Starting /dee2/code/volunteer_pipeline.sh ERR1864463 current disk space = 3091022360576 free memory = 1579917700 ERR1864463 SRAfilesize a621b4712d43c42ef22710df36192adf ERR1864463.sra ERR1864463.sra file validated ERR1864463 is paired end ERR1864463 is conventional basespace ERR1864463 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864463_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.45475 33.0 31.0 34.0 30.0 34.0 2 31.82675 34.0 31.0 34.0 30.0 34.0 3 31.92025 34.0 31.0 34.0 28.0 34.0 4 35.5265 37.0 35.0 37.0 33.0 37.0 5 35.235 37.0 35.0 37.0 33.0 37.0 6 35.13225 37.0 35.0 37.0 32.0 37.0 7 35.064 37.0 35.0 37.0 32.0 37.0 8 35.119 37.0 35.0 37.0 32.0 37.0 9 36.6715 39.0 37.0 39.0 33.0 39.0 10-11 36.685500000000005 39.0 37.0 39.0 33.0 39.0 12-13 36.376375 39.0 37.0 39.0 32.0 39.0 14-15 37.90075 40.0 38.0 41.0 33.0 41.0 16-17 37.869125 40.0 38.0 41.0 32.5 41.0 18-19 37.806250000000006 40.0 38.0 41.0 32.5 41.0 20-21 37.64975 40.0 38.0 41.0 32.0 41.0 22-23 37.502125 40.0 38.0 41.0 32.0 41.0 24-25 37.525 40.0 38.0 41.0 32.0 41.0 26-27 37.281875 40.0 37.5 41.0 31.0 41.0 28-29 37.157125 40.0 37.5 41.0 31.0 41.0 30-31 36.936875 40.0 37.0 41.0 30.5 41.0 32-33 36.866625 40.0 37.0 41.0 30.0 41.0 34-35 36.71425 40.0 37.0 41.0 30.0 41.0 36-37 36.868625 40.0 37.0 41.0 30.0 41.0 38-39 36.562875000000005 40.0 36.5 41.0 30.0 41.0 40-41 36.432125 40.0 36.5 41.0 30.0 41.0 42-43 36.346375 40.0 36.0 41.0 29.5 41.0 44-45 36.26225 39.5 36.0 41.0 30.0 41.0 46-47 36.11125 39.0 35.0 41.0 29.5 41.0 48-49 36.2515 39.5 36.0 41.0 29.0 41.0 50-51 36.236 40.0 36.0 41.0 29.0 41.0 52-53 36.067125000000004 40.0 36.0 41.0 28.5 41.0 54-55 35.74575 39.0 35.0 41.0 28.0 41.0 56-57 35.584625 39.0 35.0 41.0 28.0 41.0 58-59 35.413624999999996 39.0 35.0 41.0 27.0 41.0 60-61 34.9815 38.5 34.0 40.5 26.0 41.0 62-63 34.818125 38.0 34.0 40.0 26.0 41.0 64-65 34.401250000000005 37.5 34.0 40.0 25.5 41.0 66-67 33.951625 37.0 34.0 40.0 24.0 41.0 68-69 33.644375 36.5 33.5 39.0 24.0 41.0 70-71 33.066125 36.0 32.5 39.0 22.0 40.0 72-73 32.688625 35.5 32.0 38.5 22.0 40.0 74-75 32.216499999999996 35.0 32.0 37.0 21.0 39.0 76-77 31.18175 34.0 30.5 36.0 20.5 39.0 78-79 31.529 35.0 31.5 36.0 20.0 39.0 80-81 31.5455 35.0 32.0 36.0 20.5 37.5 82-83 31.149625 35.0 32.0 36.0 20.0 37.0 84-85 30.825 35.0 31.5 35.0 19.0 36.5 86-87 30.473375 34.5 31.0 35.0 16.0 36.0 88-89 30.242375 34.0 31.0 35.0 14.5 36.0 90-91 29.945375 34.0 31.0 35.0 7.0 36.0 92-93 29.720875 34.0 31.0 35.0 4.0 35.0 94-95 29.354999999999997 34.0 30.0 35.0 2.0 35.0 96-97 29.02325 34.0 30.0 35.0 2.0 35.0 98-99 28.56075 34.0 29.5 35.0 2.0 35.0 100-101 27.308374999999998 33.0 27.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 47.0 3 17.0 4 8.0 5 10.0 6 6.0 7 10.0 8 7.0 9 6.0 10 11.0 11 15.0 12 12.0 13 13.0 14 10.0 15 13.0 16 13.0 17 21.0 18 17.0 19 14.0 20 15.0 21 18.0 22 23.0 23 18.0 24 22.0 25 19.0 26 36.0 27 30.0 28 60.0 29 64.0 30 67.0 31 88.0 32 109.0 33 166.0 34 209.0 35 312.0 36 445.0 37 861.0 38 1051.0 39 137.