Starting /dee2/code/volunteer_pipeline.sh ERR1864460 current disk space = 3091213193216 free memory = 1577282716 ERR1864460 SRAfilesize 222dceb0a3971be6c9ce574ee36dfda4 ERR1864460.sra ERR1864460.sra file validated ERR1864460 is paired end ERR1864460 is conventional basespace ERR1864460 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864460_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.806 34.0 31.0 34.0 30.0 34.0 2 32.201 34.0 31.0 34.0 30.0 34.0 3 32.47725 34.0 31.0 34.0 30.0 34.0 4 35.9235 37.0 37.0 37.0 35.0 37.0 5 35.61175 37.0 35.0 37.0 33.0 37.0 6 35.6915 37.0 35.0 37.0 35.0 37.0 7 35.7185 37.0 36.0 37.0 35.0 37.0 8 35.74925 37.0 37.0 37.0 35.0 37.0 9 37.477 39.0 38.0 39.0 35.0 39.0 10-11 37.34025 39.0 38.0 39.0 35.0 39.0 12-13 37.223749999999995 39.0 38.0 39.0 34.0 39.0 14-15 38.729875 41.0 39.0 41.0 34.5 41.0 16-17 38.68825 41.0 39.0 41.0 35.0 41.0 18-19 38.7385 41.0 39.0 41.0 35.0 41.0 20-21 38.661375 41.0 39.0 41.0 34.0 41.0 22-23 38.6025 41.0 39.0 41.0 34.0 41.0 24-25 38.4875 41.0 38.5 41.0 34.0 41.0 26-27 38.588750000000005 41.0 39.0 41.0 34.0 41.0 28-29 38.48075 41.0 39.0 41.0 34.0 41.0 30-31 38.378375000000005 41.0 38.0 41.0 34.0 41.0 32-33 38.317125 40.0 38.0 41.0 34.0 41.0 34-35 38.1605 40.0 38.0 41.0 33.5 41.0 36-37 38.17125 40.0 38.0 41.0 33.5 41.0 38-39 38.0535 40.0 38.0 41.0 33.0 41.0 40-41 37.984625 40.0 38.0 41.0 33.0 41.0 42-43 37.986875 40.0 38.0 41.0 33.0 41.0 44-45 37.819 40.0 38.0 41.0 33.0 41.0 46-47 37.629125 40.0 38.0 41.0 32.5 41.0 48-49 37.665375 40.0 38.0 41.0 32.5 41.0 50-51 37.471125 40.0 37.5 41.0 32.0 41.0 52-53 37.405249999999995 40.0 37.0 41.0 32.0 41.0 54-55 37.205749999999995 40.0 37.0 41.0 32.0 41.0 56-57 37.01325 40.0 36.5 41.0 31.0 41.0 58-59 36.7295 39.0 36.0 41.0 31.0 41.0 60-61 36.57875 39.0 36.0 41.0 30.5 41.0 62-63 36.639250000000004 39.0 36.0 41.0 31.0 41.0 64-65 36.268125 39.0 35.0 41.0 31.0 41.0 66-67 35.902875 38.0 35.0 40.0 30.0 41.0 68-69 35.575874999999996 37.5 35.0 40.0 30.0 41.0 70-71 34.8095 37.0 34.0 39.0 28.5 40.5 72-73 34.521874999999994 36.0 34.0 39.0 29.0 40.0 74-75 33.951750000000004 35.5 33.5 38.0 28.0 39.5 76-77 32.33075 34.5 31.5 36.0 26.0 39.0 78-79 33.097375 35.0 33.0 37.0 27.0 39.0 80-81 33.002250000000004 35.0 34.0 36.5 28.0 38.0 82-83 32.774 35.0 34.0 36.0 27.5 37.0 84-85 32.503 35.0 33.5 36.0 27.0 37.0 86-87 32.30525 35.0 33.0 35.0 27.0 36.5 88-89 32.024375 35.0 33.0 35.0 26.0 36.0 90-91 31.809625 35.0 33.0 35.0 26.0 36.0 92-93 31.603125 35.0 33.0 35.0 25.5 35.5 94-95 31.435125 35.0 33.0 35.0 25.0 35.0 96-97 31.25275 35.0 33.0 35.0 24.5 35.0 98-99 31.088124999999998 35.0 32.5 35.0 24.0 35.0 100-101 30.10025 34.0 30.5 35.0 20.5 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 7.0 4 8.0 5 5.0 6 2.0 7 3.0 8 6.0 9 5.0 10 7.0 11 3.0 12 5.0 13 7.0 14 10.0 15 10.0 16 13.0 17 8.0 18 10.0 19 11.0 20 12.0 21 12.0 22 16.0 23 9.0 24 15.0 25 18.0 26 21.0 27 32.0 28 37.0 29 38.0 30 52.0 31 64.0 32 79.0 33 130.0 34 125.0 35 248.0 36 365.0 37 920.0 38 1414.0 39 254.