Starting /dee2/code/volunteer_pipeline.sh ERR1864464 current disk space = 3091037278208 free memory = 1576068616 ERR1864464 SRAfilesize a5dda5cf979616187acbbe2d4fed8511 ERR1864464.sra ERR1864464.sra file validated ERR1864464 is paired end ERR1864464 is conventional basespace ERR1864464 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864464_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.40325 33.0 31.0 34.0 30.0 34.0 2 31.831 34.0 31.0 34.0 30.0 34.0 3 31.963 34.0 31.0 34.0 29.0 34.0 4 35.489 37.0 35.0 37.0 33.0 37.0 5 35.12925 37.0 35.0 37.0 32.0 37.0 6 34.984 37.0 35.0 37.0 32.0 37.0 7 35.005 37.0 35.0 37.0 32.0 37.0 8 35.02575 37.0 35.0 37.0 32.0 37.0 9 36.6585 39.0 37.0 39.0 32.0 39.0 10-11 36.53625 39.0 37.0 39.0 32.5 39.0 12-13 36.326375 39.0 37.0 39.0 32.0 39.0 14-15 37.752375 40.0 38.0 41.0 32.5 41.0 16-17 37.68625 40.0 38.0 41.0 32.0 41.0 18-19 37.61 40.0 38.0 41.0 32.0 41.0 20-21 37.583124999999995 40.0 38.0 41.0 32.0 41.0 22-23 37.358999999999995 40.0 38.0 41.0 31.5 41.0 24-25 37.320625 40.0 38.0 41.0 31.5 41.0 26-27 37.173500000000004 40.0 38.0 41.0 31.0 41.0 28-29 37.06675 40.0 37.5 41.0 31.0 41.0 30-31 36.75775 40.0 37.0 41.0 30.0 41.0 32-33 36.68962500000001 40.0 37.0 41.0 30.0 41.0 34-35 36.6035 40.0 37.0 41.0 30.0 41.0 36-37 36.593 40.0 37.0 41.0 30.0 41.0 38-39 36.3825 40.0 36.5 41.0 29.5 41.0 40-41 36.285125 40.0 36.0 41.0 29.0 41.0 42-43 36.23775 40.0 36.0 41.0 29.5 41.0 44-45 36.083749999999995 39.5 35.5 41.0 29.0 41.0 46-47 35.815 39.0 35.5 40.5 28.0 41.0 48-49 36.07525 39.5 36.0 41.0 28.5 41.0 50-51 36.0805 40.0 36.0 41.0 29.0 41.0 52-53 35.952625 40.0 35.5 41.0 28.0 41.0 54-55 35.686625 39.0 35.0 41.0 27.5 41.0 56-57 35.50975 39.0 35.0 41.0 27.0 41.0 58-59 35.31075 39.0 35.0 41.0 27.0 41.0 60-61 34.984875 38.5 34.0 40.5 26.0 41.0 62-63 34.75425 38.0 34.0 40.0 26.0 41.0 64-65 34.34425 37.5 34.0 40.0 25.0 41.0 66-67 33.913875 37.0 33.5 40.0 23.5 41.0 68-69 33.621875 36.5 33.5 39.0 23.5 41.0 70-71 33.119 36.0 33.0 39.0 23.0 40.5 72-73 32.70725 35.5 32.0 38.5 22.0 40.0 74-75 32.23375 35.0 32.0 37.0 21.0 39.0 76-77 31.189999999999998 34.5 30.5 36.0 20.0 39.0 78-79 31.4955 35.0 31.5 36.0 19.0 39.0 80-81 31.399749999999997 35.0 32.0 36.0 20.0 37.0 82-83 31.092750000000002 35.0 32.0 36.0 19.0 37.0 84-85 30.703625000000002 35.0 31.0 35.0 17.5 36.5 86-87 30.392 34.5 31.0 35.0 14.5 36.0 88-89 30.157 34.0 31.0 35.0 9.0 36.0 90-91 29.882125000000002 34.0 31.0 35.0 6.0 36.0 92-93 29.627875 34.0 30.0 35.0 2.0 35.0 94-95 29.28875 34.0 30.0 35.0 2.0 35.0 96-97 28.76075 34.0 29.5 35.0 2.0 35.0 98-99 28.53 34.0 30.0 35.0 2.0 35.0 100-101 27.354750000000003 33.0 27.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 52.0 3 31.0 4 9.0 5 3.0 6 9.0 7 6.0 8 10.0 9 7.0 10 12.0 11 14.0 12 10.0 13 13.0 14 18.0 15 15.0 16 12.0 17 11.0 18 11.0 19 10.0 20 17.0 21 15.0 22 13.0 23 18.0 24 21.0 25 32.0 26 33.0 27 35.0 28 60.0 29 69.0 30 65.0 31 111.0 32 108.0 33 161.0 34 216.0 35 284.0 36 453.0 37 832.0 38 1032.0 39 172.