Starting /dee2/code/volunteer_pipeline.sh ERR1864465 current disk space = 3091561558016 free memory = 1494169800 ERR1864465 SRAfilesize d2228584b9341010e794a1ae7283a610 ERR1864465.sra ERR1864465.sra file validated ERR1864465 is paired end ERR1864465 is conventional basespace ERR1864465 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864465_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.2605 34.0 31.0 34.0 30.0 34.0 2 31.835 34.0 31.0 34.0 28.0 34.0 3 32.344 34.0 31.0 34.0 30.0 34.0 4 35.8645 37.0 35.0 37.0 35.0 37.0 5 35.72125 37.0 35.0 37.0 35.0 37.0 6 35.577 37.0 36.0 37.0 35.0 37.0 7 35.681 37.0 36.0 37.0 35.0 37.0 8 35.72475 37.0 37.0 37.0 35.0 37.0 9 37.36675 39.0 38.0 39.0 35.0 39.0 10-11 37.371375 39.0 38.0 39.0 35.0 39.0 12-13 37.256125 39.0 38.0 39.0 35.0 39.0 14-15 38.808 41.0 39.0 41.0 35.5 41.0 16-17 38.654875000000004 41.0 39.0 41.0 35.0 41.0 18-19 38.683375 41.0 39.0 41.0 35.0 41.0 20-21 38.559375 41.0 39.0 41.0 34.0 41.0 22-23 38.529875000000004 41.0 39.0 41.0 34.0 41.0 24-25 38.460375 41.0 39.0 41.0 34.5 41.0 26-27 38.344625 41.0 38.5 41.0 34.0 41.0 28-29 38.34287500000001 40.0 38.5 41.0 34.0 41.0 30-31 38.24525 40.0 38.0 41.0 34.0 41.0 32-33 38.21425 40.0 38.0 41.0 34.0 41.0 34-35 38.020875000000004 40.0 38.0 41.0 33.0 41.0 36-37 37.88275 40.0 38.0 41.0 33.0 41.0 38-39 37.91475 40.0 38.0 41.0 33.0 41.0 40-41 37.738 40.0 38.0 41.0 33.0 41.0 42-43 37.54325 40.0 38.0 41.0 32.5 41.0 44-45 37.486375 40.0 37.5 41.0 32.5 41.0 46-47 37.606875 40.0 38.0 41.0 32.5 41.0 48-49 37.617375 40.0 38.0 41.0 33.0 41.0 50-51 37.512125 40.0 38.0 41.0 33.0 41.0 52-53 37.36625 40.0 37.0 41.0 32.0 41.0 54-55 37.135625000000005 40.0 37.0 41.0 31.0 41.0 56-57 36.938625 40.0 36.5 41.0 31.5 41.0 58-59 36.76225 40.0 36.0 41.0 31.0 41.0 60-61 36.5415 39.0 36.0 41.0 31.0 41.0 62-63 36.32325 39.0 35.0 40.5 30.5 41.0 64-65 35.96275 38.5 35.0 40.0 29.5 41.0 66-67 35.575125 38.0 35.0 40.0 29.5 41.0 68-69 35.199375 37.0 35.0 40.0 28.5 41.0 70-71 34.6245 37.0 34.0 39.0 28.0 41.0 72-73 34.2365 36.0 34.0 39.0 28.5 40.0 74-75 33.703125 35.5 34.0 38.0 27.0 39.5 76-77 32.58125 35.0 32.0 37.0 26.0 39.0 78-79 32.7845 35.0 33.0 37.0 26.0 39.0 80-81 32.543499999999995 35.0 33.0 36.0 26.0 37.5 82-83 32.322125 35.0 33.0 36.0 26.0 37.0 84-85 32.04875 35.0 33.0 35.0 26.0 37.0 86-87 31.764875 35.0 33.0 35.0 25.5 36.0 88-89 31.486125 35.0 32.5 35.0 25.0 36.0 90-91 31.12375 34.0 32.0 35.0 24.5 35.5 92-93 30.8485 34.0 32.0 35.0 22.5 35.0 94-95 30.6955 34.0 31.0 35.0 23.0 35.0 96-97 30.499 34.0 31.0 35.0 20.0 35.0 98-99 30.240875000000003 34.0 31.0 35.0 18.0 35.0 100-101 29.491625 34.0 30.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 27.0 3 16.0 4 4.0 5 4.0 6 5.0 7 3.0 8 4.0 9 2.0 10 5.0 11 10.0 12 6.0 13 9.0 14 6.0 15 6.0 16 5.0 17 11.0 18 16.0 19 8.0 20 10.0 21 16.0 22 18.0 23 10.0 24 16.0 25 19.0 26 25.0 27 27.0 28 35.0 29 42.0 30 61.0 31 68.0 32 86.0 33 126.0 34 171.0 35 236.0 36 456.0 37 902.0 38 1358.0 39 171.