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.349068639959174 9.51773411584588 9.237050267925492 52.896146976269456 2 18.525 14.575 41.449999999999996 25.45 3 19.025 19.2 25.624999999999996 36.15 4 23.75 29.349999999999998 20.599999999999998 26.3 5 21.625 32.800000000000004 24.625 20.95 6 16.2 34.175 28.675 20.95 7 12.950000000000001 24.125 43.925 19.0 8 16.650000000000002 23.599999999999998 32.525 27.224999999999998 9 17.8 21.325 34.65 26.224999999999998 10-11 19.675 33.0625 24.25 23.0125 12-13 20.0625 26.450000000000003 27.650000000000002 25.837500000000002 14-15 19.162499999999998 28.0625 27.900000000000002 24.875 16-17 19.900000000000002 28.575 27.712500000000002 23.8125 18-19 19.412499999999998 27.55 27.737499999999997 25.3 20-21 19.7375 27.3375 29.1125 23.8125 22-23 20.0375 28.199999999999996 27.650000000000002 24.1125 24-25 19.2125 28.65 27.725 24.4125 26-27 19.425 28.075 28.8875 23.6125 28-29 19.6375 27.875 28.199999999999996 24.2875 30-31 19.537499999999998 27.2625 27.9125 25.2875 32-33 19.662499999999998 28.199999999999996 27.750000000000004 24.3875 34-35 18.875 28.675 28.487499999999997 23.962500000000002 36-37 19.6125 27.962500000000002 27.200000000000003 25.224999999999998 38-39 19.0 28.812500000000004 28.262500000000003 23.925 40-41 18.7 28.725 27.8625 24.712500000000002 42-43 19.162499999999998 28.299999999999997 28.712500000000002 23.825 44-45 20.7 27.962500000000002 28.375 22.9625 46-47 19.537499999999998 28.487499999999997 27.962500000000002 24.0125 48-49 19.9875 27.537499999999998 28.549999999999997 23.925 50-51 19.275000000000002 27.8375 28.5625 24.325 52-53 19.6375 27.125 28.8625 24.375 54-55 19.525000000000002 27.962500000000002 27.762500000000003 24.75 56-57 19.6 28.762500000000003 27.1625 24.474999999999998 58-59 19.925 28.1125 27.725 24.2375 60-61 19.6375 27.537499999999998 27.8625 24.962500000000002 62-63 19.4625 27.55 28.425 24.5625 64-65 20.5 27.400000000000002 28.1625 23.9375 66-67 19.35 28.075 28.0875 24.4875 68-69 19.625 28.237499999999997 27.737499999999997 24.4 70-71 20.225 28.475 26.724999999999998 24.575 72-73 20.65 28.349999999999998 27.650000000000002 23.35 74-75 20.225 27.650000000000002 27.925 24.2 76-77 20.025000000000002 27.825 28.225 23.925 78-79 20.1 27.55 28.425 23.925 80-81 20.0625 27.487499999999997 27.962500000000002 24.4875 82-83 21.099999999999998 27.8125 27.250000000000004 23.8375 84-85 19.5875 27.525 28.487499999999997 24.4 86-87 20.1375 27.037499999999998 28.6375 24.1875 88-89 20.5625 27.962500000000002 27.287499999999998 24.1875 90-91 20.200000000000003 27.975 27.462500000000002 24.3625 92-93 20.0625 28.012500000000003 27.6125 24.3125 94-95 21.175 28.449999999999996 27.0875 23.2875 96-97 19.3375 28.3375 28.199999999999996 24.125 98-99 20.75 27.487499999999997 27.5875 24.175 