Starting /dee2/code/volunteer_pipeline.sh ERR1864461 current disk space = 3091833761792 free memory = 1450157880 ERR1864461 SRAfilesize 9ab245367c74cdc65aeb12333ece7e10 ERR1864461.sra ERR1864461.sra file validated ERR1864461 is paired end ERR1864461 is conventional basespace ERR1864461 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864461_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.54925 34.0 31.0 34.0 30.0 34.0 2 32.088 34.0 31.0 34.0 30.0 34.0 3 32.38875 34.0 31.0 34.0 30.0 34.0 4 35.8245 37.0 37.0 37.0 35.0 37.0 5 35.508 37.0 35.0 37.0 33.0 37.0 6 35.551 37.0 35.0 37.0 33.0 37.0 7 35.62325 37.0 35.0 37.0 35.0 37.0 8 35.6055 37.0 36.0 37.0 35.0 37.0 9 37.32325 39.0 38.0 39.0 34.0 39.0 10-11 37.259 39.0 38.0 39.0 34.0 39.0 12-13 37.138125 39.0 37.5 39.0 33.5 39.0 14-15 38.681375 41.0 39.0 41.0 34.0 41.0 16-17 38.660624999999996 41.0 38.5 41.0 34.5 41.0 18-19 38.630250000000004 41.0 39.0 41.0 34.0 41.0 20-21 38.502250000000004 41.0 39.0 41.0 34.0 41.0 22-23 38.542375 41.0 39.0 41.0 34.0 41.0 24-25 38.39075 40.5 38.5 41.0 34.0 41.0 26-27 38.423125 41.0 38.0 41.0 34.0 41.0 28-29 38.376000000000005 41.0 38.0 41.0 34.0 41.0 30-31 38.3365 40.5 38.0 41.0 34.0 41.0 32-33 38.232749999999996 40.0 38.0 41.0 33.5 41.0 34-35 38.0775 40.0 38.0 41.0 33.0 41.0 36-37 38.04625 40.0 38.0 41.0 33.0 41.0 38-39 38.00175 40.0 38.0 41.0 33.0 41.0 40-41 37.868875 40.0 38.0 41.0 33.0 41.0 42-43 37.8095 40.0 38.0 41.0 33.0 41.0 44-45 37.653375 40.0 38.0 41.0 32.0 41.0 46-47 37.566374999999994 40.0 38.0 41.0 32.0 41.0 48-49 37.477625 40.0 37.5 41.0 32.0 41.0 50-51 37.337 40.0 37.0 41.0 31.5 41.0 52-53 37.164625 40.0 37.0 41.0 31.0 41.0 54-55 36.942750000000004 40.0 36.0 41.0 31.0 41.0 56-57 36.750875 39.5 36.0 41.0 31.0 41.0 58-59 36.440124999999995 39.0 36.0 41.0 30.0 41.0 60-61 36.306124999999994 39.0 35.0 41.0 29.5 41.0 62-63 36.309125 39.0 35.0 41.0 30.0 41.0 64-65 36.0955 38.5 35.0 40.5 30.0 41.0 66-67 35.785375 38.0 35.0 40.0 30.0 41.0 68-69 35.48125 37.0 35.0 40.0 29.5 41.0 70-71 34.755624999999995 36.5 34.0 39.0 28.5 41.0 72-73 34.387 36.0 34.0 39.0 28.5 40.0 74-75 33.76175 35.5 33.5 37.5 27.0 39.5 76-77 32.0845 34.0 31.5 36.0 25.5 38.5 78-79 32.88125 35.0 33.0 36.5 26.0 39.0 80-81 32.836 35.0 33.0 36.0 27.0 37.5 82-83 32.62875 35.0 33.0 36.0 27.0 37.0 84-85 32.33125 35.0 33.0 35.5 26.5 37.0 86-87 32.048 35.0 33.0 35.0 26.0 36.0 88-89 31.732374999999998 35.0 33.0 35.0 25.5 36.0 90-91 31.683 35.0 33.0 35.0 25.5 36.0 92-93 31.476875 35.0 33.0 35.0 25.0 35.5 94-95 31.262875 35.0 32.5 35.0 25.0 35.0 96-97 31.041375000000002 35.0 32.0 35.0 24.5 35.0 98-99 30.726625 34.0 32.0 35.0 21.5 35.0 100-101 29.689875 33.5 30.5 34.5 10.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 28.0 3 5.0 4 3.0 5 2.0 6 4.0 7 3.0 8 6.0 9 9.0 10 6.0 11 9.0 12 7.0 13 6.0 14 7.0 15 9.0 16 9.0 17 9.0 18 9.0 19 12.0 20 11.0 21 9.0 22 18.0 23 18.0 24 17.0 25 12.0 26 24.0 27 34.0 28 34.0 29 50.0 30 52.0 31 89.0 32 85.0 33 114.0 34 146.0 35 233.0 36 409.0 37 919.0 38 1350.0 39 233.