690863579475 4 28.000000000000004 20.200000000000003 20.25 31.55 5 27.89592194145609 25.193895421566175 24.49337002752064 22.416812609457093 6 19.950000000000003 29.7 26.974999999999998 23.375 7 16.2 24.625 40.775 18.4 8 18.6 23.799999999999997 34.4 23.200000000000003 9 18.025 22.925 37.325 21.725 10-11 20.4 32.587500000000006 27.474999999999998 19.537499999999998 12-13 20.724999999999998 26.387500000000003 29.15 23.7375 14-15 19.6375 27.925 30.425 22.0125 16-17 21.1875 27.825 28.5875 22.400000000000002 18-19 21.5375 26.974999999999998 28.249999999999996 23.2375 20-21 20.125 27.800000000000004 28.575 23.5 22-23 20.875 28.549999999999997 28.599999999999998 21.975 24-25 20.625 27.8875 27.3375 24.15 26-27 20.8875 28.1875 27.200000000000003 23.724999999999998 28-29 20.875 27.5875 28.8625 22.675 30-31 20.3375 27.487499999999997 28.15 24.025 32-33 21.3625 26.5 28.675 23.4625 34-35 21.25 27.0875 27.750000000000004 23.9125 36-37 22.275 27.0625 27.500000000000004 23.1625 38-39 20.424999999999997 27.0625 28.999999999999996 23.5125 40-41 21.337500000000002 27.650000000000002 28.299999999999997 22.7125 42-43 21.0125 26.150000000000002 28.325 24.5125 44-45 21.325 27.1625 27.9375 23.575 46-47 21.4 27.6125 27.224999999999998 23.7625 48-49 20.9375 27.05 27.712500000000002 24.3 50-51 20.3625 28.0625 27.8375 23.7375 52-53 21.31782945736434 27.219304826206553 28.119529882470616 23.34333583395849 54-55 21.3875 27.025 27.8125 23.775 56-57 20.875 27.224999999999998 28.325 23.575 58-59 21.3 27.250000000000004 28.125 23.325000000000003 60-61 21.352669083635455 27.890986373296663 27.465933241655204 23.29041130141268 62-63 21.702712839104887 27.015876984623077 28.353544193024128 22.927865983247905 64-65 20.40510127531883 28.35708927231808 27.419354838709676 23.818454613653415 66-67 20.43010752688172 27.84446111527882 28.294573643410853 23.43085771442861 68-69 21.345504564211577 26.747530323871448 28.373139927472803 23.533825184444165 70-71 21.840230028753595 27.65345668208526 27.528441055131893 22.977872234029252 72-73 21.65270658832354 28.253531691461433 26.20327540942618 23.89048631078885 74-75 21.007877954232836 27.91046642490934 28.435663373765163 22.64599224709266 76-77 21.165145643205403 27.378422302787847 28.978622327790976 22.477809726215778 78-79 22.175 26.625 27.762500000000003 23.4375 80-81 21.6 27.5875 27.537499999999998 23.275000000000002 82-83 22.0875 27.325 27.05 23.5375 84-85 20.8625 27.3875 27.1 24.65 86-87 21.6625 27.750000000000004 27.275 23.3125 88-89 21.45 27.275 27.775 23.5 90-91 22.6875 27.2625 27.3875 22.662499999999998 92-93 21.442860715178792 26.806701675418854 28.644661165291325 23.10577644411103 94-95 22.052756594574323 27.603450431303912 27.528441055131893 22.815351918989872 96-97 21.6875 27.487499999999997 27.224999999999998 23.599999999999998 98-99 21.587500000000002 27.962500000000002 27.500000000000004 22.95 100-101 21.475 28.3125 27.3375 22.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 1.5 26 3.0 27 3.0 28 4.0 29 7.0 30 11.5 31 20.0 32 26.0 33 28.5 34 39.0 35 51.0 36 65.5 37 95.0 38 121.5 39 142.5 40 175.0 41 202.5 42 227.5 43 255.5 44 260.5 45 267.5 46 276.0 47 252.5 48 235.5 49 216.5 50 189.0 51 160.0 52 126.0 53 98.0 54 78.0 55 65.0 56 53.0 57 44.0 58 39.0 59 43.0 60 34.5 61 17.0 62 12.5 63 12.0 64 10.0 65 7.5 66 7.0 67 6.5 68 2.0 69 0.5 70 0.5 71 0.5 72 1.5 73 2.