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.73086670045616 5.727318803852002 4.282818043588444 43.258996452103396 2 26.3 5.375 32.85 35.475 3 23.974999999999998 8.7 23.65 43.675000000000004 4 29.675 13.450000000000001 21.525 35.35 5 31.175000000000004 18.725 24.55 25.55 6 23.75 25.924999999999997 23.549999999999997 26.775 7 18.575 22.8 41.625 17.0 8 17.375 24.099999999999998 35.55 22.975 9 16.900000000000002 22.900000000000002 38.775 21.425 10-11 18.987499999999997 32.1 30.049999999999997 18.862499999999997 12-13 20.45 26.8375 31.337500000000002 21.375 14-15 20.925 27.650000000000002 29.7 21.725 16-17 20.5875 28.1125 29.6875 21.6125 18-19 21.2375 27.437499999999996 28.537499999999998 22.787499999999998 20-21 20.200000000000003 28.125 28.962500000000002 22.7125 22-23 21.224999999999998 28.1375 28.7375 21.9 24-25 20.8125 27.787499999999998 28.4125 22.9875 26-27 21.0 27.8875 27.5125 23.599999999999998 28-29 21.1625 26.950000000000003 28.6125 23.275000000000002 30-31 21.6875 27.0 28.625 22.6875 32-33 21.3 27.575 28.025 23.1 34-35 21.7 28.212500000000002 27.775 22.3125 36-37 21.3625 26.950000000000003 28.525 23.1625 38-39 21.15 27.5875 28.212500000000002 23.05 40-41 21.224999999999998 28.0625 28.3375 22.375 42-43 21.5625 27.187499999999996 28.8625 22.3875 44-45 21.7 27.5125 28.037499999999998 22.75 46-47 20.5125 27.525 28.6875 23.275000000000002 48-49 21.75 27.55 27.6625 23.0375 50-51 21.462500000000002 27.950000000000003 27.437499999999996 23.150000000000002 52-53 21.337500000000002 28.325 27.712500000000002 22.625 54-55 20.5875 28.125 27.825 23.4625 56-57 20.95 28.375 27.55 23.125 58-59 20.75 27.6875 29.2875 22.275 60-61 20.974999999999998 27.712500000000002 27.675 23.6375 62-63 20.3875 27.875 27.700000000000003 24.0375 64-65 21.3 27.650000000000002 28.1125 22.9375 66-67 21.6125 28.037499999999998 27.150000000000002 23.200000000000003 68-69 20.849999999999998 27.287499999999998 28.0875 23.775 70-71 21.575 26.974999999999998 29.037499999999998 22.412499999999998 72-73 20.6875 26.937499999999996 28.875 23.5 74-75 22.237499999999997 28.1625 27.1375 22.4625 76-77 21.1375 29.062500000000004 27.3625 22.4375 78-79 21.275 27.6125 28.787499999999998 22.325 80-81 20.9875 27.125 28.549999999999997 23.3375 82-83 21.5 27.975 27.737499999999997 22.787499999999998 84-85 21.7375 27.950000000000003 27.8875 22.425 86-87 22.225 26.2125 28.125 23.4375 88-89 21.125 28.1875 27.925 22.7625 90-91 21.6 27.6 27.987499999999997 22.8125 92-93 21.5375 28.8625 26.424999999999997 23.175 94-95 22.15 28.8625 26.3625 22.625 96-97 22.162499999999998 27.762500000000003 27.625 22.45 98-99 22.037499999999998 28.849999999999998 27.450000000000003 21.6625 100-101 22.075 28.849999999999998 26.474999999999998 22.6 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.5 17 1.5 18 0.5 19 0.5 20 0.5 21 1.5 22 1.0 23 2.5 24 4.0 25 3.5 26 4.0 27 5.0 28 9.5 29 11.0 30 8.5 31 12.5 32 20.0 33 33.0 34 39.5 35 53.5 36 70.5 37 83.5 38 113.5 39 140.0 40 179.0 41 231.0 42 262.5 43 254.5 44 246.0 45 255.0 46 257.0 47 255.0 48 246.5 49 226.0 50 191.0 51 147.5 52 114.0 53 97.0 54 82.5 55 61.5 56 45.5 57 42.5 58 39.5 59 30.0 60 24.0 61 19.0 62 14.5 63 16.5 64 11.0 65 4.0 66 5.0 67 5.5 68 3.5 69 3.5 70 2.5 71 1.0 72 1.5 73 2.0 74 1.