100-101 20.275000000000002 29.1375 27.125 23.4625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 3.0 25 3.0 26 1.5 27 1.5 28 6.5 29 13.5 30 17.0 31 19.0 32 23.0 33 29.5 34 44.5 35 70.5 36 83.5 37 103.0 38 139.0 39 161.5 40 187.5 41 223.5 42 249.0 43 275.0 44 284.0 45 267.5 46 263.5 47 252.0 48 222.5 49 198.5 50 178.5 51 157.0 52 123.5 53 94.5 54 72.0 55 60.5 56 50.0 57 27.5 58 16.0 59 13.0 60 11.0 61 8.0 62 9.0 63 8.5 64 8.0 65 7.0 66 2.5 67 2.0 68 2.0 69 1.5 70 1.0 71 1.0 72 1.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.1875 0.0 0.0 0.0 0.0 68-69 0.25 0.0 0.0 0.0 0.0 70-71 0.2875 0.0 0.0 0.0 0.0 72-73 0.4 0.0 0.0 0.0 0.0 74-75 0.5125 0.0 0.0 0.0 0.0 76-77 0.575 0.0 0.0 0.0 0.0 78-79 0.6625 0.0 0.0 0.0 0.0 80-81 0.75 0.0 0.0 0.0 0.0 82-83 0.825 0.0 0.0 0.0 0.0 84-85 0.9 0.0 0.0 0.0 0.0 86-87 1.2125 0.0 0.0 0.0 0.0 88-89 1.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864460 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864460_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.1695 33.0 31.0 34.0 30.0 34.0 2 32.25175 34.0 31.0 34.0 30.0 34.0 3 32.167 34.0 31.0 34.0 30.0 34.0 4 35.66475 37.0 35.0 37.0 33.0 37.0 5 35.6835 37.0 37.0 37.0 35.0 37.0 6 35.6755 37.0 36.0 37.0 33.0 37.0 7 35.73725 37.0 36.0 37.0 33.0 37.0 8 35.6105 37.0 35.0 37.0 33.0 37.0 9 37.14225 39.0 37.0 39.0 33.0 39.0 10-11 37.228125 39.0 37.5 39.0 33.5 39.0 12-13 37.171125 39.0 37.5 39.0 33.5 39.0 14-15 38.650999999999996 41.0 38.5 41.0 34.0 41.0 16-17 38.6055 41.0 38.0 41.0 33.5 41.0 18-19 38.65 41.0 39.0 41.0 34.5 41.0 20-21 38.537375 41.0 39.0 41.0 34.0 41.0 22-23 38.519999999999996 41.0 39.0 41.0 34.0 41.0 24-25 38.240375 40.0 38.0 41.0 33.0 41.0 26-27 38.025125 40.0 38.0 41.0 33.0 41.0 28-29 37.967375 40.0 38.0 41.0 33.0 41.0 30-31 37.992625000000004 40.0 38.0 41.0 33.0 41.0 32-33 37.768 40.0 38.0 41.0 32.0 41.0 34-35 37.682875 40.0 38.0 41.0 32.0 41.0 36-37 37.66875 40.0 38.0 41.0 32.0 41.0 38-39 37.599875 40.0 38.0 41.0 32.5 41.0 40-41 37.522875 40.0 38.0 41.0 31.0 41.0 42-43 37.278875 40.0 38.0 41.0 31.0 41.0 44-45 37.33 40.0 38.0 41.0 31.0 41.0 46-47 37.133875 40.0 37.0 41.0 30.5 41.0 48-49 37.175 40.0 37.0 41.0 31.0 41.0 50-51 36.307375 39.0 36.0 40.5 29.5 40.5 52-53 36.376875 39.0 36.0 40.0 30.0 41.0 54-55 36.52425 39.0 36.5 41.0 29.5 41.0 56-57 36.23325 39.0 35.5 41.0 28.5 41.0 58-59 36.087 39.0 35.0 41.0 28.5 41.0 60-61 35.7825 39.0 35.0 40.5 28.0 41.0 62-63 35.56675 38.0 35.0 40.0 28.0 41.0 64-65 35.189499999999995 38.0 34.5 40.0 27.5 41.0 66-67 35.19175 37.5 34.5 40.0 28.0 41.0 68-69 34.976875 37.0 35.0 39.5 28.0 41.0 70-71 34.28212499999999 36.5 34.0 39.0 26.0 41.0 72-73 33.954750000000004 36.0 34.0 39.0 26.5 40.5 74-75 32.87225 35.0 32.5 37.0 23.0 39.0 76-77 33.068749999999994 35.0 33.0 37.0 26.0 39.0 78-79 32.329875 35.0 33.0 36.5 24.5 39.0 80-81 32.310375 35.0 33.0 36.0 25.5 37.0 82-83 32.087125 35.0 33.0 36.0 25.5 37.0 84-85 31.86275 35.0 33.0 35.0 25.0 37.0 86-87 31.746625 35.0 33.0 35.0 25.0 36.0 88-89 31.470375 35.0 33.0 35.0 24.5 36.0 90-91 31.036749999999998 35.0 32.0 35.0 22.0 36.0 92-93 30.984875000000002 35.0 32.0 35.0 20.0 35.5 94-95 30.811374999999998 35.0 32.0 35.0 20.0 35.0 96-97 30.452624999999998 35.0 32.0 35.0 17.0 35.0 98-99 30.175375 35.0 31.5 35.0 6.5 35.0 100-101 28.953 33.5 30.