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.15 2 0.0 3 0.125 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.025 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0125 62-63 0.0125 64-65 0.025 66-67 0.025 68-69 0.0375 70-71 0.0125 72-73 0.0125 74-75 0.0375 76-77 0.0125 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.025 94-95 0.0125 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39622641509433 98.775 2 0.5786163522012578 1.15 3 0.025157232704402514 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.1875 0.0 0.0 0.0 0.0 72-73 0.21250000000000002 0.0 0.0 0.0 0.0 74-75 0.2875 0.0 0.0 0.0 0.0 76-77 0.375 0.0 0.0 0.0 0.0 78-79 0.45 0.0 0.0 0.0 0.0 80-81 0.5375 0.0 0.0 0.0 0.0 82-83 0.7250000000000001 0.0 0.0 0.0 0.0 84-85 0.9 0.0 0.0 0.0 0.0 86-87 1.0499999999999998 0.0 0.0 0.0 0.0 88-89 1.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864458 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864458_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.31575 34.0 31.0 34.0 31.0 34.0 2 32.495 34.0 31.0 34.0 31.0 34.0 3 32.4955 34.0 31.0 34.0 31.0 34.0 4 35.819 37.0 37.0 37.0 35.0 37.0 5 35.83975 37.0 37.0 37.0 35.0 37.0 6 35.8415 37.0 37.0 37.0 35.0 37.0 7 35.804 37.0 37.0 37.0 35.0 37.0 8 35.8665 37.0 37.0 37.0 35.0 37.0 9 37.54025 39.0 38.0 39.0 35.0 39.0 10-11 37.434250000000006 39.0 38.0 39.0 35.0 39.0 12-13 37.439750000000004 39.0 38.0 39.0 35.0 39.0 14-15 38.725375 41.0 38.5 41.0 34.5 41.0 16-17 38.77775 41.0 39.0 41.0 35.5 41.0 18-19 38.72475 41.0 39.0 41.0 35.0 41.0 20-21 38.561625 41.0 39.0 41.0 34.0 41.0 22-23 38.603125000000006 40.5 39.0 41.0 34.0 41.0 24-25 38.406125 40.0 38.5 41.0 34.0 41.0 26-27 38.32 40.0 38.0 41.0 34.0 41.0 28-29 38.233 40.0 38.0 41.0 34.0 41.0 30-31 38.180499999999995 40.0 38.0 41.0 33.5 41.0 32-33 38.043875 40.0 38.0 41.0 33.0 41.0 34-35 38.077124999999995 40.0 38.0 41.0 33.5 41.0 36-37 37.9365 40.0 38.0 41.0 33.0 41.0 38-39 37.86825 40.0 38.0 41.0 33.0 41.0 40-41 37.69499999999999 40.0 38.0 41.0 33.0 41.0 42-43 37.480000000000004 40.0 38.0 41.0 32.0 41.0 44-45 37.2315 40.0 37.5 41.0 31.5 41.0 46-47 36.99575 40.0 37.0 41.0 31.0 41.0 48-49 37.057125 40.0 37.0 41.0 31.0 41.0 50-51 36.737375 39.5 36.5 40.5 30.5 41.0 52-53 37.058875 39.5 37.0 40.5 31.5 41.0 54-55 37.12975 40.0 37.0 41.0 31.0 41.0 56-57 37.10875 40.0 37.0 41.0 31.0 41.0 58-59 36.8825 39.5 36.5 41.0 31.0 41.0 60-61 36.337875 39.0 35.0 41.0 29.5 41.0 62-63 36.19825 39.0 35.0 41.0 29.5 41.0 64-65 35.952124999999995 38.5 35.0 40.5 29.5 41.0 66-67 35.5675 37.5 35.0 40.0 29.0 41.0 68-69 35.130875 37.0 35.0 39.5 29.0 41.0 70-71 34.720125 36.5 34.0 39.0 28.0 41.0 72-73 34.255875 36.0 34.0 39.0 28.0 40.0 74-75 33.685625 35.5 34.0 37.5 27.0 39.5 76-77 33.317625 35.0 34.0 37.0 26.0 39.0 78-79 32.865375 35.0 33.0 37.0 26.0 39.0 80-81 32.441374999999994 35.0 33.0 36.0 26.0 37.0 82-83 31.806625 35.0 32.0 36.0 24.5 37.0 84-85 31.661375 35.0 32.0 35.0 25.0 36.5 86-87 31.49425 35.0 32.0 35.0 24.5 36.0 88-89 31.27525 35.0 32.0 35.0 24.5 36.0 90-91 30.987125 34.0 32.0 35.0 23.0 35.5 92-93 30.799750000000003 34.0 31.5 35.0 21.5 35.0 94-95 30.5855 34.0 31.0 35.0 19.5 35.0 96-97 30.244 34.0 31.0 35.0 18.0 35.0 98-99 29.82175 34.0 31.0 35.0 4.5 35.0 100-101 28.766 33.5 29.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 2.0 4 6.0 5 5.0 6 5.0 7 5.0 8 7.0 9 9.0 10 7.0 11 12.0 12 6.0 13 8.0 14 9.0 15 11.0 16 7.0 17 9.0 18 11.0 19 12.0 20 16.0 21 17.0 22 17.0 23 18.0 24 12.0 25 23.0 26 26.0 27 34.0 28 51.0 29 43.0 30 53.0 31 65.0 32 109.0 33 119.0 34 199.0 35 253.0 36 439.0 37 957.0 38 1229.0 39 179.