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.745379876796715 10.035934291581109 9.137577002053387 54.08110882956879 2 19.625 15.2 40.375 24.8 3 20.549999999999997 18.575 25.525 35.35 4 23.799999999999997 27.55 21.475 27.175 5 22.900000000000002 31.624999999999996 24.95 20.525 6 17.25 34.8 25.974999999999998 21.975 7 13.475000000000001 24.975 42.65 18.9 8 17.65 23.075000000000003 33.575 25.7 9 16.05 23.35 36.625 23.974999999999998 10-11 19.25 33.6625 24.5375 22.55 12-13 19.475 26.025 29.562500000000004 24.9375 14-15 19.35 26.7625 29.3375 24.55 16-17 20.525 27.1125 27.700000000000003 24.6625 18-19 19.375 27.975 27.187499999999996 25.4625 20-21 19.1875 27.075 28.549999999999997 25.1875 22-23 18.85 28.725 28.262500000000003 24.1625 24-25 19.8375 28.625 27.0 24.5375 26-27 18.625 28.4125 28.8375 24.125 28-29 19.3375 28.075 28.375 24.212500000000002 30-31 20.349999999999998 27.750000000000004 27.962500000000002 23.9375 32-33 20.325 27.287499999999998 27.737499999999997 24.65 34-35 19.85 27.775 27.9125 24.462500000000002 36-37 19.5625 27.575 27.6875 25.174999999999997 38-39 19.8 28.512500000000003 27.950000000000003 23.7375 40-41 19.7375 28.125 27.962500000000002 24.175 42-43 19.9375 27.3875 27.962500000000002 24.712500000000002 44-45 20.225 27.975 28.812500000000004 22.9875 46-47 21.175 28.012500000000003 27.900000000000002 22.912499999999998 48-49 20.325 27.900000000000002 27.400000000000002 24.375 50-51 20.6375 28.325 27.9125 23.125 52-53 19.775000000000002 29.3375 27.700000000000003 23.1875 54-55 19.9625 27.325 27.55 25.162499999999998 56-57 19.6125 26.6125 29.15 24.625 58-59 20.25 27.55 27.6875 24.5125 60-61 19.45 27.737499999999997 28.849999999999998 23.962500000000002 62-63 20.875 27.1 27.437499999999996 24.587500000000002 64-65 20.325 27.0125 28.1875 24.474999999999998 66-67 19.825 27.875 27.55 24.75 68-69 20.625 28.375 26.8125 24.1875 70-71 20.5125 28.749999999999996 26.924999999999997 23.8125 72-73 20.674999999999997 28.050000000000004 27.6625 23.6125 74-75 19.900000000000002 26.1125 29.299999999999997 24.6875 76-77 20.375 27.3375 28.1875 24.099999999999998 78-79 20.175 26.950000000000003 28.1375 24.7375 80-81 20.525 28.050000000000004 27.825 23.599999999999998 82-83 21.025 28.1375 27.0875 23.75 84-85 20.150000000000002 27.462500000000002 28.125 24.2625 86-87 20.5875 28.237499999999997 27.762500000000003 23.4125 88-89 20.225 28.025 28.000000000000004 23.75 90-91 20.549999999999997 27.5125 27.55 24.3875 92-93 21.125 26.987499999999997 27.725 24.1625 94-95 20.7625 28.549999999999997 27.537499999999998 23.150000000000002 96-97 21.775 27.474999999999998 27.287499999999998 23.4625 98-99 21.712500000000002 27.3875 27.200000000000003 23.7 100-101 20.8625 28.825 26.625 