Starting /dee2/code/volunteer_pipeline.sh ERR1864459 current disk space = 3092667203584 free memory = 1446468440 ERR1864459 SRAfilesize 3e48c2710fff68258bb787bf59e70fef ERR1864459.sra ERR1864459.sra file validated ERR1864459 is paired end ERR1864459 is conventional basespace ERR1864459 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864459_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6095 34.0 31.0 34.0 30.0 34.0 2 32.09075 34.0 31.0 34.0 30.0 34.0 3 32.38575 34.0 31.0 34.0 30.0 34.0 4 35.81975 37.0 37.0 37.0 35.0 37.0 5 35.448 37.0 35.0 37.0 33.0 37.0 6 35.575 37.0 35.0 37.0 33.0 37.0 7 35.61925 37.0 36.0 37.0 35.0 37.0 8 35.605 37.0 36.0 37.0 35.0 37.0 9 37.3265 39.0 38.0 39.0 35.0 39.0 10-11 37.243875 39.0 38.0 39.0 34.5 39.0 12-13 37.079125000000005 39.0 38.0 39.0 33.5 39.0 14-15 38.621750000000006 41.0 39.0 41.0 34.0 41.0 16-17 38.521125 41.0 39.0 41.0 34.0 41.0 18-19 38.53775 41.0 39.0 41.0 34.0 41.0 20-21 38.469875 41.0 39.0 41.0 34.0 41.0 22-23 38.448625 41.0 39.0 41.0 34.0 41.0 24-25 38.29775 40.5 38.5 41.0 34.0 41.0 26-27 38.37425 41.0 38.5 41.0 34.0 41.0 28-29 38.359624999999994 41.0 39.0 41.0 34.0 41.0 30-31 38.318875000000006 40.5 38.5 41.0 34.0 41.0 32-33 38.186875 40.0 38.0 41.0 34.0 41.0 34-35 38.050875 40.0 38.0 41.0 33.0 41.0 36-37 38.04075 40.0 38.0 41.0 33.0 41.0 38-39 37.9825 40.0 38.0 41.0 33.0 41.0 40-41 37.84725 40.0 38.0 41.0 33.0 41.0 42-43 37.747125 40.0 38.0 41.0 33.0 41.0 44-45 37.672875000000005 40.0 38.0 41.0 33.0 41.0 46-47 37.560125 40.0 38.0 41.0 32.0 41.0 48-49 37.51649999999999 40.0 38.0 41.0 32.0 41.0 50-51 37.346500000000006 40.0 37.0 41.0 31.5 41.0 52-53 37.16175 40.0 37.0 41.0 31.5 41.0 54-55 36.927875 40.0 37.0 41.0 31.0 41.0 56-57 36.75075 40.0 36.0 41.0 31.0 41.0 58-59 36.525375 39.0 36.0 41.0 30.5 41.0 60-61 36.3865 39.0 35.0 41.0 30.0 41.0 62-63 36.372749999999996 39.0 35.0 41.0 31.0 41.0 64-65 36.114625000000004 39.0 35.0 40.5 30.5 41.0 66-67 35.82725000000001 38.0 35.0 40.0 30.0 41.0 68-69 35.5195 37.5 35.0 40.0 30.0 41.0 70-71 34.725875 36.5 34.5 39.0 28.0 41.0 72-73 34.392375 36.0 34.0 39.0 28.0 40.0 74-75 33.786249999999995 35.5 33.5 38.0 27.5 39.5 76-77 32.16475 34.5 31.5 36.0 25.5 39.0 78-79 32.962625 35.0 33.0 37.0 27.5 39.0 80-81 32.808499999999995 35.0 33.0 36.0 26.0 37.5 82-83 32.671625 35.0 33.0 36.0 28.0 37.0 84-85 32.433875 35.0 33.0 35.5 26.5 37.0 86-87 32.109375 35.0 33.0 35.0 26.0 36.0 88-89 31.81575 35.0 33.0 35.0 26.0 36.0 90-91 31.762124999999997 35.0 33.0 35.0 26.0 36.0 92-93 31.490000000000002 35.0 32.5 35.0 25.0 35.0 94-95 31.21 35.0 32.0 35.0 24.0 35.0 96-97 30.95925 35.0 32.0 35.0 23.5 35.0 98-99 30.744500000000002 35.0 32.0 35.0 21.0 35.0 100-101 29.754625 34.0 30.5 34.5 10.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 29.0 3 11.0 4 10.0 5 5.0 6 4.0 7 6.0 8 1.0 9 6.0 10 4.0 11 4.0 12 9.0 13 8.0 14 9.0 15 1.0 16 5.0 17 11.0 18 6.0 19 9.0 20 15.0 21 17.0 22 8.0 23 20.0 24 22.0 25 27.0 26 17.0 27 28.0 28 37.0 29 39.0 30 51.0 31 61.0 32 95.0 33 99.0 34 150.0 35 221.0 36 464.0 37 873.0 38 1416.0 39 202.