Starting /dee2/code/volunteer_pipeline.sh ERR1864462 current disk space = 3091174739968 free memory = 1582051724 ERR1864462 SRAfilesize 95375560b4886a9ef6a00a53d4da942a ERR1864462.sra ERR1864462.sra file validated ERR1864462 is paired end ERR1864462 is conventional basespace ERR1864462 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864462_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.411 33.0 31.0 34.0 30.0 34.0 2 31.91275 34.0 31.0 34.0 30.0 34.0 3 32.0535 34.0 31.0 34.0 29.0 34.0 4 35.62075 37.0 35.0 37.0 33.0 37.0 5 35.3285 37.0 35.0 37.0 33.0 37.0 6 35.3055 37.0 35.0 37.0 33.0 37.0 7 35.23425 37.0 35.0 37.0 32.0 37.0 8 35.20925 37.0 35.0 37.0 33.0 37.0 9 36.83 39.0 37.0 39.0 33.0 39.0 10-11 36.836124999999996 39.0 37.0 39.0 33.0 39.0 12-13 36.594375 39.0 37.0 39.0 32.0 39.0 14-15 37.981875 40.0 38.0 41.0 32.5 41.0 16-17 37.923375 40.0 38.0 41.0 33.0 41.0 18-19 37.832375 40.0 38.0 41.0 33.0 41.0 20-21 37.808 40.0 38.0 41.0 32.0 41.0 22-23 37.701125000000005 40.0 38.0 41.0 32.0 41.0 24-25 37.628 40.0 38.0 41.0 32.0 41.0 26-27 37.42975 40.0 38.0 41.0 32.0 41.0 28-29 37.28375 40.0 37.5 41.0 31.5 41.0 30-31 37.047250000000005 40.0 37.5 41.0 30.5 41.0 32-33 36.94625 40.0 37.0 41.0 31.0 41.0 34-35 36.78675 40.0 37.0 41.0 30.0 41.0 36-37 36.804625 40.0 37.0 41.0 30.0 41.0 38-39 36.659125 40.0 37.0 41.0 30.0 41.0 40-41 36.562375 40.0 36.5 41.0 30.0 41.0 42-43 36.511875 40.0 36.5 41.0 30.0 41.0 44-45 36.360125 40.0 36.0 41.0 30.0 41.0 46-47 36.150000000000006 39.0 35.5 41.0 28.5 41.0 48-49 36.347125000000005 40.0 36.0 41.0 30.0 41.0 50-51 36.312250000000006 40.0 36.0 41.0 29.0 41.0 52-53 36.235125 40.0 36.0 41.0 29.0 41.0 54-55 35.882000000000005 39.0 35.5 41.0 28.0 41.0 56-57 35.724625 39.0 35.0 41.0 28.0 41.0 58-59 35.481625 39.0 35.0 41.0 27.5 41.0 60-61 35.155375 39.0 34.5 41.0 26.5 41.0 62-63 34.831375 38.0 34.0 40.0 26.0 41.0 64-65 34.4895 38.0 34.0 40.0 26.0 41.0 66-67 34.03275 37.0 34.0 40.0 25.0 41.0 68-69 33.65775 36.5 33.0 39.0 24.0 41.0 70-71 33.18825 36.0 33.0 39.0 23.5 40.5 72-73 32.761375 35.5 32.5 38.5 22.0 40.0 74-75 32.418375 35.0 32.0 37.0 22.0 39.5 76-77 31.4045 34.5 30.5 36.0 22.0 39.0 78-79 31.667749999999998 35.0 32.0 36.0 21.0 39.0 80-81 31.544625 35.0 32.0 36.0 22.0 37.0 82-83 31.17425 35.0 32.0 36.0 20.0 37.0 84-85 30.8175 35.0 31.5 35.0 18.0 36.5 86-87 30.534375 35.0 31.0 35.0 17.0 36.0 88-89 30.370375 34.5 31.0 35.0 17.5 36.0 90-91 30.217375 34.0 31.0 35.0 11.5 35.5 92-93 29.847375 34.0 31.0 35.0 3.5 35.0 94-95 29.407125 34.0 30.0 35.0 2.0 35.0 96-97 29.11575 34.0 30.0 35.0 2.0 35.0 98-99 28.790750000000003 34.0 30.0 35.0 2.0 35.0 100-101 27.59575 33.0 27.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 37.0 3 16.0 4 9.0 5 10.0 6 6.0 7 6.0 8 12.0 9 11.0 10 10.0 11 12.0 12 12.0 13 10.0 14 17.0 15 16.0 16 10.0 17 11.0 18 18.0 19 13.0 20 13.0 21 12.0 22 20.0 23 25.0 24 24.0 25 30.0 26 44.0 27 36.0 28 47.0 29 66.0 30 79.0 31 80.0 32 117.0 33 129.0 34 203.0 35 271.0 36 493.0 37 868.0 38 1057.0 39 150.