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.255009107468126 6.0629716367421285 7.624251886546969 46.05776736924278 2 24.95 8.525 35.975 30.55 3 24.131032758189548 12.80320080020005 22.980745186296573 40.085021255313826 4 28.4 20.375 20.4 30.825000000000003 5 27.075 25.2 26.724999999999998 21.0 6 22.0 29.325000000000003 26.275 22.400000000000002 7 16.0 23.175 43.925 16.900000000000002 8 18.375 23.474999999999998 36.449999999999996 21.7 9 17.95 21.525 39.275 21.25 10-11 20.025000000000002 32.025 28.575 19.375 12-13 21.05 25.7375 30.85 22.3625 14-15 20.5125 27.400000000000002 30.5125 21.575 16-17 20.724999999999998 27.8875 28.749999999999996 22.6375 18-19 20.775 27.224999999999998 28.5875 23.4125 20-21 20.625 27.775 29.799999999999997 21.8 22-23 21.6125 28.000000000000004 28.825 21.5625 24-25 21.175 27.875 27.900000000000002 23.05 26-27 20.625 28.3875 28.212500000000002 22.775000000000002 28-29 21.2 28.4 28.4375 21.9625 30-31 20.075000000000003 27.474999999999998 28.462500000000002 23.9875 32-33 20.6875 27.450000000000003 29.25 22.6125 34-35 20.5125 27.987499999999997 28.425 23.075000000000003 36-37 20.7375 28.512500000000003 27.825 22.925 38-39 19.8625 28.512500000000003 27.6375 23.9875 40-41 20.4875 28.262500000000003 28.4 22.85 42-43 20.75 27.775 28.3625 23.1125 44-45 21.1625 27.325 28.175 23.3375 46-47 20.575 28.349999999999998 28.725 22.35 48-49 20.674999999999997 28.237499999999997 27.950000000000003 23.1375 50-51 21.275 27.85 28.3375 22.537499999999998 52-53 20.885442721360683 28.65182591295648 27.926463231615806 22.536268134067033 54-55 20.7875 28.712500000000002 27.875 22.625 56-57 20.1875 29.062500000000004 28.462500000000002 22.287499999999998 58-59 20.9375 28.15 26.987499999999997 23.925 60-61 21.175 28.499999999999996 27.55 22.775000000000002 62-63 20.849999999999998 28.3625 28.1875 22.6 64-65 20.77028885832187 28.060522696011002 27.79792422158309 23.371264224084033 66-67 20.820307615355755 27.935475803426286 27.810428910841566 23.43378767037639 68-69 20.70302727045284 28.121090818113586 27.89592194145609 23.279959969977483 70-71 20.857821683131174 28.385644616731277 27.64786795048143 23.108665749656122 72-73 21.330332583145786 28.66966741685421 27.544386096524132 22.455613903475868 74-75 20.965724293219914 27.60820615461596 28.29622216662497 23.129847385539154 76-77 21.10527631907977 28.982245561390346 27.619404851212803 22.29307326831708 78-79 21.075 29.099999999999998 27.474999999999998 22.35 80-81 21.425 28.3625 28.075 22.1375 82-83 21.6875 28.349999999999998 27.200000000000003 22.7625 84-85 20.9875 27.650000000000002 28.125 23.2375 86-87 21.224999999999998 27.975 27.212500000000002 23.5875 88-89 22.35 27.950000000000003 27.287499999999998 22.412499999999998 90-91 22.1875 27.6 27.675 22.537499999999998 92-93 21.898449224612307 26.863431715857928 28.76438219109555 22.473736868434216 94-95 20.91772943235809 28.432108027006752 27.86946736684171 22.780695173793447 96-97 21.425 28.1875 27.1375 23.25 98-99 21.349999999999998 28.275 27.250000000000004 23.125 100-101 21.9375 29.6375 25.85 22.