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.040163724737788 9.439754412893322 9.311844461499104 54.208237400869784 2 19.15 16.375 42.95 21.525 3 18.475 22.025 24.975 34.525 4 22.475 29.525000000000002 20.825 27.175 5 21.525 34.599999999999994 25.074999999999996 18.8 6 16.925 34.65 26.825 21.6 7 13.325000000000001 23.075000000000003 44.2 19.400000000000002 8 17.05 23.150000000000002 33.1 26.700000000000003 9 17.025000000000002 21.85 35.85 25.275 10-11 20.4 32.0625 24.8625 22.675 12-13 20.025000000000002 25.912499999999998 28.225 25.837500000000002 14-15 19.0875 27.9375 28.275 24.7 16-17 20.525 27.9125 27.575 23.9875 18-19 19.900000000000002 28.075 27.3375 24.6875 20-21 19.075 29.6875 26.8 24.4375 22-23 20.875 28.799999999999997 27.6875 22.6375 24-25 20.2625 28.212500000000002 28.025 23.5 26-27 19.650000000000002 28.212500000000002 28.225 23.9125 28-29 20.8125 29.2375 27.625 22.325 30-31 20.0625 28.287499999999998 26.887499999999996 24.762500000000003 32-33 20.4 27.962500000000002 28.0625 23.575 34-35 19.662499999999998 27.875 28.6375 23.825 36-37 19.287499999999998 28.812500000000004 27.650000000000002 24.25 38-39 19.6875 28.762500000000003 27.3625 24.1875 40-41 19.8625 27.962500000000002 28.0625 24.1125 42-43 19.55 28.1875 27.900000000000002 24.3625 44-45 19.9125 28.499999999999996 27.5875 24.0 46-47 19.9625 28.025 28.0875 23.925 48-49 19.5 27.8875 27.825 24.7875 50-51 19.45 28.325 28.762500000000003 23.4625 52-53 20.424999999999997 28.499999999999996 27.8625 23.2125 54-55 19.6875 29.1125 27.0625 24.1375 56-57 19.8875 28.237499999999997 28.0625 23.8125 58-59 19.8875 28.6625 27.537499999999998 23.9125 60-61 20.200000000000003 27.650000000000002 27.8875 24.2625 62-63 19.625 29.2 27.525 23.65 64-65 19.9625 28.375 27.5625 24.099999999999998 66-67 19.775000000000002 28.000000000000004 28.175 24.05 68-69 20.6375 27.487499999999997 27.987499999999997 23.8875 70-71 20.625 27.6875 27.487499999999997 24.2 72-73 20.474999999999998 27.875 28.625 23.025000000000002 74-75 21.1875 27.8625 27.712500000000002 23.2375 76-77 20.375 28.95 27.787499999999998 22.8875 78-79 20.4 28.499999999999996 27.6625 23.4375 80-81 20.825 28.3875 27.787499999999998 23.0 82-83 19.75 29.525000000000002 27.3375 23.3875 84-85 21.512500000000003 27.987499999999997 27.525 22.975 86-87 20.5625 29.062500000000004 27.1125 23.2625 88-89 20.325 29.262500000000003 27.075 23.3375 90-91 20.8125 28.8875 26.5625 23.7375 92-93 20.5 28.625 27.375 23.5 94-95 21.15 28.849999999999998 27.55 22.45 96-97 21.2875 28.749999999999996 26.375 23.5875 98-99 21.1875 28.599999999999998 27.5875 22.625 100-101 21.875 28.6125 25.924999999999997 23.5875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 1.0 23 1.5 24 1.5 25 2.0 26 3.0 27 6.5 28 7.5 29 8.5 30 18.0 31 28.0 32 28.5 33 33.5 34 44.5 35 60.0 36 83.0 37 114.0 38 139.5 39 163.0 40 202.5 41 223.5 42 241.0 43 270.5 44 273.0 45 261.0 46 263.0 47 250.0 48 235.5 49 215.5 50 173.0 51 154.5 52 129.5 53 92.0 54 71.0 55 55.5 56 43.0 57 29.5 58 16.0 59 11.0 60 9.0 61 6.0 62 7.0 63 7.5 64 6.0 65 3.5 66 1.0 67 1.5 68 1.