23.6875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 1.5 25 1.0 26 2.5 27 6.0 28 9.0 29 9.0 30 14.5 31 24.0 32 24.5 33 38.0 34 55.5 35 60.5 36 77.5 37 95.0 38 117.0 39 154.0 40 181.5 41 203.5 42 233.5 43 255.0 44 276.5 45 279.0 46 263.0 47 260.5 48 248.0 49 224.0 50 190.0 51 147.5 52 124.5 53 105.5 54 76.0 55 48.0 56 33.0 57 34.5 58 26.0 59 22.5 60 23.5 61 14.5 62 9.0 63 6.0 64 7.5 65 7.5 66 2.0 67 0.5 68 1.5 69 1.5 70 0.5 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0125 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.1875 0.0 0.0 0.0 0.0 70-71 0.25 0.0 0.0 0.0 0.0 72-73 0.2625 0.0 0.0 0.0 0.0 74-75 0.3125 0.0 0.0 0.0 0.0 76-77 0.375 0.0 0.0 0.0 0.0 78-79 0.4625 0.0 0.0 0.0 0.0 80-81 0.6499999999999999 0.0 0.0 0.0 0.0 82-83 0.8125 0.0 0.0 0.0 0.0 84-85 1.0375 0.0 0.0 0.0 0.0 86-87 1.2000000000000002 0.0 0.0 0.0 0.0 88-89 1.6375000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864461 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864461_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2155 33.0 31.0 34.0 30.0 34.0 2 32.1735 34.0 31.0 34.0 30.0 34.0 3 32.1745 34.0 31.0 34.0 30.0 34.0 4 35.60925 37.0 35.0 37.0 33.0 37.0 5 35.58875 37.0 35.0 37.0 33.0 37.0 6 35.55225 37.0 35.0 37.0 33.0 37.0 7 35.63625 37.0 36.0 37.0 33.0 37.0 8 35.5705 37.0 35.0 37.0 33.0 37.0 9 37.09625 39.0 37.0 39.0 33.0 39.0 10-11 37.258875 39.0 37.5 39.0 34.0 39.0 12-13 37.18 39.0 37.5 39.0 33.5 39.0 14-15 38.612625 41.0 38.5 41.0 34.0 41.0 16-17 38.5535 41.0 38.0 41.0 33.5 41.0 18-19 38.61425 41.0 38.5 41.0 34.0 41.0 20-21 38.5775 41.0 39.0 41.0 34.0 41.0 22-23 38.589749999999995 41.0 39.0 41.0 34.0 41.0 24-25 38.200874999999996 40.0 38.0 41.0 33.0 41.0 26-27 38.16075 40.0 38.0 41.0 33.0 41.0 28-29 38.058125000000004 40.0 38.0 41.0 33.0 41.0 30-31 38.0645 40.0 38.0 41.0 33.0 41.0 32-33 37.855625 40.0 38.0 41.0 32.5 41.0 34-35 37.774375000000006 40.0 38.0 41.0 32.5 41.0 36-37 37.710625 40.0 38.0 41.0 32.5 41.0 38-39 37.595875 40.0 38.0 41.0 31.0 41.0 40-41 37.573 40.0 37.5 41.0 31.5 41.0 42-43 37.3475 40.0 37.0 41.0 31.0 41.0 44-45 37.4075 40.0 37.5 41.0 31.0 41.0 46-47 37.269999999999996 40.0 37.0 41.0 31.5 41.0 48-49 37.257000000000005 40.0 37.0 41.0 31.0 41.0 50-51 36.29975 39.0 36.0 40.5 30.0 40.5 52-53 36.38775 39.0 36.0 40.0 30.0 41.0 54-55 36.515874999999994 39.0 36.0 41.0 29.5 41.0 56-57 36.302625 39.0 35.5 41.0 28.5 41.0 58-59 36.109875 39.0 35.0 41.0 28.0 41.0 60-61 35.881125 38.5 35.0 40.5 28.0 41.0 62-63 35.66825 38.0 35.0 40.0 28.5 41.0 64-65 35.29075 37.5 34.5 40.0 28.0 41.0 66-67 35.350875 37.0 35.0 40.0 28.0 41.0 68-69 34.940875 37.0 34.5 39.5 28.0 41.0 70-71 34.339375000000004 36.0 34.0 39.0 28.0 41.0 72-73 34.059 36.0 34.0 39.0 27.0 40.5 74-75 33.02125 35.0 33.0 37.0 25.0 39.0 76-77 33.164375 35.0 33.0 37.0 26.0 39.0 78-79 32.345125 35.0 33.0 36.5 25.0 38.5 80-81 32.296875 35.0 33.0 36.0 25.0 37.0 82-83 32.115624999999994 35.0 33.0 