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.48330359418812 5.837369360183533 4.817741524343615 40.86158552128473 2 28.025 5.775 31.624999999999996 34.575 3 25.6 7.75 22.15 44.5 4 29.825000000000003 14.524999999999999 20.424999999999997 35.225 5 28.9 19.175 25.05 26.875 6 25.724999999999998 24.45 23.95 25.874999999999996 7 19.825 23.375 40.050000000000004 16.75 8 18.025 22.8 36.85 22.325 9 19.125 23.225 37.375 20.275000000000002 10-11 19.7625 32.0625 28.95 19.225 12-13 21.2625 26.625 31.087500000000002 21.025 14-15 21.6 27.35 30.412499999999998 20.6375 16-17 22.287499999999998 27.200000000000003 28.8375 21.675 18-19 21.712500000000002 27.450000000000003 28.4125 22.425 20-21 20.95 28.199999999999996 28.1 22.75 22-23 20.925 28.3375 28.8625 21.875 24-25 21.275 26.9125 28.499999999999996 23.3125 26-27 20.95 28.6125 28.3375 22.1 28-29 22.162499999999998 26.9125 27.9375 22.9875 30-31 21.775 27.500000000000004 27.787499999999998 22.9375 32-33 20.9125 27.3625 28.3625 23.3625 34-35 21.725 27.875 27.437499999999996 22.9625 36-37 21.725 27.525 28.125 22.625 38-39 20.849999999999998 27.8375 28.3375 22.975 40-41 21.5 28.3875 27.525 22.5875 42-43 21.8625 26.650000000000002 28.675 22.8125 44-45 20.837500000000002 28.487499999999997 28.050000000000004 22.625 46-47 21.325 28.0875 27.425 23.1625 48-49 21.4875 27.487499999999997 28.15 22.875 50-51 21.15 27.5875 28.275 22.9875 52-53 21.7875 28.625 27.0125 22.575 54-55 21.0125 28.925 28.125 21.9375 56-57 20.974999999999998 28.025 28.725 22.275 58-59 21.0125 28.1875 28.237499999999997 22.5625 60-61 21.0375 27.762500000000003 28.1875 23.0125 62-63 21.5 27.0625 27.5125 23.925 64-65 21.337500000000002 27.950000000000003 28.175 22.537499999999998 66-67 21.575 28.287499999999998 28.1 22.037499999999998 68-69 21.6125 27.737499999999997 27.800000000000004 22.85 70-71 22.2125 26.937499999999996 28.075 22.775000000000002 72-73 21.6125 28.3625 27.575 22.45 74-75 20.974999999999998 27.8375 27.625 23.5625 76-77 22.375 27.700000000000003 27.0875 22.8375 78-79 22.15 28.0625 28.1875 21.6 80-81 21.2 28.712500000000002 27.0625 23.025000000000002 82-83 21.3125 28.512500000000003 27.762500000000003 22.412499999999998 84-85 22.525000000000002 26.424999999999997 28.6375 22.412499999999998 86-87 20.6875 28.375 27.8375 23.1 88-89 20.9 27.075 28.5625 23.4625 90-91 21.637500000000003 27.787499999999998 28.225 22.35 92-93 21.9625 27.650000000000002 27.3875 23.0 94-95 22.287499999999998 28.050000000000004 26.85 22.8125 96-97 21.2 29.075 27.650000000000002 22.075 98-99 22.3625 27.6625 27.0875 22.8875 100-101 23.1125 28.299999999999997 26.724999999999998 21.8625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 0.5 23 2.0 24 2.0 25 3.0 26 4.0 27 3.0 28 5.0 29 8.0 30 15.5 31 22.5 32 24.5 33 31.5 34 39.0 35 53.5 36 74.5 37 89.0 38 109.5 39 138.5 40 173.5 41 209.0 42 230.5 43 260.0 44 263.5 45 247.5 46 256.0 47 270.0 48 257.5 49 216.0 50 176.5 51 144.5 52 128.5 53 113.5 54 88.0 55 70.0 56 55.5 57 44.5 58 34.0 59 20.0 60 18.5 61 20.5 62 17.5 63 12.5 64 9.0 65 8.0 66 6.0 67 4.0 68 4.5 69 3.5 70 3.0 71 2.