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.7 19.75 14.35 37.2 2 25.0 24.75 33.575 16.675 3 20.75 28.225 28.599999999999998 22.425 4 23.275000000000002 33.525 22.900000000000002 20.3 5 26.05 34.150000000000006 22.825 16.975 6 19.950000000000003 38.25 23.474999999999998 18.325 7 20.95 20.5 37.15 21.4 8 20.65 24.575 29.125 25.650000000000002 9 21.15 24.025 30.599999999999998 24.224999999999998 10-11 22.5 32.1875 23.724999999999998 21.587500000000002 12-13 24.5375 25.55 27.075 22.8375 14-15 22.3125 28.275 27.437499999999996 21.975 16-17 23.3375 27.700000000000003 27.3125 21.65 18-19 22.85 28.325 27.0125 21.8125 20-21 23.65 28.825 26.187500000000004 21.337500000000002 22-23 22.112499999999997 28.1625 27.55 22.175 24-25 22.8625 28.812500000000004 27.8125 20.5125 26-27 22.8375 28.675 27.150000000000002 21.337500000000002 28-29 22.8 27.8375 27.35 22.0125 30-31 22.7 28.7 27.05 21.55 32-33 23.3875 29.037499999999998 26.575 21.0 34-35 23.0 28.5625 27.3625 21.075 36-37 22.725 28.7 26.6125 21.9625 38-39 23.9 27.712500000000002 27.150000000000002 21.2375 40-41 24.025 28.425 26.75 20.8 42-43 21.675 28.5875 27.962500000000002 21.775 44-45 22.5875 28.012500000000003 27.400000000000002 22.0 46-47 23.2375 27.987499999999997 27.575 21.2 48-49 23.200000000000003 27.900000000000002 26.8375 22.0625 50-51 22.9875 28.262500000000003 27.487499999999997 21.2625 52-53 22.8625 28.1625 28.075 20.9 54-55 22.237499999999997 28.475 27.712500000000002 21.575 56-57 22.875 29.4125 27.250000000000004 20.4625 58-59 23.375 27.525 26.6625 22.4375 60-61 23.225 27.800000000000004 26.950000000000003 22.025 62-63 23.5125 29.099999999999998 26.937499999999996 20.45 64-65 23.3 28.1 27.287499999999998 21.3125 66-67 23.3 27.537499999999998 27.3375 21.825 68-69 23.0625 27.737499999999997 27.987499999999997 21.212500000000002 70-71 24.025 28.050000000000004 26.0625 21.8625 72-73 23.125 27.6125 27.4125 21.85 74-75 23.974999999999998 28.525 26.5625 20.9375 76-77 23.25 28.462500000000002 26.487500000000004 21.8 78-79 23.2375 28.212500000000002 27.800000000000004 20.75 80-81 23.25 28.025 26.974999999999998 21.75 82-83 23.4125 28.0875 26.825 21.675 84-85 23.0375 28.3625 27.3875 21.212500000000002 86-87 22.9625 28.299999999999997 27.1375 21.6 88-89 24.587500000000002 27.762500000000003 27.187499999999996 20.4625 90-91 24.1375 28.349999999999998 26.875 20.6375 92-93 23.575 27.5875 27.9375 20.9 94-95 24.6875 27.6375 26.8125 20.8625 96-97 24.325 27.762500000000003 26.55 21.3625 98-99 23.9875 28.999999999999996 25.937500000000004 21.075 100-101 24.6125 27.5625 26.400000000000002 21.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 1.0 27 2.0 28 3.5 29 8.0 30 13.5 31 17.5 32 23.5 33 31.0 34 41.5 35 58.5 36 80.0 37 111.0 38 135.5 39 151.5 40 178.0 41 209.5 42 246.5 43 266.0 44 277.0 45 281.5 46 287.0 47 271.5 48 221.0 49 192.0 50 177.0 51 142.0 52 107.0 53 84.5 54 76.5 55 63.5 56 42.5 57 42.0 58 35.0 59 26.0 60 21.5 61 15.5 62 12.0 63 11.5 64 10.0 65 7.5 66 5.0 67 2.5 68 3.0 69 2.5 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.2 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.21250000000000002 0.0 0.0 0.0 0.0 74-75 0.2875 0.0 0.0 0.0 0.0 76-77 0.375 0.0 0.0 0.0 0.0 78-79 0.45 0.0 0.0 0.0 0.0 80-81 0.55 0.0 0.0 0.0 0.0 82-83 0.7250000000000001 0.0 0.0 0.0 0.0 84-85 0.8875 0.0 0.0 0.0 0.0 86-87 1.025 0.0 0.0 0.0 0.0 88-89 1.