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.27281947261663 5.704868154158215 4.690669371196755 43.3316430020284 2 27.0 5.6000000000000005 32.550000000000004 34.849999999999994 3 23.625 8.05 22.575 45.75 4 29.049999999999997 13.5 21.125 36.325 5 30.75 19.25 23.5 26.5 6 25.05 25.224999999999998 24.349999999999998 25.374999999999996 7 17.525 22.625 42.4 17.45 8 18.224999999999998 23.5 36.1 22.175 9 16.875 22.775000000000002 38.675 21.675 10-11 20.4375 33.1125 28.799999999999997 17.65 12-13 21.337500000000002 26.5 31.337500000000002 20.825 14-15 20.2875 26.4625 30.3875 22.8625 16-17 21.099999999999998 28.375 29.349999999999998 21.175 18-19 21.9625 28.0625 27.962500000000002 22.0125 20-21 20.8 28.1375 28.8625 22.2 22-23 21.15 28.287499999999998 28.849999999999998 21.712500000000002 24-25 21.175 27.237499999999997 27.875 23.7125 26-27 21.1625 27.825 28.275 22.7375 28-29 20.8125 28.1625 28.1 22.925 30-31 20.150000000000002 27.125 28.849999999999998 23.875 32-33 21.099999999999998 28.512500000000003 28.549999999999997 21.837500000000002 34-35 22.025 26.275 28.537499999999998 23.1625 36-37 21.775 26.737499999999997 27.8375 23.65 38-39 21.587500000000002 27.825 28.012500000000003 22.575 40-41 21.512500000000003 27.962500000000002 28.025 22.5 42-43 21.349999999999998 27.750000000000004 28.3625 22.537499999999998 44-45 21.8 28.125 27.537499999999998 22.537499999999998 46-47 21.462500000000002 27.9125 27.8375 22.787499999999998 48-49 21.775 26.2625 28.812500000000004 23.150000000000002 50-51 20.925 27.55 28.299999999999997 23.225 52-53 21.224999999999998 28.050000000000004 28.225 22.5 54-55 21.075 27.787499999999998 28.512500000000003 22.625 56-57 21.175 27.575 28.262500000000003 22.9875 58-59 21.625 27.6125 27.975 22.787499999999998 60-61 21.7375 26.950000000000003 27.275 24.0375 62-63 20.8125 27.05 28.8875 23.25 64-65 21.275 28.125 27.8625 22.7375 66-67 20.8125 28.000000000000004 27.55 23.6375 68-69 21.087500000000002 27.275 28.5625 23.075000000000003 70-71 21.8625 27.275 28.4 22.4625 72-73 21.725 27.0 28.262500000000003 23.0125 74-75 22.05 27.4125 27.8125 22.725 76-77 21.55 27.1125 28.3125 23.025000000000002 78-79 21.175 27.9125 27.1 23.8125 80-81 22.6125 28.9 26.650000000000002 21.837500000000002 82-83 20.549999999999997 27.5125 28.537499999999998 23.400000000000002 84-85 21.2625 27.224999999999998 28.425 23.0875 86-87 21.3875 27.150000000000002 28.4125 23.05 88-89 21.1125 29.45 27.375 22.0625 90-91 22.0125 28.15 26.937499999999996 22.900000000000002 92-93 21.3625 27.975 27.3 23.3625 94-95 21.6875 28.475 27.8125 22.025 96-97 21.375 28.537499999999998 27.0 23.0875 98-99 22.3625 28.237499999999997 27.400000000000002 22.0 100-101 21.837500000000002 28.625 27.275 22.2625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 1.0 23 1.5 24 2.0 25 2.5 26 3.5 27 5.5 