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 2.0 25 3.5 26 2.5 27 7.0 28 10.5 29 10.5 30 14.5 31 18.5 32 20.5 33 29.0 34 49.5 35 71.5 36 85.5 37 100.5 38 134.0 39 159.0 40 190.5 41 208.5 42 228.5 43 262.0 44 267.5 45 283.5 46 303.5 47 266.5 48 227.0 49 204.0 50 163.0 51 140.0 52 118.5 53 105.5 54 81.5 55 50.5 56 35.5 57 29.0 58 28.0 59 20.5 60 17.0 61 14.5 62 10.5 63 8.5 64 4.5 65 2.5 66 3.0 67 3.0 68 1.0 69 0.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.925 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.05 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0375 66-67 0.0375 68-69 0.075 70-71 0.0375 72-73 0.025 74-75 0.075 76-77 0.025 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.05 94-95 0.025 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19334509705067 98.375 2 0.7814469372321654 1.55 3 0.025207965717166627 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.21250000000000002 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.30000000000000004 0.0 0.0 0.0 0.0 80-81 0.375 0.0 0.0 0.0 0.0 82-83 0.475 0.0 0.0 0.0 0.0 84-85 0.625 0.0 0.0 0.0 0.0 86-87 0.775 0.0 0.0 0.0 0.0 88-89 1.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864465 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864465_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.269 34.0 31.0 34.0 31.0 34.0 2 32.42725 34.0 31.0 34.0 31.0 34.0 3 32.35725 34.0 31.0 34.0 30.0 34.0 4 35.74525 37.0 37.0 37.0 35.0 37.0 5 35.7875 37.0 37.0 37.0 35.0 37.0 6 35.80775 37.0 37.0 37.0 35.0 37.0 7 35.671 37.0 37.0 37.0 35.0 37.0 8 35.65975 37.0 37.0 37.0 35.0 37.0 9 37.434 39.0 38.0 39.0 35.0 39.0 10-11 37.328125 39.0 38.0 39.0 35.0 39.0 12-13 37.274 39.0 38.0 39.0 34.5 39.0 14-15 38.641 41.0 39.0 41.0 34.5 41.0 16-17 38.68425 41.0 39.0 41.0 34.0 41.0 18-19 38.688500000000005 41.0 39.0 41.0 35.0 41.0 20-21 38.527875 41.0 39.0 41.0 34.0 41.0 22-23 38.53 40.5 39.0 41.0 34.0 41.0 24-25 38.23475 40.5 38.5 41.0 33.5 41.0 26-27 38.144625 40.0 38.0 41.0 33.0 41.0 28-29 38.06525 40.0 38.0 41.0 33.0 41.0 30-31 38.032125 40.0 38.0 41.0 33.0 41.0 32-33 37.914125 40.0 38.0 41.0 33.0 41.0 34-35 37.967 40.0 38.0 41.0 33.0 41.0 36-37 37.913375 40.0 38.0 41.0 33.0 41.0 38-39 37.786125 40.0 38.0 41.0 33.0 41.0 40-41 37.735375000000005 40.0 38.0 41.0 33.0 41.0 42-43 37.532875000000004 40.0 38.0 41.0 31.5 41.0 44-45 37.2085 40.0 37.5 41.0 31.0 41.0 46-47 36.9435 40.0 37.0 41.0 30.5 41.0 48-49 36.884874999999994 40.0 37.0 41.0 30.5 41.0 50-51 36.63525 39.5 36.5 40.5 30.5 41.0 52-53 36.836875000000006 39.5 37.0 40.5 31.0 41.0 54-55 36.996625 40.0 37.0 41.0 31.0 41.0 56-57 36.933125000000004 40.0 37.0 41.0 31.0 41.0 58-59 36.8295 40.0 36.5 41.0 31.0 41.0 60-61 36.306749999999994 