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 1.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.925 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34426229508196 98.475 2 0.5296343001261034 1.05 3 0.05044136191677175 0.15 4 0.05044136191677175 0.2 5 0.025220680958385876 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACACTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.2875 0.0 0.0 0.0 0.0 78-79 0.36250000000000004 0.0 0.0 0.0 0.0 80-81 0.45 0.0 0.0 0.0 0.0 82-83 0.575 0.0 0.0 0.0 0.0 84-85 0.7375 0.0 0.0 0.0 0.0 86-87 1.0499999999999998 0.0 0.0 0.0 0.0 88-89 1.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864462 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864462_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.643 33.0 31.0 34.0 30.0 34.0 2 31.66725 34.0 31.0 34.0 28.0 34.0 3 31.77775 34.0 31.0 34.0 30.0 34.0 4 35.22775 37.0 35.0 37.0 33.0 37.0 5 35.3365 37.0 35.0 37.0 33.0 37.0 6 35.11725 37.0 35.0 37.0 32.0 37.0 7 35.29975 37.0 35.0 37.0 33.0 37.0 8 35.12 37.0 35.0 37.0 32.0 37.0 9 36.8135 39.0 37.0 39.0 33.0 39.0 10-11 36.7855 39.0 37.0 39.0 33.0 39.0 12-13 36.68325 39.0 37.0 39.0 32.5 39.0 14-15 38.126625000000004 40.0 38.0 41.0 33.0 41.0 16-17 37.9565 40.0 38.0 41.0 32.5 41.0 18-19 38.033875 40.0 38.0 41.0 33.0 41.0 20-21 38.000375 40.0 38.0 41.0 33.0 41.0 22-23 37.822 40.0 38.0 41.0 32.0 41.0 24-25 37.661125 40.0 38.0 41.0 32.0 41.0 26-27 37.428875000000005 40.0 38.0 41.0 31.5 41.0 28-29 37.368875 40.0 38.0 41.0 31.0 41.0 30-31 37.277249999999995 40.0 38.0 41.0 31.0 41.0 32-33 37.12175 40.0 37.5 41.0 30.5 41.0 34-35 37.0535 40.0 37.5 41.0 30.5 41.0 36-37 36.795375 40.0 37.0 41.0 30.0 41.0 38-39 36.66125 40.0 37.0 41.0 30.0 41.0 40-41 36.510625000000005 40.0 37.0 41.0 30.0 41.0 42-43 36.2355 39.0 36.0 41.0 29.5 41.0 44-45 36.01825 39.0 35.5 40.5 28.0 41.0 46-47 36.113749999999996 39.0 36.0 41.0 29.0 41.0 48-49 35.809 39.0 35.0 41.0 27.5 41.0 50-51 35.00325 38.0 34.0 39.5 25.5 40.5 52-53 34.918625 38.0 34.5 39.5 26.0 40.5 54-55 35.957875 39.0 36.0 40.5 28.0 41.0 56-57 35.780874999999995 39.0 35.0 41.0 27.5 41.0 58-59 35.694874999999996 39.0 35.0 41.0 27.0 41.0 60-61 35.455749999999995 39.0 35.0 41.0 27.5 41.0 62-63 35.260125 39.0 35.0 40.5 26.5 41.0 64-65 34.8615 38.0 34.5 40.0 26.0 41.0 66-67 34.4385 37.0 34.0 40.0 26.0 41.0 68-69 34.042625 37.0 34.0 39.0 26.0 41.0 70-71 33.580375000000004 36.0 34.0 39.0 25.0 41.0 72-73 33.14875 36.0 33.0 39.0 24.0 40.0 74-75 32.671375 35.0 33.0 37.5 22.0 39.5 76-77 32.286500000000004 35.0 32.0 37.0 23.0 39.0 78-79 31.781625 35.0 32.0 36.5 20.5 39.0 80-81 31.495375 35.0 32.0 36.0 20.0 37.0 82-83 31.045625 35.0 31.0 36.0 18.5 37.0 84-85 30.734125 35.0 31.0 35.0 18.0 36.5 86-87 30.384999999999998 34.0 31.0 35.0 16.5 36.0 88-89 30.06975 34.0 31.0 35.0 10.5 36.0 90-91 29.920749999999998 34.0 31.0 35.0 6.5 35.5 92-93 29.659625 34.0 31.0 35.0 2.0 35.0 94-95 29.29875 34.0 30.0 35.0 2.0 35.0 96-97 28.80075 34.0 29.5 35.0 2.0 35.0 98-99 28.3455 34.0 29.0 35.0 2.0 35.0 100-101 27.3185 33.5 27.