36.0 25.5 37.0 84-85 31.966875 35.0 33.0 35.0 25.0 36.5 86-87 31.814125 35.0 33.0 35.0 25.5 36.0 88-89 31.560375 35.0 33.0 35.0 25.0 36.0 90-91 31.21 35.0 32.0 35.0 24.0 36.0 92-93 31.172625 35.0 32.0 35.0 23.5 35.0 94-95 31.021625 35.0 32.0 35.0 23.5 35.0 96-97 30.674374999999998 35.0 32.0 35.0 20.0 35.0 98-99 30.326375 34.5 31.5 35.0 18.0 35.0 100-101 29.000375 33.5 29.5 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 2.0 4 4.0 5 3.0 6 4.0 7 4.0 8 8.0 9 5.0 10 4.0 11 12.0 12 16.0 13 5.0 14 8.0 15 11.0 16 16.0 17 14.0 18 12.0 19 11.0 20 10.0 21 19.0 22 15.0 23 21.0 24 20.0 25 36.0 26 38.0 27 39.0 28 37.0 29 41.0 30 53.0 31 88.0 32 107.0 33 116.0 34 200.0 35 282.0 36 421.0 37 947.0 38 1180.0 39 179.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.799999999999997 16.075 13.450000000000001 41.675000000000004 2 23.724999999999998 24.175 37.325 14.774999999999999 3 19.75 28.125 29.375 22.75 4 24.8 33.7 21.85 19.650000000000002 5 25.900000000000002 35.175 22.400000000000002 16.525000000000002 6 20.8 38.05 23.1 18.05 7 20.4 18.55 40.75 20.3 8 20.625 23.0 30.349999999999998 26.025 9 21.675 23.925 30.875000000000004 23.525 10-11 23.4875 32.5625 23.6625 20.2875 12-13 23.775 25.337500000000002 28.4 22.4875 14-15 22.15 28.125 28.525 21.2 16-17 23.325000000000003 28.262500000000003 27.125 21.2875 18-19 23.962500000000002 28.050000000000004 27.05 20.9375 20-21 24.8625 27.975 27.2625 19.900000000000002 22-23 23.0 28.5875 27.487499999999997 20.925 24-25 23.0875 28.175 27.975 20.7625 26-27 23.3375 28.125 27.6875 20.849999999999998 28-29 23.175 27.625 27.6625 21.5375 30-31 23.2125 28.1625 27.1375 21.4875 32-33 23.6875 27.950000000000003 27.750000000000004 20.6125 34-35 23.95 27.500000000000004 26.8 21.75 36-37 23.724999999999998 27.5875 27.675 21.0125 38-39 23.4875 28.625 26.6 21.2875 40-41 23.9125 28.000000000000004 27.712500000000002 20.375 42-43 23.2125 28.325 27.425 21.0375 44-45 24.474999999999998 27.537499999999998 27.3375 20.65 46-47 23.7375 27.3125 27.825 21.125 48-49 23.825 28.15 27.500000000000004 20.525 50-51 23.8375 27.625 28.3625 20.175 52-53 24.325 27.5125 27.212500000000002 20.95 54-55 23.7125 28.499999999999996 27.787499999999998 20.0 56-57 23.9 27.625 27.6375 20.837500000000002 58-59 23.0625 28.075 28.225 20.6375 60-61 24.349999999999998 28.0625 27.474999999999998 20.1125 62-63 24.85 27.5875 26.3125 21.25 64-65 25.0625 27.737499999999997 26.575 20.625 66-67 23.8375 28.525 27.450000000000003 20.1875 68-69 24.1780222527816 27.778472309038634 27.15339417427178 20.890111263907986 70-71 24.3625 27.0 27.237499999999997 21.4 72-73 23.625 28.4375 26.8125 21.125 74-75 23.674999999999997 27.6 28.175 20.549999999999997 76-77 24.5 28.0625 27.025 20.4125 78-79 23.9 28.787499999999998 27.5625 19.75 80-81 24.2625 26.900000000000002 28.1625 20.674999999999997 82-83 24.625 27.725 27.625 20.025000000000002 84-85 23.45 28.925 27.55 