28 7.0 29 14.0 30 15.5 31 13.0 32 17.0 33 35.0 34 49.0 35 53.0 36 65.5 37 86.0 38 120.0 39 163.0 40 185.0 41 196.5 42 221.0 43 244.5 44 263.5 45 262.5 46 261.0 47 259.0 48 240.5 49 221.5 50 183.5 51 144.5 52 127.0 53 114.5 54 93.0 55 66.0 56 46.5 57 38.0 58 34.5 59 26.0 60 19.5 61 20.0 62 18.5 63 12.0 64 8.0 65 6.5 66 7.5 67 6.0 68 4.5 69 4.0 70 1.0 71 0.5 72 1.5 73 2.5 74 2.0 75 1.0 76 0.5 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4000000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26860025220681 98.4 2 0.6305170239596469 1.25 3 0.07566204287515763 0.22499999999999998 4 0.0 0.0 5 0.025220680958385876 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGCTGATCTTTCATGACAGCTCTCCAATACTCTCCAGTGTCTTTTCTAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.1875 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.30000000000000004 0.0 0.0 0.0 0.0 78-79 0.425 0.0 0.0 0.0 0.0 80-81 0.5 0.0 0.0 0.0 0.0 82-83 0.6125 0.0 0.0 0.0 0.0 84-85 0.7625 0.0 0.0 0.0 0.0 86-87 1.0 0.0 0.0 0.0 0.0 88-89 1.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864463 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864463_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.4985 33.0 31.0 34.0 30.0 34.0 2 31.51625 33.0 31.0 34.0 28.0 34.0 3 31.58225 34.0 31.0 34.0 28.0 34.0 4 35.18925 37.0 35.0 37.0 33.0 37.0 5 35.20525 37.0 35.0 37.0 33.0 37.0 6 35.10025 37.0 35.0 37.0 32.0 37.0 7 35.18225 37.0 35.0 37.0 33.0 37.0 8 35.133 37.0 35.0 37.0 32.0 37.0 9 36.75425 39.0 37.0 39.0 33.0 39.0 10-11 36.681625 39.0 37.0 39.0 32.5 39.0 12-13 36.562125 39.0 37.0 39.0 32.0 39.0 14-15 37.942375 40.0 38.0 41.0 32.5 41.0 16-17 37.7255 40.0 38.0 41.0 32.0 41.0 18-19 37.842875 40.0 38.0 41.0 32.5 41.0 20-21 37.850125 40.0 38.0 41.0 32.5 41.0 22-23 37.731624999999994 40.0 38.0 41.0 32.0 41.0 24-25 37.6375 40.0 38.0 41.0 32.0 41.0 26-27 37.3395 40.0 38.0 41.0 31.0 41.0 28-29 37.324625 40.0 38.0 41.0 31.5 41.0 30-31 37.111875 40.0 37.0 41.0 31.0 41.0 32-33 37.039249999999996 40.0 37.0 41.0 30.5 41.0 34-35 36.988125 40.0 37.0 41.0 30.0 41.0 36-37 36.647999999999996 40.0 37.0 41.0 30.0 41.0 38-39 36.537625000000006 40.0 36.0 41.0 30.0 41.0 40-41 36.388625 39.0 36.0 41.0 30.0 41.0 42-43 36.152249999999995 39.0 35.5 40.5 29.5 41.0 44-45 35.861625000000004 39.0 35.5 40.0 27.5 41.0 46-47 35.876374999999996 39.0 35.0 41.0 27.5 41.0 48-49 35.624875 39.0 35.0 40.0 27.0 41.0 50-51 34.863749999999996 38.0 34.0 39.5 26.0 40.5 52-53 34.876999999999995 38.0 34.5 39.5 26.5 40.5 54-55 35.778125 39.0 35.5 40.5 28.0 41.0 56-57 35.64975 39.0 35.0 41.0 27.0 41.0 58-59 35.676625 39.0 35.0 41.0 28.0 41.0 60-61 35.407875000000004 39.0 35.0 41.0 27.5 41.0 62-63 35.086124999999996 38.5 34.5 40.0 26.0 41.0 64-65 34.723875 38.0 34.0 40.0 26.0 41.0 66-67 34.379999999999995 37.0 34.0 40.0 26.0 41.0 68-69 34.04025 37.0 34.0 39.0 26.0 41.0 70-71 33.589375000000004 36.0 33.5 39.0 26.0 40.5 72-73 