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 4.0 4 3.0 5 4.0 6 8.0 7 9.0 8 9.0 9 9.0 10 5.0 11 7.0 12 9.0 13 11.0 14 7.0 15 11.0 16 17.0 17 14.0 18 18.0 19 12.0 20 13.0 21 18.0 22 16.0 23 19.0 24 23.0 25 35.0 26 27.0 27 38.0 28 43.0 29 58.0 30 49.0 31 70.0 32 91.0 33 136.0 34 173.0 35 265.0 36 435.0 37 857.0 38 1256.0 39 209.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.775000000000002 16.2 13.275 41.75 2 22.650000000000002 24.45 38.175 14.725 3 20.575 29.075 29.099999999999998 21.25 4 24.3 34.325 21.0 20.375 5 24.2 36.925000000000004 22.425 16.45 6 19.7 38.574999999999996 23.05 18.675 7 20.275000000000002 18.575 41.199999999999996 19.950000000000003 8 21.2 22.025 30.275000000000002 26.5 9 21.925 23.474999999999998 30.525000000000002 24.075 10-11 23.8875 31.412499999999998 23.5875 21.1125 12-13 24.125 24.9125 27.750000000000004 23.2125 14-15 22.775000000000002 28.175 28.349999999999998 20.7 16-17 23.5125 27.625 27.212500000000002 21.65 18-19 24.099999999999998 27.437499999999996 27.525 20.9375 20-21 24.0375 28.3125 27.275 20.375 22-23 23.175 28.725 27.4125 20.6875 24-25 23.2625 29.099999999999998 27.212500000000002 20.424999999999997 26-27 24.1875 28.3875 27.0125 20.4125 28-29 23.925 28.075 27.6625 20.3375 30-31 22.9625 27.962500000000002 28.249999999999996 20.825 32-33 24.1875 27.150000000000002 28.1875 20.474999999999998 34-35 24.325 28.249999999999996 27.725 19.7 36-37 23.724999999999998 28.575 27.2625 20.4375 38-39 23.7 28.212500000000002 27.1125 20.974999999999998 40-41 23.45 28.6125 27.474999999999998 20.4625 42-43 24.5125 27.5875 28.000000000000004 19.900000000000002 44-45 23.599999999999998 28.1 27.1375 21.1625 46-47 23.5 28.1125 28.075 20.3125 48-49 24.125 28.1125 27.375 20.3875 50-51 24.325 28.325 26.7125 20.6375 52-53 24.2625 28.0625 27.1 20.575 54-55 23.1 28.237499999999997 27.750000000000004 20.9125 56-57 23.5375 27.5875 28.3625 20.5125 58-59 24.224999999999998 27.775 27.575 20.424999999999997 60-61 24.6875 27.325 27.6875 20.3 62-63 23.8375 28.475 27.237499999999997 20.45 64-65 24.8 27.575 27.175 20.45 66-67 23.849999999999998 28.025 28.65 19.475 68-69 23.95898461923221 28.998374390396396 27.160185069401027 19.88245592097036 70-71 23.9 27.487499999999997 27.5125 21.099999999999998 72-73 23.575 27.875 28.050000000000004 20.5 74-75 23.5375 28.275 27.6375 20.549999999999997 76-77 24.4375 28.962500000000002 27.200000000000003 19.400000000000002 78-79 23.674999999999997 27.800000000000004 27.200000000000003 21.325 80-81 23.377922240280036 