39.0 36.0 41.0 29.5 41.0 62-63 36.095375000000004 39.0 35.5 41.0 29.0 41.0 64-65 35.838625 39.0 35.0 40.5 29.5 41.0 66-67 35.426625 38.0 35.0 40.0 28.5 41.0 68-69 35.019999999999996 37.0 35.0 39.5 28.5 41.0 70-71 34.539125 37.0 34.0 39.0 28.0 41.0 72-73 34.13975 36.0 34.0 39.0 28.0 40.5 74-75 33.540875 35.5 34.0 37.5 26.0 39.0 76-77 33.153625 35.0 33.5 37.0 26.0 39.0 78-79 32.771874999999994 35.0 33.5 37.0 26.0 39.0 80-81 32.384125 35.0 33.0 36.0 26.0 37.0 82-83 31.6785 35.0 32.0 35.5 23.5 37.0 84-85 31.647375 35.0 32.5 35.0 24.5 36.5 86-87 31.46425 35.0 32.5 35.0 24.0 36.0 88-89 31.158875000000002 35.0 32.0 35.0 23.5 36.0 90-91 30.926000000000002 35.0 32.0 35.0 20.0 35.5 92-93 30.7045 34.5 32.0 35.0 19.5 35.0 94-95 30.406 34.5 31.5 35.0 17.5 35.0 96-97 30.140875 34.0 31.0 35.0 12.5 35.0 98-99 29.84975 34.0 31.0 35.0 2.0 35.0 100-101 28.847749999999998 33.5 30.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 9.0 4 4.0 5 1.0 6 6.0 7 4.0 8 5.0 9 7.0 10 8.0 11 9.0 12 8.0 13 15.0 14 11.0 15 8.0 16 11.0 17 13.0 18 12.0 19 18.0 20 13.0 21 11.0 22 19.0 23 30.0 24 23.0 25 33.0 26 23.0 27 24.0 28 24.0 29 65.0 30 56.0 31 79.0 32 85.0 33 110.0 34 152.0 35 244.0 36 428.0 37 956.0 38 1260.0 39 201.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.125 18.725 13.600000000000001 37.55 2 24.474999999999998 23.775 34.375 17.375 3 19.675 27.675 30.349999999999998 22.3 4 21.775 34.725 23.75 19.75 5 23.599999999999998 35.9 23.575 16.925 6 19.7 38.15 24.0 18.15 7 18.85 21.349999999999998 39.475 20.325 8 21.75 24.224999999999998 29.375 24.65 9 21.725 23.575 30.625000000000004 24.075 10-11 23.0125 32.337500000000006 24.525 20.125 12-13 23.0375 25.974999999999998 27.3 23.6875 14-15 22.5625 28.125 27.725 21.587500000000002 16-17 22.8375 28.275 27.3875 21.5 18-19 22.35 28.762500000000003 27.462500000000002 21.425 20-21 23.3125 28.462500000000002 26.35 21.875 22-23 22.037499999999998 28.275 28.512500000000003 21.175 24-25 22.4875 27.3875 28.6375 21.4875 26-27 22.725 29.262500000000003 27.1375 20.875 28-29 23.0375 27.250000000000004 27.775 21.9375 30-31 22.400000000000002 27.700000000000003 28.075 21.825 32-33 22.45 28.3625 28.025 21.1625 34-35 22.575 28.8875 26.9625 21.575 36-37 23.5875 27.787499999999998 27.85 20.775 38-39 23.0375 28.0625 28.449999999999996 20.45 40-41 23.05 28.275 27.425 21.25 42-43 22.112499999999997 27.925 28.675 21.2875 44-45 22.25 28.5625 27.875 21.3125 46-47 23.775 27.650000000000002 27.400000000000002 21.175 48-49 22.537499999999998 28.9 27.5125 21.05 50-51 21.825 28.475 27.400000000000002 22.3 52-53 22.425 28.1375 27.8875 21.55 54-55 22.9625 27.075 29.15 20.8125 56-57 22.9375 28.037499999999998 27.375 21.65 58-59 22.825 28.3875 27.700000000000003 21.087500000000002 60-61 22.5125 28.475 27.8875 21.125 62-63 23.225 27.787499999999998 28.037499999999998 20.95 64-65 23.1875 28.6375 28.012500000000003 20.1625 66-67 22.35 28.725 27.224999999999998 