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.275 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.16249999999999998 0.0 0.0 0.0 0.0 64-65 0.2 0.0 0.0 0.0 0.0 66-67 0.21250000000000002 0.0 0.0 0.0 0.0 68-69 0.32499999999999996 0.0 0.0 0.0 0.0 70-71 0.3875 0.0 0.0 0.0 0.0 72-73 0.48750000000000004 0.0 0.0 0.0 0.0 74-75 0.7125 0.0 0.0 0.0 0.0 76-77 0.875 0.0 0.0 0.0 0.0 78-79 1.1125 0.0 0.0 0.0 0.0 80-81 1.375 0.0 0.0 0.0 0.0 82-83 1.6375 0.0 0.0 0.0 0.0 84-85 1.925 0.0 0.0 0.0 0.0 86-87 2.3499999999999996 0.0 0.0 0.0 0.0 88-89 2.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864459 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864459_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2145 33.0 31.0 34.0 30.0 34.0 2 32.3625 34.0 31.0 34.0 30.0 34.0 3 32.22275 34.0 31.0 34.0 30.0 34.0 4 35.76825 37.0 35.0 37.0 35.0 37.0 5 35.7535 37.0 35.0 37.0 35.0 37.0 6 35.7065 37.0 37.0 37.0 35.0 37.0 7 35.75 37.0 37.0 37.0 35.0 37.0 8 35.59075 37.0 36.0 37.0 33.0 37.0 9 37.12075 39.0 37.0 39.0 34.0 39.0 10-11 37.326125000000005 39.0 38.0 39.0 34.0 39.0 12-13 37.297625 39.0 37.5 39.0 34.0 39.0 14-15 38.763875 41.0 39.0 41.0 34.0 41.0 16-17 38.699875 41.0 38.5 41.0 34.0 41.0 18-19 38.68 41.0 39.0 41.0 34.5 41.0 20-21 38.607124999999996 41.0 39.0 41.0 34.0 41.0 22-23 38.609875 41.0 39.0 41.0 34.0 41.0 24-25 38.353625 40.0 38.0 41.0 34.0 41.0 26-27 38.18325 40.0 38.0 41.0 33.0 41.0 28-29 38.12075 40.0 38.0 41.0 32.5 41.0 30-31 38.158 40.0 38.0 41.0 33.0 41.0 32-33 37.945750000000004 40.0 38.0 41.0 32.5 41.0 34-35 37.94625 40.0 38.0 41.0 33.0 41.0 36-37 37.870625000000004 40.0 38.0 41.0 33.0 41.0 38-39 37.670874999999995 40.0 38.0 41.0 32.0 41.0 40-41 37.71275 40.0 38.0 41.0 32.5 41.0 42-43 37.432625 40.0 37.5 41.0 31.0 41.0 44-45 37.667500000000004 40.0 38.0 41.0 32.0 41.0 46-47 37.342625 40.0 37.5 41.0 31.0 41.0 48-49 37.42725 40.0 37.5 41.0 31.5 41.0 50-51 36.601875 39.0 36.5 40.5 30.5 40.5 52-53 36.55825 39.0 36.5 40.0 30.5 41.0 54-55 36.73625 40.0 36.5 41.0 30.0 41.0 56-57 36.525125 39.5 36.5 41.0 29.0 41.0 58-59 36.352625 39.0 35.5 41.0 29.5 41.0 60-61 36.08525 39.0 35.0 41.0 29.0 41.0 62-63 35.89149999999999 38.5 35.0 40.0 29.0 41.0 64-65 35.4795 38.0 35.0 40.0 28.0 41.0 66-67 35.513000000000005 38.0 35.0 40.0 29.0 41.0 68-69 35.173375 37.0 35.0 39.5 28.5 41.0 70-71 34.571125 37.0 34.0 39.0 28.0 41.0 72-73 34.247249999999994 36.0 34.0 39.0 27.5 40.5 74-75 33.186375 35.0 33.5 37.0 25.0 39.0 76-77 33.332625 35.0 34.0 37.0 26.5 39.0 78-79 32.541624999999996 35.0 33.0 36.5 25.0 39.0 