28.478559819977495 27.528441055131893 20.615076884610577 82-83 24.474999999999998 28.349999999999998 26.2125 20.962500000000002 84-85 24.2875 28.499999999999996 27.575 19.6375 86-87 23.865483185398176 28.716089511188898 27.665958244780597 19.75246905863233 88-89 24.75 28.225 27.175 19.85 90-91 24.0780097512189 28.54106763345418 26.8533566695837 20.527565945743216 92-93 24.9125 27.9375 27.55 19.6 94-95 25.387500000000003 28.449999999999996 26.75 19.412499999999998 96-97 24.73427535325747 28.23558834562961 26.785044391646867 20.24509190946605 98-99 24.975 28.7375 26.5125 19.775000000000002 100-101 25.5 28.4 26.75 19.35 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 1.5 27 3.0 28 4.0 29 10.0 30 15.5 31 14.5 32 19.0 33 30.5 34 38.0 35 53.0 36 77.5 37 99.5 38 131.0 39 158.5 40 189.5 41 214.5 42 250.5 43 307.5 44 316.0 45 293.0 46 277.0 47 237.0 48 215.5 49 218.0 50 175.5 51 139.0 52 113.0 53 85.5 54 70.5 55 52.5 56 39.5 57 28.0 58 21.5 59 18.5 60 16.0 61 18.0 62 13.0 63 6.5 64 5.0 65 6.0 66 6.0 67 3.0 68 1.0 69 1.5 70 1.5 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0375 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0125 82-83 0.0 84-85 0.0 86-87 0.0125 88-89 0.0 90-91 0.0125 92-93 0.0 94-95 0.0 96-97 0.0375 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.1875 0.0 0.0 0.0 0.0 68-69 0.25 0.0 0.0 0.0 0.0 70-71 0.2875 0.0 0.0 0.0 0.0 72-73 0.4 0.0 0.0 0.0 0.0 74-75 0.5125 0.0 0.0 0.0 0.0 76-77 0.575 0.0 0.0 0.0 0.0 78-79 0.6625 0.0 0.0 0.0 0.0 80-81 0.75 0.0 0.0 0.0 0.0 82-83 0.85 0.0 0.0 0.0 0.0 84-85 0.925 0.0 0.0 0.0 0.0 86-87 1.2374999999999998 0.0 0.0 0.0 0.0 88-89 1.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 794820 spots for ERR1864460.sra Written 794820 spots for ERR1864460.sra Read 794820 spots for ERR1864460.sra Written 794820 spots for ERR1864460.sra Read 794820 spots for ERR1864460.sra Written 794820 spots for ERR1864460.sra Read 794820 spots for ERR1864460.sra Written 794820 spots for ERR1864460.sra Read 794820 spots for ERR1864460.sra Written 794820 spots for ERR1864460.sra Read 794820 spots for ERR1864460.sra Written 794820 spots for ERR1864460.sra Read 794820 spots for ERR1864460.sra Written 794820 spots for ERR1864460.sra Read 794820 spots for ERR1864460.sra Written 794820 spots for ERR1864460.sra Read 794820 spots for ERR1864460.sra Written 794820 spots for ERR1864460.sra Read 794820 spots for ERR1864460.sra Written 794820 spots for ERR1864460.sra Read 794820 spots for ERR1864460.sra Written 794820 spots for ERR1864460.sra Read 794820 spots for ERR1864460.sra Written 794820 spots for ERR1864460.sra Read 794827 spots for ERR1864460.sra Written 794827 spots for ERR1864460.sra Read 794820 spots for ERR1864460.sra Written 794820 spots for ERR1864460.sra Read 794820 spots for ERR1864460.sra Written 794820 spots for ERR1864460.sra Read 794820 spots for ERR1864460.sra Written 794820 spots for ERR1864460.sra Read 794820 spots for ERR1864460.sra Written 794820 spots for ERR1864460.sra Read 794820 spots for ERR1864460.sra Written 794820 spots for ERR1864460.sra Read 794820 spots for ERR1864460.sra Written 794820 spots for ERR1864460.sra Read 794820 spots for ERR1864460.sra Written 794820 spots for ERR1864460.sra SRR ids: ['ERR1864460.