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.35 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11593836827481 98.1 2 0.8082849204344532 1.6 3 0.025258903763576663 0.075 4 0.025258903763576663 0.1 5 0.025258903763576663 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGCTGATCTTTCATGACAGCTCTCCAATACTCTCCAGTGTCTTTTCTAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.1375 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.1875 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.275 0.0 0.0 0.0 0.0 74-75 0.3 0.0 0.0 0.0 0.0 76-77 0.32499999999999996 0.0 0.0 0.0 0.0 78-79 0.3875 0.0 0.0 0.0 0.0 80-81 0.48750000000000004 0.0 0.0 0.0 0.0 82-83 0.6625 0.0 0.0 0.0 0.0 84-85 0.7749999999999999 0.0 0.0 0.0 0.0 86-87 1.1 0.0 0.0 0.0 0.0 88-89 1.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864464 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864464_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6355 33.0 31.0 34.0 30.0 34.0 2 31.55875 34.0 31.0 34.0 28.0 34.0 3 31.648 34.0 31.0 34.0 28.0 34.0 4 35.137 37.0 35.0 37.0 32.0 37.0 5 35.1115 37.0 35.0 37.0 32.0 37.0 6 35.1455 37.0 35.0 37.0 32.0 37.0 7 35.22525 37.0 35.0 37.0 33.0 37.0 8 35.132 37.0 35.0 37.0 32.0 37.0 9 36.7855 39.0 37.0 39.0 33.0 39.0 10-11 36.817125000000004 39.0 37.0 39.0 33.0 39.0 12-13 36.637875 39.0 37.0 39.0 32.0 39.0 14-15 37.947874999999996 40.0 38.0 41.0 32.5 41.0 16-17 37.95375 40.0 38.0 41.0 32.5 41.0 18-19 37.9555 40.0 38.0 41.0 32.5 41.0 20-21 37.872375000000005 40.0 38.0 41.0 32.5 41.0 22-23 37.759 40.0 38.0 41.0 32.0 41.0 24-25 37.640625 40.0 38.0 41.0 32.0 41.0 26-27 37.418125 40.0 38.0 41.0 32.0 41.0 28-29 37.349000000000004 40.0 38.0 41.0 31.0 41.0 30-31 37.16775 40.0 37.5 41.0 31.0 41.0 32-33 37.135374999999996 40.0 37.0 41.0 30.0 41.0 34-35 36.945499999999996 40.0 37.0 41.0 30.0 41.0 36-37 36.655 40.0 37.0 41.0 30.0 41.0 38-39 36.561875 40.0 36.5 41.0 30.0 41.0 40-41 36.3925 39.5 36.0 41.0 30.0 41.0 42-43 36.238375 39.0 36.0 41.0 29.0 41.0 44-45 35.95075 39.0 35.0 40.0 28.0 41.0 46-47 36.0675 39.0 35.5 41.0 28.5 41.0 48-49 35.749875 39.0 35.0 40.5 27.0 41.0 50-51 34.95275 38.0 34.0 39.5 26.0 40.5 52-53 34.998375 38.0 34.5 39.5 27.0 40.5 54-55 35.843375 39.0 35.0 40.5 28.0 41.0 56-57 35.761 39.0 35.0 41.0 27.5 41.0 58-59 35.712375 39.0 35.0 41.0 28.0 41.0 60-61 35.44325 39.0 35.0 41.0 27.0 41.0 62-63 35.11275 38.0 34.5 40.5 26.5 41.0 64-65 34.806375 38.0 34.0 40.0 26.0 41.0 66-67 34.3905 37.0 34.0 40.0 26.0 41.0 68-69 34.071875 37.0 34.0 39.0 26.0 41.0 70-71 33.547 36.0 33.5 39.0 25.5 40.5 72-73 33.082499999999996 35.5 33.0 38.5 24.5 40.0 74-75 32.53675 35.0 33.0 37.0 22.0 39.0 