80-81 32.518249999999995 35.0 33.0 36.0 26.0 37.0 82-83 32.213125 35.0 33.0 36.0 25.5 37.0 84-85 32.088625 35.0 33.0 35.0 25.5 36.5 86-87 32.041875 35.0 33.0 35.0 26.0 36.0 88-89 31.73425 35.0 33.0 35.0 25.0 36.0 90-91 31.36725 35.0 32.5 35.0 24.5 36.0 92-93 31.247500000000002 35.0 32.0 35.0 24.5 35.0 94-95 31.054000000000002 35.0 32.0 35.0 23.0 35.0 96-97 30.705625 35.0 32.0 35.0 19.5 35.0 98-99 30.415375 35.0 32.0 35.0 15.5 35.0 100-101 29.250125 33.5 30.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 4.0 4 2.0 5 1.0 6 4.0 7 2.0 8 6.0 9 6.0 10 7.0 11 5.0 12 17.0 13 11.0 14 14.0 15 9.0 16 19.0 17 9.0 18 14.0 19 12.0 20 13.0 21 13.0 22 18.0 23 19.0 24 21.0 25 25.0 26 25.0 27 37.0 28 44.0 29 42.0 30 66.0 31 76.0 32 78.0 33 117.0 34 172.0 35 237.0 36 411.0 37 942.0 38 1267.0 39 221.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.725 16.575 13.525 42.175000000000004 2 21.925 24.275 38.25 15.55 3 19.525000000000002 28.425 28.125 23.925 4 22.825 35.275 21.475 20.424999999999997 5 24.575 36.15 22.525000000000002 16.75 6 20.125 36.975 24.224999999999998 18.675 7 20.599999999999998 17.299999999999997 41.099999999999994 21.0 8 19.825 23.35 31.025000000000002 25.8 9 21.175 22.55 32.35 23.925 10-11 23.8375 31.1875 23.9 21.075 12-13 24.099999999999998 25.074999999999996 27.900000000000002 22.925 14-15 22.9875 27.462500000000002 27.700000000000003 21.85 16-17 23.6625 28.962500000000002 26.05 21.325 18-19 23.0875 28.3375 27.700000000000003 20.875 20-21 23.4125 28.725 26.900000000000002 20.962500000000002 22-23 22.5875 28.349999999999998 27.775 21.2875 24-25 23.075000000000003 27.8125 28.225 20.8875 26-27 22.85 28.549999999999997 28.037499999999998 20.5625 28-29 23.2625 28.1 27.9125 20.724999999999998 30-31 22.662499999999998 28.249999999999996 28.375 20.7125 32-33 23.625 28.15 27.287499999999998 20.9375 34-35 23.3125 28.775000000000002 27.675 20.2375 36-37 23.925 27.375 28.3875 20.3125 38-39 23.2125 29.075 27.224999999999998 20.4875 40-41 23.5875 27.3625 28.1 20.95 42-43 22.400000000000002 28.0625 29.2 20.3375 44-45 23.200000000000003 27.712500000000002 28.349999999999998 20.7375 46-47 22.725 27.025 28.925 21.325 48-49 23.3125 27.800000000000004 28.262500000000003 20.625 50-51 22.45 28.1875 27.625 21.7375 52-53 23.5375 27.025 28.537499999999998 20.9 54-55 22.912499999999998 28.95 28.000000000000004 20.1375 56-57 23.2875 28.625 27.275 20.8125 58-59 23.5 28.4375 28.025 20.0375 60-61 23.1125 28.487499999999997 27.775 20.625 62-63 23.3125 28.1 27.900000000000002 20.6875 64-65 23.95 28.499999999999996 27.0875 20.4625 66-67 24.525 27.575 28.1375 19.7625 68-69 23.2375 28.325 28.1875 20.25 70-71 23.5625 28.425 27.675 20.3375 72-73 22.6875 28.375 28.9125 20.025000000000002 74-75 24.5625 27.237499999999997 28.1 20.1 76-77 23.7125 28.325 28.3625 19.6 78-79 23.799999999999997 27.525 28.050000000000004 20.625 80-81 23.674999999999997 