20.075000000000003 86-87 24.4125 28.9875 27.224999999999998 19.375 88-89 24.525 28.225 27.1375 20.1125 90-91 23.9375 27.650000000000002 27.200000000000003 21.212500000000002 92-93 23.9 28.462500000000002 27.474999999999998 20.1625 94-95 24.3 28.8625 26.55 20.2875 96-97 24.553069133641706 28.34104263032879 27.415926990873857 19.689961245155644 98-99 25.85 27.5125 27.025 19.6125 100-101 25.650000000000002 28.7375 26.05 19.5625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 1.5 26 2.5 27 5.5 28 8.0 29 9.5 30 16.5 31 20.0 32 19.0 33 28.5 34 42.5 35 50.5 36 66.0 37 91.0 38 122.0 39 155.5 40 190.5 41 226.0 42 251.5 43 274.0 44 292.5 45 285.5 46 256.0 47 239.0 48 232.5 49 214.0 50 191.0 51 164.0 52 121.5 53 88.5 54 74.5 55 62.5 56 45.5 57 29.0 58 22.5 59 22.5 60 18.5 61 15.5 62 13.0 63 6.5 64 4.0 65 4.0 66 3.0 67 2.0 68 1.0 69 1.5 70 1.5 71 0.5 72 0.5 73 1.0 74 1.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0125 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0125 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0125 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.0875 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.21250000000000002 0.0 0.0 0.0 0.0 70-71 0.275 0.0 0.0 0.0 0.0 72-73 0.2875 0.0 0.0 0.0 0.0 74-75 0.35 0.0 0.0 0.0 0.0 76-77 0.425 0.0 0.0 0.0 0.0 78-79 0.5 0.0 0.0 0.0 0.0 80-81 0.675 0.0 0.0 0.0 0.0 82-83 0.8375 0.0 0.0 0.0 0.0 84-85 1.0625 0.0 0.0 0.0 0.0 86-87 1.25 0.0 0.0 0.0 0.0 88-89 1.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 946856 spots for ERR1864461.sra Written 946856 spots for ERR1864461.sra Read 946856 spots for ERR1864461.sra Written 946856 spots for ERR1864461.sra Read 946856 spots for ERR1864461.sra Written 946856 spots for ERR1864461.sra Read 946856 spots for ERR1864461.sra Written 946856 spots for ERR1864461.sra Read 946856 spots for ERR1864461.sra Written 946856 spots for ERR1864461.sra Read 946856 spots for ERR1864461.sra Written 946856 spots for ERR1864461.sra Read 946856 spots for ERR1864461.sra Written 946856 spots for ERR1864461.sra Read 946856 spots for ERR1864461.sra Written 946856 spots for ERR1864461.sra Read 946856 spots for ERR1864461.sra Written 946856 spots for ERR1864461.sra Read 946856 spots for ERR1864461.sra Written 946856 spots for ERR1864461.sra Read 946856 spots for ERR1864461.sra Written 946856 spots for ERR1864461.sra Read 946856 spots for ERR1864461.sra Written 946856 spots for ERR1864461.sra Read 946856 spots for ERR1864461.sra Written 946856 spots for ERR1864461.sra Read 946856 spots for ERR1864461.sra Written 946856 spots for ERR1864461.sra Read 946856 spots for ERR1864461.sra Written 946856 spots for ERR1864461.sra Read 946856 spots for ERR1864461.sra Written 946856 spots for ERR1864461.sra Read 946856 spots for ERR1864461.sra Written 946856 spots for ERR1864461.sra Read 946856 spots for ERR1864461.sra Written 946856 spots for ERR1864461.sra Read 946856 spots for ERR1864461.sra Written 946856 spots for ERR1864461.sra Read 946860 spots for ERR1864461.sra Written 946860 spots for ERR1864461.sra SRR ids: ['ERR1864461.