76-77 32.1385 35.0 32.5 37.0 22.0 39.0 78-79 31.561125 35.0 32.0 36.5 20.0 38.5 80-81 31.360875 35.0 32.0 36.0 20.0 37.0 82-83 30.923625 35.0 31.5 35.5 18.5 37.0 84-85 30.534625 34.5 31.0 35.0 16.0 36.5 86-87 30.1515 34.0 31.0 35.0 9.5 36.0 88-89 29.974 34.0 31.0 35.0 7.0 36.0 90-91 29.760624999999997 34.0 31.0 35.0 4.5 35.0 92-93 29.472749999999998 34.0 30.0 35.0 2.0 35.0 94-95 29.186374999999998 34.0 30.0 35.0 2.0 35.0 96-97 28.800125 34.0 30.0 35.0 2.0 35.0 98-99 28.274 34.0 29.0 35.0 2.0 35.0 100-101 27.298375 33.5 27.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 32.0 3 8.0 4 6.0 5 6.0 6 7.0 7 6.0 8 8.0 9 12.0 10 10.0 11 10.0 12 14.0 13 19.0 14 15.0 15 15.0 16 20.0 17 20.0 18 19.0 19 16.0 20 21.0 21 18.0 22 24.0 23 23.0 24 26.0 25 34.0 26 35.0 27 38.0 28 54.0 29 59.0 30 82.0 31 70.0 32 135.0 33 138.0 34 198.0 35 280.0 36 513.0 37 894.0 38 991.0 39 124.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.65 24.4 10.525 34.425 2 26.3 24.825 32.300000000000004 16.575 3 19.1 27.450000000000003 32.550000000000004 20.9 4 22.7 32.875 24.7 19.725 5 23.799999999999997 36.425000000000004 22.8 16.975 6 20.200000000000003 39.2 22.525000000000002 18.075 7 19.8 22.900000000000002 37.325 19.975 8 19.925 26.05 29.049999999999997 24.975 9 21.05 25.1 31.374999999999996 22.475 10-11 22.25 32.275 24.8625 20.6125 12-13 23.925 26.5375 27.037499999999998 22.5 14-15 21.9625 28.487499999999997 27.625 21.925 16-17 23.502937867233403 27.25340667583448 27.603450431303912 21.640205025628205 18-19 22.375 29.612500000000004 26.900000000000002 21.1125 20-21 22.5625 29.0875 27.400000000000002 20.95 22-23 22.412499999999998 28.262500000000003 27.787499999999998 21.5375 24-25 23.1 27.900000000000002 27.85 21.15 26-27 22.5625 28.825 27.675 20.9375 28-29 23.2375 27.55 27.224999999999998 21.987499999999997 30-31 23.200000000000003 27.700000000000003 28.1625 20.9375 32-33 23.200000000000003 28.549999999999997 26.900000000000002 21.349999999999998 34-35 23.1 27.6875 27.8625 21.349999999999998 36-37 22.4625 28.037499999999998 28.212500000000002 21.2875 38-39 22.725 28.599999999999998 26.474999999999998 22.2 40-41 23.1625 28.625 26.687499999999996 21.525 42-43 23.674999999999997 27.925 28.375 20.025000000000002 44-45 23.4125 28.075 27.4125 21.099999999999998 46-47 22.4875 28.1625 27.775 21.575 48-49 23.1625 27.6875 28.375 20.775 50-51 22.775000000000002 28.175 27.750000000000004 21.3 52-53 23.3375 28.4125 27.125 21.125 54-55 22.7 28.225 27.0625 22.0125 56-57 22.825 28.725 27.1125 21.337500000000002 58-59 23.125 28.6625 27.5875 20.625 60-61 22.912499999999998 27.700000000000003 27.8125 21.575 62-63 22.75 28.475 27.237499999999997 21.5375 64-65 23.5875 28.1625 27.0125 21.2375 66-67 23.1 27.725 27.6 21.575 68-69 24.025 27.800000000000004 27.224999999999998 20.95 70-71 22.9875 28.7 27.462500000000002 20.849999999999998 72-73 23.5125 29.175 26.775 20.5375 74-75 22.775000000000002 28.825 26.474999999999998 21.925 76-77 22.5 29.1125 