28.487499999999997 27.650000000000002 20.1875 82-83 23.674999999999997 28.575 27.6625 20.0875 84-85 23.0875 28.65 28.1875 20.075000000000003 86-87 24.4875 28.65 26.974999999999998 19.8875 88-89 23.674999999999997 28.3375 28.012500000000003 19.975 90-91 24.4125 28.449999999999996 27.487499999999997 19.650000000000002 92-93 24.462500000000002 28.425 27.525 19.5875 94-95 24.425 28.175 27.212500000000002 20.1875 96-97 24.224999999999998 28.1375 27.375 20.2625 98-99 23.849999999999998 28.4375 26.937499999999996 20.775 100-101 25.374999999999996 28.012500000000003 26.6125 20.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.0 26 2.0 27 5.5 28 7.5 29 12.5 30 17.0 31 17.0 32 26.0 33 34.5 34 47.0 35 67.0 36 86.0 37 108.0 38 131.5 39 158.5 40 201.0 41 246.0 42 251.5 43 255.0 44 272.5 45 277.0 46 285.0 47 264.5 48 239.5 49 212.5 50 172.0 51 143.5 52 108.0 53 80.5 54 63.5 55 51.0 56 42.5 57 33.0 58 21.0 59 12.5 60 9.0 61 8.0 62 7.5 63 7.0 64 5.0 65 2.0 66 1.5 67 1.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92492492492492 99.825 2 0.050050050050050046 0.1 3 0.025025025025025023 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.16249999999999998 0.0 0.0 0.0 0.0 64-65 0.2 0.0 0.0 0.0 0.0 66-67 0.21250000000000002 0.0 0.0 0.0 0.0 68-69 0.32499999999999996 0.0 0.0 0.0 0.0 70-71 0.3875 0.0 0.0 0.0 0.0 72-73 0.48750000000000004 0.0 0.0 0.0 0.0 74-75 0.7 0.0 0.0 0.0 0.0 76-77 0.8500000000000001 0.0 0.0 0.0 0.0 78-79 1.0875 0.0 0.0 0.0 0.0 80-81 1.35 0.0 0.0 0.0 0.0 82-83 1.6125 0.0 0.0 0.0 0.0 84-85 1.9124999999999999 0.0 0.0 0.0 0.0 86-87 2.325 0.0 0.0 0.0 0.0 88-89 2.7125000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 826657 spots for ERR1864459.sra Written 826657 spots for ERR1864459.sra Read 826657 spots for ERR1864459.sra Written 826657 spots for ERR1864459.sra Read 826657 spots for ERR1864459.sra Written 826657 spots for ERR1864459.sra Read 826657 spots for ERR1864459.sra Written 826657 spots for ERR1864459.sra Read 826657 spots for ERR1864459.sra Written 826657 spots for ERR1864459.sra Read 826657 spots for ERR1864459.sra Written 826657 spots for ERR1864459.sra Read 826657 spots for ERR1864459.sra Written 826657 spots for ERR1864459.sra Read 826657 spots for ERR1864459.sra Written 826657 spots for ERR1864459.sra Read 826657 spots for ERR1864459.sra Written 826657 spots for ERR1864459.sra Read 826657 spots for ERR1864459.sra Written 826657 spots for ERR1864459.sra Read 826657 spots for ERR1864459.sra Written 826657 spots for ERR1864459.sra Read 826657 spots for ERR1864459.sra Written 826657 spots for ERR1864459.sra Read 826657 spots for ERR1864459.sra Written 826657 spots for ERR1864459.sra Read 826657 spots for ERR1864459.sra Written 826657 spots for ERR1864459.sra Read 826658 spots for ERR1864459.sra Written 826658 spots for ERR1864459.sra Read 826657 spots for ERR1864459.sra Written 826657 spots for ERR1864459.sra Read 826657 spots for ERR1864459.sra Written 826657 spots for ERR1864459.sra Read 826657 spots for ERR1864459.sra Written 826657 spots for ERR1864459.sra Read 826657 spots for ERR1864459.sra Written 826657 spots for ERR1864459.sra Read 826657 spots for ERR1864459.sra Written 826657 spots for ERR1864459.sra SRR ids: ['ERR1864459.