21.7 68-69 23.5375 26.75 27.975 21.7375 70-71 23.1875 28.525 27.650000000000002 20.6375 72-73 22.4375 28.8375 27.6125 21.1125 74-75 23.5625 28.4 27.4125 20.625 76-77 22.8875 28.812500000000004 28.050000000000004 20.25 78-79 22.900000000000002 27.125 28.525 21.45 80-81 22.95 27.55 27.950000000000003 21.55 82-83 24.075 27.3125 27.85 20.7625 84-85 22.162499999999998 29.037499999999998 27.650000000000002 21.15 86-87 23.2125 28.325 27.3375 21.125 88-89 23.4875 28.487499999999997 27.474999999999998 20.549999999999997 90-91 23.8625 28.075 27.6375 20.424999999999997 92-93 23.075000000000003 28.287499999999998 28.0875 20.549999999999997 94-95 24.6125 27.5875 27.1625 20.6375 96-97 22.287499999999998 28.037499999999998 29.549999999999997 20.125 98-99 22.0125 29.912499999999998 26.687499999999996 21.3875 100-101 23.575 29.0875 26.174999999999997 21.1625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 1.0 24 2.0 25 2.5 26 2.5 27 6.0 28 9.5 29 13.0 30 16.5 31 23.0 32 31.5 33 35.0 34 41.0 35 62.0 36 86.0 37 105.0 38 133.0 39 175.5 40 216.0 41 233.0 42 257.0 43 274.0 44 259.0 45 267.5 46 276.5 47 252.5 48 226.0 49 199.0 50 163.0 51 131.0 52 110.0 53 91.5 54 73.5 55 53.5 56 39.5 57 29.5 58 24.5 59 21.5 60 12.5 61 9.5 62 8.0 63 6.0 64 6.0 65 3.5 66 0.5 67 0.5 68 1.0 69 0.5 70 0.0 71 0.5 72 0.5 73 0.5 74 0.5 75 1.0 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.21250000000000002 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.35 0.0 0.0 0.0 0.0 82-83 0.45 0.0 0.0 0.0 0.0 84-85 0.6000000000000001 0.0 0.0 0.0 0.0 86-87 0.75 0.0 0.0 0.0 0.0 88-89 0.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAGA 15 0.009957196 47.5 86-87 >>END_MODULE Read 829533 spots for ERR1864465.sra Written 829533 spots for ERR1864465.sra Read 829533 spots for ERR1864465.sra Written 829533 spots for ERR1864465.sra Read 829533 spots for ERR1864465.sra Written 829533 spots for ERR1864465.sra Read 829533 spots for ERR1864465.sra Written 829533 spots for ERR1864465.sra Read 829533 spots for ERR1864465.sra Written 829533 spots for ERR1864465.sra Read 829533 spots for ERR1864465.sra Written 829533 spots for ERR1864465.sra Read 829533 spots for ERR1864465.sra Written 829533 spots for ERR1864465.sra Read 829533 spots for ERR1864465.sra Written 829533 spots for ERR1864465.sra Read 829533 spots for ERR1864465.sra Written 829533 spots for ERR1864465.sra Read 829533 spots for ERR1864465.sra Written 829533 spots for ERR1864465.sra Read 829533 spots for ERR1864465.sra Written 829533 spots for ERR1864465.sra Read 829533 spots for ERR1864465.sra Written 829533 spots for ERR1864465.sra Read 829543 spots for ERR1864465.sra Written 829543 spots for ERR1864465.sra Read 829533 spots for ERR1864465.sra Written 829533 spots for ERR1864465.sra Read 829533 spots for ERR1864465.sra Written 829533 spots for ERR1864465.sra Read 829533 spots for ERR1864465.sra Written 829533 spots for ERR1864465.sra Read 829533 spots for ERR1864465.sra Written 829533 spots for ERR1864465.sra Read 829533 spots for ERR1864465.sra Written 829533 spots for ERR1864465.sra Read 829533 spots for ERR1864465.sra Written 829533 spots for ERR1864465.sra Read 829533 spots for ERR1864465.sra Written 829533 spots for ERR1864465.sra SRR ids: ['ERR1864465.