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_te1b3qfj ERR1864460.sra spots: 15896407 blocks: [[1, 794820], [794821, 1589640], [1589641, 2384460], [2384461, 3179280], [3179281, 3974100], [3974101, 4768920], [4768921, 5563740], [5563741, 6358560], [6358561, 7153380], [7153381, 7948200], [7948201, 8743020], [8743021, 9537840], [9537841, 10332660], [10332661, 11127480], [11127481, 11922300], [11922301, 12717120], [12717121, 13511940], [13511941, 14306760], [14306761, 15101580], [15101581, 15896407]] ERR1864460 file size 3812686 ERR1864460 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864460 ERR1864460_1.fastq ERR1864460_2.fastq Input file: ERR1864460_1.fastq Paired file: ERR1864460_2.fastq trimmed: ERR1864460-trimmed-pair1.fastq, ERR1864460-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:13:11 2025 >> started Thu Feb 13 13:13:26 2025 >> done (14.618s) 15896407 read pairs processed; of these: 174369 ( 1.10%) short read pairs filtered out after trimming by size control 196104 ( 1.23%) empty read pairs filtered out after trimming by size control 15525934 (97.67%) read pairs available; of these: 3799312 (24.47%) trimmed read pairs available after processing 11726622 (75.53%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 108 0.00% 19 221 0.00% 20 307 0.00% 21 437 0.00% 22 579 0.00% 23 711 0.00% 24 859 0.01% 25 991 0.01% 26 1209 0.01% 27 1412 0.01% 28 1623 0.01% 29 1748 0.01% 30 2075 0.01% 31 2504 0.02% 32 2721 0.02% 33 3026 0.02% 34 3368 0.02% 35 3626 0.02% 36 3987 0.03% 37 4419 0.03% 38 4711 0.03% 39 4987 0.03% 40 5313 0.03% 41 5678 0.04% 42 5990 0.04% 43 6380 0.04% 44 6655 0.04% 45 7026 0.05% 46 7635 0.05% 47 7897 0.05% 48 8046 0.05% 49 8606 0.06% 50 9027 0.06% 51 9360 0.06% 52 9762 0.06% 53 10360 0.07% 54 10619 0.07% 55 11255 0.07% 56 11965 0.08% 57 12770 0.08% 58 13365 0.09% 59 16035 0.10% 60 18577 0.12% 61 19128 0.12% 62 19878 0.13% 63 20860 0.13% 64 21865 0.14% 65 22440 0.14% 66 23588 0.15% 67 24766 0.16% 68 25736 0.17% 69 26774 0.17% 70 28255 0.18% 71 29706 0.19% 72 31374 0.20% 73 33784 0.22% 74 34745 0.22% 75 36000 0.23% 76 35722 0.23% 77 37876 0.24% 78 39224 0.25% 79 40886 0.26% 80 42747 0.28% 81 44570 0.29% 82 47298 0.30% 83 50980 0.33% 84 54506 0.35% 85 59335 0.38% 86 62727 0.40% 87 67926 0.44% 88 69320 0.45% 89 72212 0.47% 90 80406 0.52% 91 88802 0.57% 92 98202 0.63% 93 110378 0.71% 94 125854 0.81% 95 144942 0.93% 96 172177 1.11% 97 212511 1.37% 98 281578 1.81% 99 390537 2.52% 100 721747 4.65% 101 11726622 75.53% 15525934 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=3.53 