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 31.0 3 11.0 4 6.0 5 5.0 6 5.0 7 9.0 8 18.0 9 16.0 10 7.0 11 8.0 12 8.0 13 18.0 14 15.0 15 16.0 16 15.0 17 20.0 18 8.0 19 13.0 20 17.0 21 23.0 22 31.0 23 25.0 24 26.0 25 28.0 26 36.0 27 35.0 28 57.0 29 56.0 30 84.0 31 80.0 32 110.0 33 144.0 34 178.0 35 286.0 36 472.0 37 902.0 38 1051.0 39 130.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.95 24.55 11.225 33.275 2 24.224999999999998 24.975 32.725 18.075 3 19.675 26.0 32.35 21.975 4 21.25 32.875 24.474999999999998 21.4 5 25.374999999999996 35.949999999999996 21.85 16.825000000000003 6 20.275000000000002 38.75 23.150000000000002 17.825 7 21.275 23.075000000000003 36.175000000000004 19.475 8 20.625 25.724999999999998 29.025000000000002 24.625 9 22.5 23.849999999999998 31.674999999999997 21.975 10-11 22.650000000000002 31.7125 25.074999999999996 20.5625 12-13 22.6125 26.6 27.737499999999997 23.05 14-15 22.175 28.537499999999998 27.737499999999997 21.55 16-17 23.5 27.6625 26.687499999999996 22.15 18-19 22.8875 29.062500000000004 26.9125 21.1375 20-21 23.25 29.15 26.2875 21.3125 22-23 22.1875 29.15 27.950000000000003 20.7125 24-25 22.55 28.625 27.075 21.75 26-27 22.525000000000002 28.712500000000002 27.3375 21.425 28-29 22.037499999999998 28.675 27.5125 21.775 30-31 22.4875 28.275 27.6375 21.6 32-33 22.925 28.237499999999997 27.5625 21.275 34-35 22.2625 28.349999999999998 27.650000000000002 21.7375 36-37 22.6125 27.237499999999997 27.5625 22.5875 38-39 22.400000000000002 28.5875 27.0 22.0125 40-41 22.400000000000002 28.1 27.712500000000002 21.7875 42-43 22.05 29.312500000000004 26.5625 22.075 44-45 22.412499999999998 29.212500000000002 26.700000000000003 21.675 46-47 22.575 27.237499999999997 28.375 21.8125 48-49 22.650000000000002 28.1375 27.2625 21.95 50-51 22.9375 28.4375 27.3375 21.2875 52-53 22.5875 27.8625 27.975 21.575 54-55 22.112499999999997 27.5125 28.199999999999996 22.175 56-57 22.3625 28.7375 27.6875 21.212500000000002 58-59 21.975 28.799999999999997 27.8125 21.4125 60-61 22.2 28.3875 27.787499999999998 21.625 62-63 22.075 28.1125 27.187499999999996 22.625 64-65 22.1375 27.8375 28.050000000000004 21.975 66-67 22.4375 27.700000000000003 28.3625 21.5 68-69 23.05 28.762500000000003 27.5875 20.599999999999998 70-71 23.150000000000002 28.4125 27.05 21.3875 72-73 22.8375 27.762500000000003 27.3875 22.0125 74-75 22.8 28.237499999999997 27.800000000000004 21.1625 76-77 21.712500000000002 29.037499999999998 28.012500000000003 21.2375 78-79 22.375 28.725 27.6625 21.2375 80-81 22.8125 27.6375 27.925 21.625 82-83 23.0125 