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d_alzdje ERR1864465.sra spots: 16590670 blocks: [[1, 829533], [829534, 1659066], [1659067, 2488599], [2488600, 3318132], [3318133, 4147665], [4147666, 4977198], [4977199, 5806731], [5806732, 6636264], [6636265, 7465797], [7465798, 8295330], [8295331, 9124863], [9124864, 9954396], [9954397, 10783929], [10783930, 11613462], [11613463, 12442995], [12442996, 13272528], [13272529, 14102061], [14102062, 14931594], [14931595, 15761127], [15761128, 16590670]] ERR1864465 file size 3980150 ERR1864465 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864465 ERR1864465_1.fastq ERR1864465_2.fastq Input file: ERR1864465_1.fastq Paired file: ERR1864465_2.fastq trimmed: ERR1864465-trimmed-pair1.fastq, ERR1864465-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 12:55:51 2025 >> started Thu Feb 13 12:56:06 2025 >> done (15.441s) 16590670 read pairs processed; of these: 242012 ( 1.46%) short read pairs filtered out after trimming by size control 287812 ( 1.73%) empty read pairs filtered out after trimming by size control 16060846 (96.81%) read pairs available; of these: 3692491 (22.99%) trimmed read pairs available after processing 12368355 (77.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 127 0.00% 19 251 0.00% 20 389 0.00% 21 571 0.00% 22 722 0.00% 23 855 0.01% 24 1058 0.01% 25 1222 0.01% 26 1371 0.01% 27 1642 0.01% 28 1890 0.01% 29 2202 0.01% 30 2433 0.02% 31 2809 0.02% 32 3053 0.02% 33 3553 0.02% 34 3819 0.02% 35 4148 0.03% 36 4532 0.03% 37 4799 0.03% 38 5465 0.03% 39 5586 0.03% 40 6106 0.04% 41 6429 0.04% 42 6800 0.04% 43 7199 0.04% 44 7527 0.05% 45 7863 0.05% 46 8404 0.05% 47 8786 0.05% 48 9120 0.06% 49 9557 0.06% 50 10174 0.06% 51 10544 0.07% 52 11039 0.07% 53 11534 0.07% 54 12150 0.08% 55 12668 0.08% 56 13311 0.08% 57 14095 0.09% 58 14938 0.09% 59 18911 0.12% 60 22547 0.14% 61 23305 0.15% 62 23806 0.15% 63 24728 0.15% 64 25454 0.16% 65 26531 0.17% 66 27708 0.17% 67 28502 0.18% 68 29786 0.19% 69 31048 0.19% 70 32266 0.20% 71 33550 0.21% 72 35124 0.22% 73 36791 0.23% 74 37749 0.24% 75 38922 0.24% 76 38727 0.24% 77 40838 0.25% 78 42861 0.27% 79 45215 0.28% 80 47598 0.30% 81 49483 0.31% 82 52397 0.33% 83 54974 0.34% 84 57564 0.36% 85 60858 0.38% 86 64153 0.40% 87 67087 0.42% 88 69064 0.43% 89 73146 0.46% 90 80138 0.50% 91 88637 0.55% 92 97496 0.61% 93 108759 0.68% 94 122989 0.77% 95 142648 0.89% 96 170422 1.06% 97 211701 1.32% 98 274440 1.71% 99 372166 2.32% 100 521661 3.25% 101 12368355 77.01% 16060846 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=3.87 fanout-score-rank=22 