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zyueu55r ERR1864461.sra spots: 18937124 blocks: [[1, 946856], [946857, 1893712], [1893713, 2840568], [2840569, 3787424], [3787425, 4734280], [4734281, 5681136], [5681137, 6627992], [6627993, 7574848], [7574849, 8521704], [8521705, 9468560], [9468561, 10415416], [10415417, 11362272], [11362273, 12309128], [12309129, 13255984], [13255985, 14202840], [14202841, 15149696], [15149697, 16096552], [16096553, 17043408], [17043409, 17990264], [17990265, 18937124]] ERR1864461 file size 4546141 ERR1864461 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864461 ERR1864461_1.fastq ERR1864461_2.fastq Input file: ERR1864461_1.fastq Paired file: ERR1864461_2.fastq trimmed: ERR1864461-trimmed-pair1.fastq, ERR1864461-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 12:40:17 2025 >> started Thu Feb 13 12:40:33 2025 >> done (16.671s) 18937124 read pairs processed; of these: 226363 ( 1.20%) short read pairs filtered out after trimming by size control 266568 ( 1.41%) empty read pairs filtered out after trimming by size control 18444193 (97.40%) read pairs available; of these: 4596925 (24.92%) trimmed read pairs available after processing 13847268 (75.08%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 132 0.00% 19 263 0.00% 20 417 0.00% 21 610 0.00% 22 764 0.00% 23 913 0.00% 24 1085 0.01% 25 1343 0.01% 26 1576 0.01% 27 1826 0.01% 28 2165 0.01% 29 2374 0.01% 30 2782 0.02% 31 3062 0.02% 32 3519 0.02% 33 3926 0.02% 34 4172 0.02% 35 4698 0.03% 36 5042 0.03% 37 5462 0.03% 38 5944 0.03% 39 6107 0.03% 40 6583 0.04% 41 7033 0.04% 42 7377 0.04% 43 8017 0.04% 44 8363 0.05% 45 8472 0.05% 46 9261 0.05% 47 9704 0.05% 48 10105 0.05% 49 10509 0.06% 50 11104 0.06% 51 11543 0.06% 52 12060 0.07% 53 12769 0.07% 54 13213 0.07% 55 13942 0.08% 56 14639 0.08% 57 15452 0.08% 58 16306 0.09% 59 19598 0.11% 60 22826 0.12% 61 23280 0.13% 62 24032 0.13% 63 25177 0.14% 64 26179 0.14% 65 27084 0.15% 66 28232 0.15% 67 29976 0.16% 68 31090 0.17% 69 32654 0.18% 70 33960 0.18% 71 35930 0.19% 72 37957 0.21% 73 40339 0.22% 74 41983 0.23% 75 43254 0.23% 76 43188 0.23% 77 45729 0.25% 78 47474 0.26% 79 49280 0.27% 80 51601 0.28% 81 54211 0.29% 82 58245 0.32% 83 62112 0.34% 84 66899 0.36% 85 72442 0.39% 86 77204 0.42% 87 83247 0.45% 88 84229 0.46% 89 88898 0.48% 90 98503 0.53% 91 108838 0.59% 92 120323 0.65% 93 135167 0.73% 94 153534 0.83% 95 175913 0.95% 96 208516 1.13% 97 255958 1.39% 98 338364 1.83% 99 466289 2.53% 100 862576 4.68% 101 13847268 75.08% 18444193 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=3.47 fanout-score-rank=21 prefix-density=0.30 prefix-fanout=3.4 sequence=TTAGCATTCTCAGGCA criterion=fanout-score