fanout-score-rank=20 prefix-density=0.29 prefix-fanout=3.5 sequence=TTAGCATTCTCAGGCA criterion=fanout-score sequence-density=0.10 sequence-density-rank=18 fanout-score=61.65 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=14.1 sequence=CTTCTCTTCTTC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=5.69 fanout-score-rank=15 prefix-density=0.38 prefix-fanout=5.6 sequence=TGCCTGAGAATGCTAA criterion=fanout-score sequence-density=0.10 sequence-density-rank=20 fanout-score=62.69 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=13.8 sequence=GAAGAAGAGAAG ERR1864460 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:14:03 Started mapping on | Feb 13 13:14:03 Finished on | Feb 13 13:14:47 Mapping speed, Million of reads per hour | 1270.30 Number of input reads | 15525934 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 14761703 Uniquely mapped reads % | 95.08% Average mapped length | 195.82 Number of splices: Total | 8226566 Number of splices: Annotated (sjdb) | 8022873 Number of splices: GT/AG | 8091931 Number of splices: GC/AG | 108846 Number of splices: AT/AC | 9772 Number of splices: Non-canonical | 16017 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 2.17 Insertion rate per base | 0.01% Insertion average length | 1.78 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 453373 % of reads mapped to multiple loci | 2.92% Number of reads mapped to too many loci | 43398 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.69% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 325200 325200 325200 N_multimapping 453373 453373 453373 N_noFeature 390187 14597111 488882 N_ambiguous 122031 918 55540 UnstrandedReadsAssigned:14249485 PositiveStrandReadsAssigned:163674 NegativeStrandReadsAssigned:14217281 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864460 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864460-trimmed-pair1.fastq ERR1864460-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,525,934 reads, 14,464,731 reads pseudoaligned [quant] estimated average fragment length: 163.214 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,053 rounds 52401 ERR1864460.ke.tsv 34699 ERR1864460.se.tsv 87100 total ==> ERR1864460.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1855.79 2193.57 86.2429 Potri.005G024800.1.v4.1 1035 872.786 2013 168.281 Potri.004G059700.1.v4.1 961 798.786 62 5.66318 Potri.007G009000.2.v4.1 1416 1253.79 0 0 Potri.003G141000.2.v4.1 2943 2780.79 886.289 23.2545 Potri.016G087400.1.v4.1 270 117.226 1292.68 804.579 Potri.015G069301.1.v4.1 564 401.936 0 0 Potri.010G195200.1.v4.1 1773 1610.79 93 4.21254 Potri.012G127500.1.v4.1 977 814.786 5149 461.082 ==> ERR1864460.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 144 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 261 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 93 ERR1864460 completed mapping pipeline successfully