27.125 21.2625 78-79 22.5125 28.962500000000002 26.825 21.7 80-81 22.975 29.075 26.674999999999997 21.275 82-83 23.9875 28.6625 26.5625 20.7875 84-85 22.5 28.749999999999996 27.900000000000002 20.849999999999998 86-87 23.3625 28.1375 26.825 21.675 88-89 23.0 28.599999999999998 27.375 21.025 90-91 22.787499999999998 28.075 27.8125 21.325 92-93 23.825 27.625 27.6625 20.8875 94-95 23.525 28.925 26.7125 20.837500000000002 96-97 24.1125 28.4375 26.937499999999996 20.5125 98-99 23.674999999999997 28.999999999999996 26.1625 21.1625 100-101 23.7125 28.075 26.8 21.4125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 1.0 20 0.5 21 0.0 22 0.0 23 0.0 24 1.5 25 3.5 26 3.5 27 5.0 28 4.5 29 6.5 30 14.5 31 18.0 32 24.5 33 37.0 34 48.0 35 64.5 36 90.0 37 114.5 38 145.5 39 178.5 40 202.0 41 232.5 42 256.5 43 267.0 44 273.5 45 272.5 46 260.0 47 248.5 48 222.0 49 180.5 50 147.5 51 122.0 52 112.5 53 100.0 54 71.5 55 49.0 56 43.0 57 40.0 58 35.5 59 24.0 60 13.5 61 10.5 62 10.0 63 8.0 64 6.5 65 7.5 66 5.5 67 4.5 68 4.0 69 2.0 70 1.0 71 0.5 72 1.0 73 1.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0125 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.1125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.16249999999999998 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.25 0.0 0.0 0.0 0.0 74-75 0.275 0.0 0.0 0.0 0.0 76-77 0.30000000000000004 0.0 0.0 0.0 0.0 78-79 0.3625 0.0 0.0 0.0 0.0 80-81 0.4375 0.0 0.0 0.0 0.0 82-83 0.6125 0.0 0.0 0.0 0.0 84-85 0.7250000000000001 0.0 0.0 0.0 0.0 86-87 1.05 0.0 0.0 0.0 0.0 88-89 1.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 890006 spots for ERR1864464.sra Written 890006 spots for ERR1864464.sra Read 890006 spots for ERR1864464.sra Written 890006 spots for ERR1864464.sra Read 890006 spots for ERR1864464.sra Written 890006 spots for ERR1864464.sra Read 890006 spots for ERR1864464.sra Written 890006 spots for ERR1864464.sra Read 890006 spots for ERR1864464.sra Written 890006 spots for ERR1864464.sra Read 890007 spots for ERR1864464.sra Written 890007 spots for ERR1864464.sra Read 890006 spots for ERR1864464.sra Written 890006 spots for ERR1864464.sra Read 890006 spots for ERR1864464.sra Written 890006 spots for ERR1864464.sra Read 890006 spots for ERR1864464.sra Written 890006 spots for ERR1864464.sra Read 890006 spots for ERR1864464.sra Written 890006 spots for ERR1864464.sra Read 890006 spots for ERR1864464.sra Written 890006 spots for ERR1864464.sra Read 890006 spots for ERR1864464.sra Written 890006 spots for ERR1864464.sra Read 890006 spots for ERR1864464.sra Written 890006 spots for ERR1864464.sra Read 890006 spots for ERR1864464.sra Written 890006 spots for ERR1864464.sra Read 890006 spots for ERR1864464.sra Written 890006 spots for ERR1864464.sra Read 890006 spots for ERR1864464.sra Written 890006 spots for ERR1864464.sra Read 890006 spots for ERR1864464.sra Written 890006 spots for ERR1864464.sra Read 890006 spots for ERR1864464.sra Written 890006 spots for ERR1864464.sra Read 890006 spots for ERR1864464.sra Written 890006 spots for ERR1864464.sra Read 890006 spots for ERR1864464.sra Written 890006 spots for ERR1864464.sra SRR ids: ['ERR1864464.