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r92tny4x ERR1864459.sra spots: 16533141 blocks: [[1, 826657], [826658, 1653314], [1653315, 2479971], [2479972, 3306628], [3306629, 4133285], [4133286, 4959942], [4959943, 5786599], [5786600, 6613256], [6613257, 7439913], [7439914, 8266570], [8266571, 9093227], [9093228, 9919884], [9919885, 10746541], [10746542, 11573198], [11573199, 12399855], [12399856, 13226512], [13226513, 14053169], [14053170, 14879826], [14879827, 15706483], [15706484, 16533141]] ERR1864459 file size 3966274 ERR1864459 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864459 ERR1864459_1.fastq ERR1864459_2.fastq Input file: ERR1864459_1.fastq Paired file: ERR1864459_2.fastq trimmed: ERR1864459-trimmed-pair1.fastq, ERR1864459-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 12:11:42 2025 >> started Thu Feb 13 12:11:57 2025 >> done (14.634s) 16533141 read pairs processed; of these: 185773 ( 1.12%) short read pairs filtered out after trimming by size control 219964 ( 1.33%) empty read pairs filtered out after trimming by size control 16127404 (97.55%) read pairs available; of these: 4282418 (26.55%) trimmed read pairs available after processing 11844986 (73.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 94 0.00% 19 216 0.00% 20 317 0.00% 21 450 0.00% 22 532 0.00% 23 671 0.00% 24 829 0.01% 25 976 0.01% 26 1135 0.01% 27 1331 0.01% 28 1528 0.01% 29 1771 0.01% 30 2093 0.01% 31 2389 0.01% 32 2583 0.02% 33 2975 0.02% 34 3283 0.02% 35 3533 0.02% 36 3860 0.02% 37 4237 0.03% 38 4556 0.03% 39 4897 0.03% 40 5296 0.03% 41 5589 0.03% 42 5902 0.04% 43 6212 0.04% 44 6562 0.04% 45 7165 0.04% 46 7507 0.05% 47 7987 0.05% 48 8326 0.05% 49 8708 0.05% 50 9196 0.06% 51 9564 0.06% 52 10211 0.06% 53 10684 0.07% 54 11408 0.07% 55 11934 0.07% 56 12673 0.08% 57 13448 0.08% 58 14414 0.09% 59 17481 0.11% 60 20366 0.13% 61 20735 0.13% 62 21656 0.13% 63 22796 0.14% 64 23920 0.15% 65 24892 0.15% 66 25879 0.16% 67 27207 0.17% 68 28676 0.18% 69 30151 0.19% 70 31913 0.20% 71 33420 0.21% 72 35980 0.22% 73 38454 0.24% 74 39940 0.25% 75 41602 0.26% 76 42376 0.26% 77 44784 0.28% 78 47094 0.29% 79 49137 0.30% 80 51677 0.32% 81 54807 0.34% 82 58609 0.36% 83 62934 0.39% 84 67964 0.42% 85 73369 0.45% 86 77774 0.48% 87 84347 0.52% 88 85742 0.53% 89 90236 0.56% 90 99709 0.62% 91 109825 0.68% 92 119943 0.74% 93 132923 0.82% 94 149079 0.92% 95 170422 1.06% 96 196848 1.22% 97 238562 1.48% 98 308565 1.91% 99 417103 2.59% 100 746479 4.63% 101 11844986 73.45% 16127404 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=3.13 