33.094375 35.5 33.0 38.5 24.0 40.0 74-75 32.5125 35.0 32.0 37.0 22.5 39.0 76-77 32.148375 35.0 32.0 37.0 22.5 39.0 78-79 31.676000000000002 35.0 32.0 36.0 21.0 39.0 80-81 31.52375 35.0 32.0 36.0 21.5 37.0 82-83 31.05425 35.0 31.0 35.5 20.0 37.0 84-85 30.683500000000002 34.5 31.0 35.0 18.5 36.5 86-87 30.421 34.0 31.0 35.0 18.0 36.0 88-89 29.926499999999997 34.0 30.5 35.0 8.5 36.0 90-91 29.7415 34.0 30.0 35.0 7.0 35.0 92-93 29.559125 34.0 30.0 35.0 3.5 35.0 94-95 29.191499999999998 34.0 30.0 35.0 2.0 35.0 96-97 28.791125 34.0 29.5 35.0 2.0 35.0 98-99 28.239875 34.0 29.0 35.0 2.0 35.0 100-101 27.163249999999998 33.5 27.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 40.0 3 5.0 4 8.0 5 4.0 6 5.0 7 7.0 8 11.0 9 9.0 10 19.0 11 15.0 12 10.0 13 14.0 14 12.0 15 13.0 16 10.0 17 13.0 18 13.0 19 20.0 20 18.0 21 20.0 22 29.0 23 31.0 24 17.0 25 38.0 26 26.0 27 54.0 28 53.0 29 58.0 30 74.0 31 90.0 32 122.0 33 138.0 34 217.0 35 296.0 36 526.0 37 897.0 38 949.0 39 119.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.95 23.65 11.15 35.25 2 24.375 25.25 33.125 17.25 3 17.125 27.800000000000004 34.0 21.075 4 21.2 31.924999999999997 25.124999999999996 21.75 5 24.2 35.275 22.45 18.075 6 19.6 38.95 22.925 18.525 7 20.275000000000002 23.025000000000002 37.25 19.45 8 21.425 24.725 29.125 24.725 9 19.85 24.9 31.85 23.400000000000002 10-11 22.2625 32.1 24.7 20.9375 12-13 23.3625 27.4125 26.974999999999998 22.25 14-15 22.3 28.1 27.400000000000002 22.2 16-17 23.25 28.3375 26.5625 21.85 18-19 22.1 29.175 26.8375 21.8875 20-21 22.0 27.962500000000002 27.212500000000002 22.825 22-23 23.1 28.125 26.85 21.925 24-25 21.75 28.625 27.987499999999997 21.637500000000003 26-27 22.0125 29.225 27.212500000000002 21.55 28-29 22.3875 29.375 26.8125 21.425 30-31 21.75 28.249999999999996 28.025 21.975 32-33 22.5875 27.962500000000002 27.8375 21.6125 34-35 22.5125 27.8875 28.15 21.45 36-37 21.375 29.312500000000004 27.500000000000004 21.8125 38-39 23.275000000000002 27.737499999999997 27.500000000000004 21.4875 40-41 22.6375 27.675 27.474999999999998 22.2125 42-43 21.912499999999998 28.575 28.199999999999996 21.3125 44-45 22.1375 27.9125 28.0625 21.8875 46-47 22.825 28.299999999999997 27.5625 21.3125 48-49 22.6375 28.3625 27.987499999999997 21.0125 50-51 22.8125 28.487499999999997 27.9375 20.7625 52-53 22.912499999999998 27.35 26.8 22.9375 54-55 21.712500000000002 28.537499999999998 27.8625 21.8875 56-57 22.3625 28.625 26.825 22.1875 58-59 22.650000000000002 27.85 28.1875 21.3125 60-61 22.675 27.474999999999998 27.6125 22.237499999999997 62-63 23.775 28.1875 26.6625 21.375 64-65 22.5625 28.4 28.299999999999997 20.7375 66-67 22.8 28.9375 26.8625 21.4 68-69 23.400000000000002 28.9 26.724999999999998 20.974999999999998 70-71 23.674999999999997 28.0875 27.1375 21.099999999999998 72-73 23.25 28.65 27.0125 21.087500000000002 74-75 23.325000000000003 28.212500000000002 27.487499999999997 