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7r_dfcc6 ERR1864464.sra spots: 17800121 blocks: [[1, 890006], [890007, 1780012], [1780013, 2670018], [2670019, 3560024], [3560025, 4450030], [4450031, 5340036], [5340037, 6230042], [6230043, 7120048], [7120049, 8010054], [8010055, 8900060], [8900061, 9790066], [9790067, 10680072], [10680073, 11570078], [11570079, 12460084], [12460085, 13350090], [13350091, 14240096], [14240097, 15130102], [15130103, 16020108], [16020109, 16910114], [16910115, 17800121]] ERR1864464 file size 4271883 ERR1864464 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864464 ERR1864464_1.fastq ERR1864464_2.fastq Input file: ERR1864464_1.fastq Paired file: ERR1864464_2.fastq trimmed: ERR1864464-trimmed-pair1.fastq, ERR1864464-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:22:44 2025 >> started Thu Feb 13 13:23:00 2025 >> done (16.009s) 17800121 read pairs processed; of these: 331998 ( 1.87%) short read pairs filtered out after trimming by size control 402158 ( 2.26%) empty read pairs filtered out after trimming by size control 17065965 (95.88%) read pairs available; of these: 4214592 (24.70%) trimmed read pairs available after processing 12851373 (75.30%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 163 0.00% 19 391 0.00% 20 535 0.00% 21 757 0.00% 22 1022 0.01% 23 1291 0.01% 24 1520 0.01% 25 1746 0.01% 26 2120 0.01% 27 2396 0.01% 28 2733 0.02% 29 3100 0.02% 30 3579 0.02% 31 3867 0.02% 32 4442 0.03% 33 4819 0.03% 34 5332 0.03% 35 5634 0.03% 36 5947 0.03% 37 6536 0.04% 38 6624 0.04% 39 7234 0.04% 40 7485 0.04% 41 7931 0.05% 42 8469 0.05% 43 8732 0.05% 44 9179 0.05% 45 9641 0.06% 46 10136 0.06% 47 10592 0.06% 48 11144 0.07% 49 11207 0.07% 50 11996 0.07% 51 12291 0.07% 52 12935 0.08% 53 13386 0.08% 54 14005 0.08% 55 15120 0.09% 56 15579 0.09% 57 16431 0.10% 58 17476 0.10% 59 21898 0.13% 60 26255 0.15% 61 26410 0.15% 62 27043 0.16% 63 27576 0.16% 64 28777 0.17% 65 29836 0.17% 66 30644 0.18% 67 32478 0.19% 68 33565 0.20% 69 35137 0.21% 70 36568 0.21% 71 37805 0.22% 72 39792 0.23% 73 41924 0.25% 74 43210 0.25% 75 44094 0.26% 76 44506 0.26% 77 45478 0.27% 78 48266 0.28% 79 50755 0.30% 80 54248 0.32% 81 56599 0.33% 82 58700 0.34% 83 62944 0.37% 84 67246 0.39% 85 71473 0.42% 86 76292 0.45% 87 81059 0.47% 88 82752 0.48% 89 86613 0.51% 90 94362 0.55% 91 104752 0.61% 92 116765 0.68% 93 129844 0.76% 94 146220 0.86% 95 167311 0.98% 96 197031 1.15% 97 240129 1.41% 98 310525 1.82% 99 408799 2.40% 100 553388 3.24% 101 12851373 75.30% 17065965 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=3.98 fanout-score-rank=21 prefix-density=0.26 prefix-fanout=3.6 sequence=TTGTCATAAGATGTAGCAGTAGGCTGTGGGCCAAAATCCTTGACAAAATTATTCTTTTCATTGGACTCGGTTGTGTGGCAATCGGCTTTCTCATTGGAGACTGATGACAAT