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 889282 spots for ERR1864458.sra Written 889282 spots for ERR1864458.sra Read 889282 spots for ERR1864458.sra Written 889282 spots for ERR1864458.sra Read 889282 spots for ERR1864458.sra Written 889282 spots for ERR1864458.sra Read 889282 spots for ERR1864458.sra Written 889282 spots for ERR1864458.sra Read 889282 spots for ERR1864458.sra Written 889282 spots for ERR1864458.sra Read 889282 spots for ERR1864458.sra Written 889282 spots for ERR1864458.sra Read 889282 spots for ERR1864458.sra Written 889282 spots for ERR1864458.sra Read 889282 spots for ERR1864458.sra Written 889282 spots for ERR1864458.sra Read 889282 spots for ERR1864458.sra Written 889282 spots for ERR1864458.sra Read 889282 spots for ERR1864458.sra Written 889282 spots for ERR1864458.sra Read 889282 spots for ERR1864458.sra Written 889282 spots for ERR1864458.sra Read 889282 spots for ERR1864458.sra Written 889282 spots for ERR1864458.sra Read 889282 spots for ERR1864458.sra Written 889282 spots for ERR1864458.sra Read 889282 spots for ERR1864458.sra Written 889282 spots for ERR1864458.sra Read 889282 spots for ERR1864458.sra Written 889282 spots for ERR1864458.sra Read 889282 spots for ERR1864458.sra Written 889282 spots for ERR1864458.sra Read 889282 spots for ERR1864458.sra Written 889282 spots for ERR1864458.sra Read 889282 spots for ERR1864458.sra Written 889282 spots for ERR1864458.sra Read 889282 spots for ERR1864458.sra Written 889282 spots for ERR1864458.sra Read 889282 spots for ERR1864458.sra Written 889282 spots for ERR1864458.sra SRR ids: ['ERR1864458.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yorlafc4 ERR1864458.sra spots: 17785640 blocks: [[1, 889282], [889283, 1778564], [1778565, 2667846], [2667847, 3557128], [3557129, 4446410], [4446411, 5335692], [5335693, 6224974], [6224975, 7114256], [7114257, 8003538], [8003539, 8892820], [8892821, 9782102], [9782103, 10671384], [10671385, 11560666], [11560667, 12449948], [12449949, 13339230], [13339231, 14228512], [14228513, 15117794], [15117795, 16007076], [16007077, 16896358], [16896359, 17785640]] ERR1864458 file size 4268390 ERR1864458 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864458 ERR1864458_1.fastq ERR1864458_2.fastq Input file: ERR1864458_1.fastq Paired file: ERR1864458_2.fastq trimmed: ERR1864458-trimmed-pair1.fastq, ERR1864458-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 12:18:12 2025 >> started Thu Feb 13 12:18:36 2025 >> done (23.901s) 17785640 read pairs processed; of these: 258504 ( 1.45%) short read pairs filtered out after trimming by size control 304403 ( 1.71%) empty read pairs filtered out after trimming by size control 17222733 (96.84%) read pairs available; of these: 4098565 (23.80%) trimmed read pairs available after processing 13124168 (76.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 133 0.00% 19 303 0.00% 20 453 0.00% 21 600 0.00% 22 768 0.00% 23 1017 0.01% 24 1146 0.01% 25 1333 0.01% 26 1629 0.01% 27 1948 0.01% 28 2118 0.01% 29 2454 0.01% 30 2829 0.02% 31 3127 0.02% 32 3441 0.02% 33 3936 0.02% 34 4330 0.03% 35 4692 0.03% 36 5054 0.03% 37 5443 0.03% 38 5834 0.03% 39 6318 0.04% 40 6777 0.04% 41 7079 0.04% 42 7440 0.04% 43 8054 0.05% 44 8267 0.05% 45 8778 0.05% 46 9209 0.05% 47 9475 0.06% 48 10417 0.06% 49 10521 0.06% 50 11004 0.06% 51 11581 0.07% 52 12114 0.07% 53 12472 0.07% 54 13265 0.08% 55 13939 0.08% 56 14736 0.09% 57 15466 0.09% 58 16389 0.10% 59 20542 0.12% 60 24267 0.14% 61 24814 0.14% 62 25542 0.15% 63 26930 0.16% 64 27702 0.16% 65 28899 0.17% 66 30110 0.17% 