27.487499999999997 27.537499999999998 21.9625 84-85 22.925 28.5875 26.625 21.8625 86-87 23.4375 28.037499999999998 27.05 21.475 88-89 23.1125 28.299999999999997 27.5125 21.075 90-91 22.650000000000002 29.075 26.325 21.95 92-93 23.1375 28.025 27.675 21.1625 94-95 23.4375 28.1 26.8 21.6625 96-97 23.2375 29.0875 25.825 21.85 98-99 23.5375 28.050000000000004 26.2625 22.15 100-101 24.4 28.6375 25.8625 21.099999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.5 17 1.0 18 0.5 19 1.5 20 1.0 21 0.0 22 0.5 23 1.0 24 1.0 25 2.0 26 3.5 27 6.0 28 5.5 29 7.5 30 13.0 31 22.5 32 32.0 33 39.0 34 52.0 35 72.5 36 95.0 37 116.5 38 129.0 39 164.5 40 210.0 41 233.0 42 248.0 43 260.0 44 266.0 45 260.5 46 248.5 47 233.5 48 223.5 49 202.0 50 168.0 51 134.0 52 112.0 53 89.0 54 64.5 55 55.0 56 48.5 57 34.0 58 22.5 59 21.5 60 14.5 61 13.5 62 17.5 63 12.5 64 6.5 65 4.0 66 3.0 67 2.0 68 4.0 69 3.5 70 1.0 71 1.0 72 2.0 73 1.0 74 0.5 75 1.0 76 1.0 77 2.5 78 2.0 79 0.0 80 0.0 81 1.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77432296890673 99.47500000000001 2 0.20060180541624875 0.4 3 0.0 0.0 4 0.0 0.0 5 0.025075225677031094 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTTAATTTGAGACAGAAAACATGAAATCCTCCTACACTTTCTTCATTCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.3375 0.0 0.0 0.0 0.0 80-81 0.425 0.0 0.0 0.0 0.0 82-83 0.5375 0.0 0.0 0.0 0.0 84-85 0.6375 0.0 0.0 0.0 0.0 86-87 0.9375 0.0 0.0 0.0 0.0 88-89 1.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 838332 spots for ERR1864462.sra Written 838332 spots for ERR1864462.sra Read 838332 spots for ERR1864462.sra Written 838332 spots for ERR1864462.sra Read 838332 spots for ERR1864462.sra Written 838332 spots for ERR1864462.sra Read 838332 spots for ERR1864462.sra Written 838332 spots for ERR1864462.sra Read 838332 spots for ERR1864462.sra Written 838332 spots for ERR1864462.sra Read 838332 spots for ERR1864462.sra Written 838332 spots for ERR1864462.sra Read 838332 spots for ERR1864462.sra Written 838332 spots for ERR1864462.sra Read 838332 spots for ERR1864462.sra Written 838332 spots for ERR1864462.sra Read 838332 spots for ERR1864462.sra Written 838332 spots for ERR1864462.sra Read 838341 spots for ERR1864462.sra Written 838341 spots for ERR1864462.sra Read 838332 spots for ERR1864462.sra Written 838332 spots for ERR1864462.sra Read 838332 spots for ERR1864462.sra Written 838332 spots for ERR1864462.sra Read 838332 spots for ERR1864462.sra Written 838332 spots for ERR1864462.sra Read 838332 spots for ERR1864462.sra Written 838332 spots for ERR1864462.sra Read 838332 spots for ERR1864462.sra Written 838332 spots for ERR1864462.sra Read 838332 spots for ERR1864462.sra Written 838332 spots for ERR1864462.sra Read 838332 spots for ERR1864462.sra Written 838332 spots for ERR1864462.sra Read 838332 spots for ERR1864462.sra Written 838332 spots for ERR1864462.sra Read 838332 spots for ERR1864462.sra Written 838332 spots for ERR1864462.sra Read 838332 spots for ERR1864462.sra Written 838332 spots for ERR1864462.sra SRR ids: ['ERR1864462.