criterion=fanout-score sequence-density=0.06 sequence-density-rank=20 fanout-score=295.19 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=25.1 sequence=TCTTCTTCTTCTC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=30 prefix-density=0.17 prefix-fanout=2.2 sequence=CTCAGTTGTTCCTTTACAATGATGGTGTCGTTAAAGGAGAGAGATCCTTTGCTGAGGATCTTGAGCCGAGGCCTAATGTGTCCGTTTACCACGACGACGCTACTCTTAAAGGAGAAAAATCTTTTCCGGAGGACTTCGAACCAGGGCCTAACATATCAGTTTATGATGATGGTGTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=8 fanout-score=249.51 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=27.5 sequence=AAGAAGAAGAAA ERR1864464 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:23:32 Started mapping on | Feb 13 13:23:32 Finished on | Feb 13 13:24:37 Mapping speed, Million of reads per hour | 945.19 Number of input reads | 17065965 Average input read length | 194 UNIQUE READS: Uniquely mapped reads number | 15956121 Uniquely mapped reads % | 93.50% Average mapped length | 194.93 Number of splices: Total | 8494186 Number of splices: Annotated (sjdb) | 8345884 Number of splices: GT/AG | 8369542 Number of splices: GC/AG | 102277 Number of splices: AT/AC | 8475 Number of splices: Non-canonical | 13892 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 2.43 Insertion rate per base | 0.01% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 535415 % of reads mapped to multiple loci | 3.14% Number of reads mapped to too many loci | 60544 % of reads mapped to too many loci | 0.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.97% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 607308 607308 607308 N_multimapping 535415 535415 535415 N_noFeature 414156 15801602 499526 N_ambiguous 141784 675 72289 UnstrandedReadsAssigned:15400181 PositiveStrandReadsAssigned:153844 NegativeStrandReadsAssigned:15384306 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864464 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864464-trimmed-pair1.fastq ERR1864464-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,065,965 reads, 15,700,228 reads pseudoaligned [quant] estimated average fragment length: 158.433 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,089 rounds 52401 ERR1864464.ke.tsv 34699 ERR1864464.se.tsv 87100 total ==> ERR1864464.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1860.57 3655 138.788 Potri.005G024800.1.v4.1 1035 877.567 1387 111.662 Potri.004G059700.1.v4.1 961 803.567 161 14.1551 Potri.007G009000.2.v4.1 1416 1258.57 0 0 Potri.003G141000.2.v4.1 2943 2785.57 775.778 19.6759 Potri.016G087400.1.v4.1 270 120.386 837.481 491.485 Potri.015G069301.1.v4.1 564 406.735 0 0 Potri.010G195200.1.v4.1 1773 1615.57 41 1.79295 Potri.012G127500.1.v4.1 977 819.567 4739 408.519 ==> ERR1864464.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 131 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 261 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 462 ERR1864464 completed mapping pipeline successfully