20.974999999999998 76-77 22.425 28.325 27.712500000000002 21.5375 78-79 22.8375 28.825 27.025 21.3125 80-81 22.650000000000002 28.537499999999998 27.3625 21.45 82-83 23.150000000000002 27.950000000000003 27.1625 21.7375 84-85 23.275000000000002 27.400000000000002 27.462500000000002 21.8625 86-87 23.175 28.375 27.0 21.45 88-89 22.9875 28.799999999999997 27.237499999999997 20.974999999999998 90-91 23.7875 27.737499999999997 26.55 21.925 92-93 24.175 28.675 26.487500000000004 20.6625 94-95 23.65 28.1875 26.8 21.3625 96-97 23.400000000000002 29.262500000000003 25.9625 21.375 98-99 23.7125 28.849999999999998 26.887499999999996 20.549999999999997 100-101 24.125 28.8375 26.5125 20.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 1.0 24 0.5 25 2.0 26 4.5 27 5.5 28 6.0 29 7.0 30 15.5 31 24.0 32 32.5 33 43.0 34 48.0 35 60.0 36 74.5 37 105.0 38 156.5 39 185.0 40 215.0 41 229.0 42 242.5 43 270.5 44 264.0 45 257.5 46 250.5 47 227.5 48 215.0 49 196.5 50 168.0 51 145.5 52 113.0 53 80.0 54 64.5 55 58.0 56 48.0 57 36.0 58 27.5 59 25.0 60 18.0 61 13.5 62 13.0 63 10.0 64 7.5 65 5.0 66 4.5 67 4.5 68 2.5 69 2.5 70 3.5 71 2.5 72 1.0 73 0.5 74 0.0 75 0.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79949874686717 99.55000000000001 2 0.17543859649122806 0.35000000000000003 3 0.0 0.0 4 0.02506265664160401 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.32499999999999996 0.0 0.0 0.0 0.0 78-79 0.4625 0.0 0.0 0.0 0.0 80-81 0.55 0.0 0.0 0.0 0.0 82-83 0.6625 0.0 0.0 0.0 0.0 84-85 0.8125 0.0 0.0 0.0 0.0 86-87 1.05 0.0 0.0 0.0 0.0 88-89 1.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 855385 spots for ERR1864463.sra Written 855385 spots for ERR1864463.sra Read 855385 spots for ERR1864463.sra Written 855385 spots for ERR1864463.sra Read 855385 spots for ERR1864463.sra Written 855385 spots for ERR1864463.sra Read 855385 spots for ERR1864463.sra Written 855385 spots for ERR1864463.sra Read 855385 spots for ERR1864463.sra Written 855385 spots for ERR1864463.sra Read 855385 spots for ERR1864463.sra Written 855385 spots for ERR1864463.sra Read 855385 spots for ERR1864463.sra Written 855385 spots for ERR1864463.sra Read 855385 spots for ERR1864463.sra Written 855385 spots for ERR1864463.sra Read 855385 spots for ERR1864463.sra Written 855385 spots for ERR1864463.sra Read 855385 spots for ERR1864463.sra Written 855385 spots for ERR1864463.sra Read 855385 spots for ERR1864463.sra Written 855385 spots for ERR1864463.sra Read 855385 spots for ERR1864463.sra Written 855385 spots for ERR1864463.sra Read 855385 spots for ERR1864463.sra Written 855385 spots for ERR1864463.sra Read 855385 spots for ERR1864463.sra Written 855385 spots for ERR1864463.sra Read 855385 spots for ERR1864463.sra Written 855385 spots for ERR1864463.sra Read 855385 spots for ERR1864463.sra Written 855385 spots for ERR1864463.sra Read 855385 spots for ERR1864463.sra Written 855385 spots for ERR1864463.sra Read 855385 spots for ERR1864463.sra Written 855385 spots for ERR1864463.sra Read 855385 spots for ERR1864463.sra Written 855385 spots for ERR1864463.sra Read 855385 spots for ERR1864463.sra Written 855385 spots for ERR1864463.sra SRR ids: ['ERR1864463.