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4ewsful8 ERR1864462.sra spots: 16766649 blocks: [[1, 838332], [838333, 1676664], [1676665, 2514996], [2514997, 3353328], [3353329, 4191660], [4191661, 5029992], [5029993, 5868324], [5868325, 6706656], [6706657, 7544988], [7544989, 8383320], [8383321, 9221652], [9221653, 10059984], [10059985, 10898316], [10898317, 11736648], [11736649, 12574980], [12574981, 13413312], [13413313, 14251644], [14251645, 15089976], [15089977, 15928308], [15928309, 16766649]] ERR1864462 file size 4022598 ERR1864462 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864462 ERR1864462_1.fastq ERR1864462_2.fastq Input file: ERR1864462_1.fastq Paired file: ERR1864462_2.fastq trimmed: ERR1864462-trimmed-pair1.fastq, ERR1864462-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:16:42 2025 >> started Thu Feb 13 13:16:58 2025 >> done (15.600s) 16766649 read pairs processed; of these: 327044 ( 1.95%) short read pairs filtered out after trimming by size control 415686 ( 2.48%) empty read pairs filtered out after trimming by size control 16023919 (95.57%) read pairs available; of these: 3869325 (24.15%) trimmed read pairs available after processing 12154594 (75.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 136 0.00% 19 355 0.00% 20 513 0.00% 21 751 0.00% 22 973 0.01% 23 1200 0.01% 24 1345 0.01% 25 1580 0.01% 26 1830 0.01% 27 2180 0.01% 28 2464 0.02% 29 2822 0.02% 30 3150 0.02% 31 3553 0.02% 32 3933 0.02% 33 4372 0.03% 34 4647 0.03% 35 5021 0.03% 36 5325 0.03% 37 5881 0.04% 38 6215 0.04% 39 6666 0.04% 40 7017 0.04% 41 7196 0.04% 42 7632 0.05% 43 8245 0.05% 44 8485 0.05% 45 8670 0.05% 46 9150 0.06% 47 9487 0.06% 48 9892 0.06% 49 10405 0.06% 50 10947 0.07% 51 11328 0.07% 52 11827 0.07% 53 12247 0.08% 54 12791 0.08% 55 13597 0.08% 56 14329 0.09% 57 15063 0.09% 58 16108 0.10% 59 20811 0.13% 60 25378 0.16% 61 25632 0.16% 62 25942 0.16% 63 26942 0.17% 64 27407 0.17% 65 28528 0.18% 66 29118 0.18% 67 30488 0.19% 68 31732 0.20% 69 32993 0.21% 70 33894 0.21% 71 35030 0.22% 72 37128 0.23% 73 38624 0.24% 74 39821 0.25% 75 40809 0.25% 76 40483 0.25% 77 42044 0.26% 78 44089 0.28% 79 46458 0.29% 80 48723 0.30% 81 51003 0.32% 82 53331 0.33% 83 56357 0.35% 84 59999 0.37% 85 64002 0.40% 86 67883 0.42% 87 72781 0.45% 88 72662 0.45% 89 76289 0.48% 90 85299 0.53% 91 93828 0.59% 92 104288 0.65% 93 117026 0.73% 94 131602 0.82% 95 150188 0.94% 96 179510 1.12% 97 219715 1.37% 98 287498 1.79% 99 382403 2.39% 100 522259 3.26% 101 12154594 75.85% 16023919 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=3.74 fanout-score-rank=21 prefix-density=0.23 prefix-fanout=3.4 sequence=TTGTCATAAGATGTAGCAGTAGGCTGTGGGCCAAAATCCTTGACAAAATTATTCTTTTCATTGGACTCGGTTGTGTGGCAATCGGCTTTCTCATTGGAGACTGATGACAAT criterion=fanout-score sequence-density=0.07 