sequence-density=0.15 sequence-density-rank=9 fanout-score=43.57 fanout-score-rank=1 prefix-density=0.62 prefix-fanout=10.7 sequence=TCATCTTCAATCT criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=5.93 fanout-score-rank=11 prefix-density=0.44 prefix-fanout=5.8 sequence=TGCCTGAGAATGCTAA criterion=fanout-score sequence-density=0.11 sequence-density-rank=16 fanout-score=17.40 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=5.5 sequence=GTGGAGAAGGAAGACAAGAACGATACTTGGCATCGCGTGGAGAGGAGCAGTGGCAAATTCTCGAGGAGGTTTA ERR1864461 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 12:41:07 Started mapping on | Feb 13 12:41:07 Finished on | Feb 13 12:42:07 Mapping speed, Million of reads per hour | 1106.65 Number of input reads | 18444193 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 17378831 Uniquely mapped reads % | 94.22% Average mapped length | 195.69 Number of splices: Total | 9608173 Number of splices: Annotated (sjdb) | 9363574 Number of splices: GT/AG | 9450199 Number of splices: GC/AG | 127363 Number of splices: AT/AC | 11461 Number of splices: Non-canonical | 19150 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 2.17 Insertion rate per base | 0.01% Insertion average length | 1.84 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 576152 % of reads mapped to multiple loci | 3.12% Number of reads mapped to too many loci | 214408 % of reads mapped to too many loci | 1.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.39% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 506976 506976 506976 N_multimapping 576152 576152 576152 N_noFeature 484196 17195112 591285 N_ambiguous 144398 1096 67014 UnstrandedReadsAssigned:16750237 PositiveStrandReadsAssigned:182623 NegativeStrandReadsAssigned:16720532 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864461 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864461-trimmed-pair1.fastq ERR1864461-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,444,193 reads, 17,125,450 reads pseudoaligned [quant] estimated average fragment length: 160.607 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,257 rounds 52401 ERR1864461.ke.tsv 34699 ERR1864461.se.tsv 87100 total ==> ERR1864461.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1858.39 2897 94.7014 Potri.005G024800.1.v4.1 1035 875.393 3683 255.59 Potri.004G059700.1.v4.1 961 801.405 79 5.98854 Potri.007G009000.2.v4.1 1416 1256.39 0 0 Potri.003G141000.2.v4.1 2943 2783.39 1006.29 21.9632 Potri.016G087400.1.v4.1 270 118.614 1535 786.173 Potri.015G069301.1.v4.1 564 404.556 0 0 Potri.010G195200.1.v4.1 1773 1613.39 117 4.40546 Potri.012G127500.1.v4.1 977 817.405 5969 443.619 ==> ERR1864461.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 147 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 278 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 91 ERR1864461 completed mapping pipeline successfully