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qil5e5vv ERR1864463.sra spots: 17107700 blocks: [[1, 855385], [855386, 1710770], [1710771, 2566155], [2566156, 3421540], [3421541, 4276925], [4276926, 5132310], [5132311, 5987695], [5987696, 6843080], [6843081, 7698465], [7698466, 8553850], [8553851, 9409235], [9409236, 10264620], [10264621, 11120005], [11120006, 11975390], [11975391, 12830775], [12830776, 13686160], [13686161, 14541545], [14541546, 15396930], [15396931, 16252315], [16252316, 17107700]] ERR1864463 file size 4104863 ERR1864463 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864463 ERR1864463_1.fastq ERR1864463_2.fastq Input file: ERR1864463_1.fastq Paired file: ERR1864463_2.fastq trimmed: ERR1864463-trimmed-pair1.fastq, ERR1864463-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:23:16 2025 >> started Thu Feb 13 13:23:32 2025 >> done (16.183s) 17107700 read pairs processed; of these: 288998 ( 1.69%) short read pairs filtered out after trimming by size control 343386 ( 2.01%) empty read pairs filtered out after trimming by size control 16475316 (96.30%) read pairs available; of these: 3960164 (24.04%) trimmed read pairs available after processing 12515152 (75.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 151 0.00% 19 339 0.00% 20 498 0.00% 21 656 0.00% 22 877 0.01% 23 1071 0.01% 24 1306 0.01% 25 1539 0.01% 26 1799 0.01% 27 2109 0.01% 28 2439 0.01% 29 2722 0.02% 30 3138 0.02% 31 3436 0.02% 32 3835 0.02% 33 4416 0.03% 34 4689 0.03% 35 5028 0.03% 36 5304 0.03% 37 5753 0.03% 38 6117 0.04% 39 6529 0.04% 40 7005 0.04% 41 7221 0.04% 42 7744 0.05% 43 8112 0.05% 44 8505 0.05% 45 9082 0.06% 46 9509 0.06% 47 9700 0.06% 48 10234 0.06% 49 10579 0.06% 50 11107 0.07% 51 11620 0.07% 52 12251 0.07% 53 12717 0.08% 54 13230 0.08% 55 13707 0.08% 56 14666 0.09% 57 15504 0.09% 58 16336 0.10% 59 20323 0.12% 60 24040 0.15% 61 24738 0.15% 62 25263 0.15% 63 25811 0.16% 64 27129 0.16% 65 28257 0.17% 66 28994 0.18% 67 30134 0.18% 68 31714 0.19% 69 32894 0.20% 70 34321 0.21% 71 35461 0.22% 72 37461 0.23% 73 39088 0.24% 74 40199 0.24% 75 41602 0.25% 76 41337 0.25% 77 42980 0.26% 78 44685 0.27% 79 47130 0.29% 80 49609 0.30% 81 51626 0.31% 82 54400 0.33% 83 57673 0.35% 84 61314 0.37% 85 65459 0.40% 86 69633 0.42% 87 73793 0.45% 88 75582 0.46% 89 78477 0.48% 90 87266 0.53% 91 96140 0.58% 92 106964 0.65% 93 120001 0.73% 94 134514 0.82% 95 155096 0.94% 96 185093 1.12% 97 227553 1.38% 98 298995 1.81% 99 396226 2.40% 100 538609 3.27% 101 12515152 75.96% 16475316 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=3.38 fanout-score-rank=22 prefix-density=0.33 prefix-fanout=3.2 