sequence-density-rank=19 fanout-score=302.72 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=28.1 sequence=CTTCTTCTTCTC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=31 prefix-density=0.15 prefix-fanout=2.1 sequence=CTCAGTTGTTCCTTTACAATGATGGTGTCGTTAAAGGAGAGAGATCCTTTGCTGAGGATCTTGAGCCGAGGCCTAATGTGTCCGTTTACCACGACGACGCTACTCTTAAAGGAGAAAAATCTTTTCCGGAGGACTTCGAACCAGGGCCTAACATATCAGTTTATGATGATGGTGTC criterion=fanout-score sequence-density=0.06 sequence-density-rank=19 fanout-score=373.39 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=29.6 sequence=AAGAAGAAGAAG ERR1864462 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:17:31 Started mapping on | Feb 13 13:17:31 Finished on | Feb 13 13:18:25 Mapping speed, Million of reads per hour | 1068.26 Number of input reads | 16023919 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 15040126 Uniquely mapped reads % | 93.86% Average mapped length | 195.09 Number of splices: Total | 8411629 Number of splices: Annotated (sjdb) | 8270222 Number of splices: GT/AG | 8285465 Number of splices: GC/AG | 104957 Number of splices: AT/AC | 8131 Number of splices: Non-canonical | 13076 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.01% Deletion average length | 2.40 Insertion rate per base | 0.01% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 494023 % of reads mapped to multiple loci | 3.08% Number of reads mapped to too many loci | 56041 % of reads mapped to too many loci | 0.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.67% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 529004 529004 529004 N_multimapping 494023 494023 494023 N_noFeature 373465 14885076 459224 N_ambiguous 134430 648 64795 UnstrandedReadsAssigned:14532231 PositiveStrandReadsAssigned:154402 NegativeStrandReadsAssigned:14516107 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864462 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864462-trimmed-pair1.fastq ERR1864462-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,023,919 reads, 14,804,324 reads pseudoaligned [quant] estimated average fragment length: 159.05 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,042 rounds 52401 ERR1864462.ke.tsv 34699 ERR1864462.se.tsv 87100 total ==> ERR1864462.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1859.95 2971 121.137 Potri.005G024800.1.v4.1 1035 876.95 663 57.3341 Potri.004G059700.1.v4.1 961 802.963 177 16.7167 Potri.007G009000.2.v4.1 1416 1257.95 0 0 Potri.003G141000.2.v4.1 2943 2784.95 695 18.9252 Potri.016G087400.1.v4.1 270 119.074 825.913 526.005 Potri.015G069301.1.v4.1 564 406.064 0 0 Potri.010G195200.1.v4.1 1773 1614.95 82 3.8506 Potri.012G127500.1.v4.1 977 818.956 4453 412.35 ==> ERR1864462.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 133 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 322 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 518 ERR1864462 completed mapping pipeline successfully