fanout-score-rank=23 prefix-density=0.27 prefix-fanout=2.4 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.08 sequence-density-rank=19 fanout-score=305.09 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=28.9 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=5.82 fanout-score-rank=14 prefix-density=0.21 prefix-fanout=5.6 sequence=TGCCTGAGAATGCTAA criterion=fanout-score sequence-density=0.09 sequence-density-rank=13 fanout-score=71.64 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=15.2 sequence=GAAGAAGAGAAG ERR1864459 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 12:12:28 Started mapping on | Feb 13 12:12:28 Finished on | Feb 13 12:13:20 Mapping speed, Million of reads per hour | 1116.51 Number of input reads | 16127404 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 15425706 Uniquely mapped reads % | 95.65% Average mapped length | 195.27 Number of splices: Total | 8987335 Number of splices: Annotated (sjdb) | 8773245 Number of splices: GT/AG | 8838909 Number of splices: GC/AG | 122728 Number of splices: AT/AC | 10116 Number of splices: Non-canonical | 15582 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.02% Deletion average length | 2.14 Insertion rate per base | 0.01% Insertion average length | 1.74 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 433205 % of reads mapped to multiple loci | 2.69% Number of reads mapped to too many loci | 41368 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.38% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 284989 284989 284989 N_multimapping 433205 433205 433205 N_noFeature 427894 15233890 551551 N_ambiguous 125800 981 56964 UnstrandedReadsAssigned:14872012 PositiveStrandReadsAssigned:190835 NegativeStrandReadsAssigned:14817191 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864459 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864459-trimmed-pair1.fastq ERR1864459-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,127,404 reads, 15,049,236 reads pseudoaligned [quant] estimated average fragment length: 152.214 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,074 rounds 52401 ERR1864459.ke.tsv 34699 ERR1864459.se.tsv 87100 total ==> ERR1864459.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1866.79 1692 66.7792 Potri.005G024800.1.v4.1 1035 883.786 1543 128.634 Potri.004G059700.1.v4.1 961 809.791 52 4.73114 Potri.007G009000.2.v4.1 1416 1264.79 0 0 Potri.003G141000.2.v4.1 2943 2791.79 948.544 25.0329 Potri.016G087400.1.v4.1 270 125.592 1248 732.128 Potri.015G069301.1.v4.1 564 412.917 0 0 Potri.010G195200.1.v4.1 1773 1621.79 150 6.81449 Potri.012G127500.1.v4.1 977 825.786 9554 852.419 ==> ERR1864459.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 187 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 304 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 55 ERR1864459 completed mapping pipeline successfully