sequence=TTGTCATAAGATGTAGCAGTAGGCTGTGGGCCAAAATCCTTGACAAAATTATTCTTTTCATTGGACTCGGTTGTGTGGCAATCGGCTTTCTCATTGGAGACTGATGACAAT criterion=fanout-score sequence-density=0.07 sequence-density-rank=17 fanout-score=304.93 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=28.4 sequence=CTTCTTCTTTTT criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=30 prefix-density=0.22 prefix-fanout=2.1 sequence=CTCAGTTGTTCCTTTACAATGATGGTGTCGTTAAAGGAGAGAGATCCTTTGC criterion=fanout-score sequence-density=0.07 sequence-density-rank=12 fanout-score=332.78 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=28.6 sequence=AAGAAGAAGAAG ERR1864463 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:24:01 Started mapping on | Feb 13 13:24:01 Finished on | Feb 13 13:24:51 Mapping speed, Million of reads per hour | 1186.22 Number of input reads | 16475316 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 15580603 Uniquely mapped reads % | 94.57% Average mapped length | 195.18 Number of splices: Total | 8579343 Number of splices: Annotated (sjdb) | 8438163 Number of splices: GT/AG | 8452534 Number of splices: GC/AG | 105311 Number of splices: AT/AC | 8082 Number of splices: Non-canonical | 13416 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 2.41 Insertion rate per base | 0.01% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 515726 % of reads mapped to multiple loci | 3.13% Number of reads mapped to too many loci | 54728 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.94% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 408583 408583 408583 N_multimapping 515726 515726 515726 N_noFeature 384807 15434567 463392 N_ambiguous 136749 664 68938 UnstrandedReadsAssigned:15059047 PositiveStrandReadsAssigned:145372 NegativeStrandReadsAssigned:15048273 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864463 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864463-trimmed-pair1.fastq ERR1864463-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,475,316 reads, 15,345,887 reads pseudoaligned [quant] estimated average fragment length: 159.34 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,145 rounds 52401 ERR1864463.ke.tsv 34699 ERR1864463.se.tsv 87100 total ==> ERR1864463.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1859.66 3042 119.812 Potri.005G024800.1.v4.1 1035 876.66 770 64.3332 Potri.004G059700.1.v4.1 961 802.665 170 15.5128 Potri.007G009000.2.v4.1 1416 1257.66 0 0 Potri.003G141000.2.v4.1 2943 2784.66 755.224 19.8646 Potri.016G087400.1.v4.1 270 118.925 839.574 517.086 Potri.015G069301.1.v4.1 564 405.819 0 0 Potri.010G195200.1.v4.1 1773 1614.66 55 2.49492 Potri.012G127500.1.v4.1 977 818.66 4244 379.706 ==> ERR1864463.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 190 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 238 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 399 ERR1864463 completed mapping pipeline successfully