67 31102 0.18% 68 32535 0.19% 69 33772 0.20% 70 35065 0.20% 71 36319 0.21% 72 38426 0.22% 73 39904 0.23% 74 41113 0.24% 75 42634 0.25% 76 42507 0.25% 77 44904 0.26% 78 47595 0.28% 79 50377 0.29% 80 53138 0.31% 81 55356 0.32% 82 58709 0.34% 83 61523 0.36% 84 64618 0.38% 85 68237 0.40% 86 72173 0.42% 87 76952 0.45% 88 78550 0.46% 89 83191 0.48% 90 91414 0.53% 91 99988 0.58% 92 110572 0.64% 93 123078 0.71% 94 138876 0.81% 95 160893 0.93% 96 191042 1.11% 97 235240 1.37% 98 305700 1.77% 99 408717 2.37% 100 569650 3.31% 101 13124168 76.20% 17222733 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=4.79 fanout-score-rank=16 prefix-density=0.30 prefix-fanout=3.1 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.09 sequence-density-rank=11 fanout-score=258.88 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=28.3 sequence=CTTCTTCTTTTT criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=5.20 fanout-score-rank=16 prefix-density=0.24 prefix-fanout=3.8 sequence=TGCAAGTGCGGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.08 sequence-density-rank=17 fanout-score=322.17 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=29.8 sequence=AAGAAGAAGAAA ERR1864458 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 12:19:24 Started mapping on | Feb 13 12:19:24 Finished on | Feb 13 12:20:23 Mapping speed, Million of reads per hour | 1050.88 Number of input reads | 17222733 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 16495776 Uniquely mapped reads % | 95.78% Average mapped length | 195.38 Number of splices: Total | 9582236 Number of splices: Annotated (sjdb) | 9416766 Number of splices: GT/AG | 9439297 Number of splices: GC/AG | 120190 Number of splices: AT/AC | 9345 Number of splices: Non-canonical | 13404 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 2.45 Insertion rate per base | 0.01% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 442854 % of reads mapped to multiple loci | 2.57% Number of reads mapped to too many loci | 36806 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.42% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 307421 307421 307421 N_multimapping 442854 442854 442854 N_noFeature 414537 16350620 479347 N_ambiguous 150172 725 69421 UnstrandedReadsAssigned:15931067 PositiveStrandReadsAssigned:144431 NegativeStrandReadsAssigned:15947008 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864458 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864458-trimmed-pair1.fastq ERR1864458-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,222,733 reads, 16,162,637 reads pseudoaligned [quant] estimated average fragment length: 159.581 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,059 rounds 52401 ERR1864458.ke.tsv 34699 ERR1864458.se.tsv 87100 total ==> ERR1864458.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1859.42 2261 80.4706 Potri.005G024800.1.v4.1 1035 876.419 923 69.6954 Potri.004G059700.1.v4.1 961 802.419 49 4.04119 Potri.007G009000.2.v4.1 1416 1257.42 0 0 Potri.003G141000.2.v4.1 2943 2784.42 861.283 20.4704 Potri.016G087400.1.v4.1 270 118.051 1069 599.268 Potri.015G069301.1.v4.1 564 405.566 0 0 Potri.010G195200.1.v4.1 1773 1614.42 187 7.66548 Potri.012G127500.1.v4.1 977 818.419 13401 1083.62 ==> ERR1864458.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 271 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 503 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 69 ERR1864458 completed mapping pipeline successfully