prefix-density=0.22 prefix-fanout=2.8 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.05 sequence-density-rank=24 fanout-score=278.96 fanout-score-rank=1 prefix-density=0.63 prefix-fanout=22.5 sequence=TCTTCTTCTTCCTTTGGAGCTTCGACTGC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=4.10 fanout-score-rank=23 prefix-density=0.22 prefix-fanout=2.3 sequence=AAGACCATCACCCTTGAGGTGGAAAGCTCTGACAC criterion=fanout-score sequence-density=0.07 sequence-density-rank=17 fanout-score=254.31 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=25.2 sequence=AAGAAGAAGAAG ERR1864465 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 12:56:39 Started mapping on | Feb 13 12:56:40 Finished on | Feb 13 12:57:14 Mapping speed, Million of reads per hour | 1700.56 Number of input reads | 16060846 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 15668181 Uniquely mapped reads % | 97.56% Average mapped length | 195.53 Number of splices: Total | 8676935 Number of splices: Annotated (sjdb) | 8539940 Number of splices: GT/AG | 8552827 Number of splices: GC/AG | 103707 Number of splices: AT/AC | 9320 Number of splices: Non-canonical | 11081 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 2.36 Insertion rate per base | 0.01% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 312765 % of reads mapped to multiple loci | 1.95% Number of reads mapped to too many loci | 16246 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.39% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 103595 103595 103595 N_multimapping 312765 312765 312765 N_noFeature 442941 15507853 502230 N_ambiguous 161776 594 60375 UnstrandedReadsAssigned:15063464 PositiveStrandReadsAssigned:159734 NegativeStrandReadsAssigned:15105576 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864465 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864465-trimmed-pair1.fastq ERR1864465-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,060,846 reads, 15,239,507 reads pseudoaligned [quant] estimated average fragment length: 163.86 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,112 rounds 52401 ERR1864465.ke.tsv 34699 ERR1864465.se.tsv 87100 total ==> ERR1864465.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1855.14 859 40.8333 Potri.005G024800.1.v4.1 1035 872.14 108 10.9203 Potri.004G059700.1.v4.1 961 798.14 15 1.65734 Potri.007G009000.2.v4.1 1416 1253.14 0 0 Potri.003G141000.2.v4.1 2943 2780.14 366.359 11.6209 Potri.016G087400.1.v4.1 270 114.953 799 612.949 Potri.015G069301.1.v4.1 564 401.255 0 0 Potri.010G195200.1.v4.1 1773 1610.14 51 2.79322 Potri.012G127500.1.v4.1 977 814.14 326 35.3116 ==> ERR1864465.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1564 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 366 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 44 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 ERR1864465 completed mapping pipeline successfully