Starting /dee2/code/volunteer_pipeline.sh ERR1864466 current disk space = 3091023495168 free memory = 1575960508 ERR1864466 SRAfilesize 305e69649faf3e4a5d2fbfae64345e9b ERR1864466.sra ERR1864466.sra file validated ERR1864466 is paired end ERR1864466 is conventional basespace ERR1864466 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864466_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.18675 34.0 31.0 34.0 30.0 34.0 2 31.747 34.0 31.0 34.0 28.0 34.0 3 32.32275 34.0 31.0 34.0 30.0 34.0 4 35.76875 37.0 35.0 37.0 35.0 37.0 5 35.58075 37.0 35.0 37.0 35.0 37.0 6 35.474 37.0 35.0 37.0 33.0 37.0 7 35.5425 37.0 35.0 37.0 35.0 37.0 8 35.545 37.0 36.0 37.0 35.0 37.0 9 37.24625 39.0 38.0 39.0 35.0 39.0 10-11 37.207625 39.0 38.0 39.0 34.5 39.0 12-13 37.025125 39.0 37.5 39.0 33.5 39.0 14-15 38.611875 41.0 39.0 41.0 34.5 41.0 16-17 38.443625 41.0 38.5 41.0 34.0 41.0 18-19 38.38225 41.0 38.5 41.0 34.0 41.0 20-21 38.2735 41.0 38.5 41.0 33.5 41.0 22-23 38.354 40.5 39.0 41.0 34.0 41.0 24-25 38.2295 40.5 38.0 41.0 34.0 41.0 26-27 38.155375 40.0 38.0 41.0 33.5 41.0 28-29 38.186625 40.0 38.0 41.0 33.5 41.0 30-31 38.017624999999995 40.0 38.0 41.0 33.0 41.0 32-33 37.937625 40.0 38.0 41.0 33.0 41.0 34-35 37.65837500000001 40.0 38.0 41.0 32.5 41.0 36-37 37.70225 40.0 38.0 41.0 33.0 41.0 38-39 37.62075 40.0 38.0 41.0 33.0 41.0 40-41 37.4595 40.0 38.0 41.0 32.0 41.0 42-43 37.324124999999995 40.0 38.0 41.0 31.5 41.0 44-45 37.153875 40.0 37.5 41.0 31.5 41.0 46-47 37.360375 40.0 38.0 41.0 32.0 41.0 48-49 37.305875 40.0 38.0 41.0 32.0 41.0 50-51 37.160624999999996 40.0 37.0 41.0 31.0 41.0 52-53 36.92675 40.0 37.0 41.0 31.0 41.0 54-55 36.77075 40.0 36.5 41.0 31.0 41.0 56-57 36.63875 40.0 36.0 41.0 31.0 41.0 58-59 36.3425 39.0 36.0 41.0 29.5 41.0 60-61 36.1175 39.0 35.5 41.0 29.5 41.0 62-63 35.8285 39.0 35.0 40.5 29.0 41.0 64-65 35.392875000000004 38.0 35.0 40.0 28.5 41.0 66-67 35.054 37.5 34.5 40.0 28.0 41.0 68-69 34.698625 37.0 34.0 39.5 28.0 41.0 70-71 34.263374999999996 36.0 34.0 39.0 28.0 40.5 72-73 33.77075 36.0 34.0 38.5 26.5 40.0 74-75 33.271375 35.0 33.5 37.5 26.0 39.5 76-77 32.193250000000006 34.5 32.0 36.0 25.5 39.0 78-79 32.396 35.0 33.0 36.5 26.0 39.0 80-81 32.173375 35.0 33.0 36.0 26.0 37.0 82-83 31.879625 35.0 32.5 36.0 25.5 37.0 84-85 31.572375 35.0 32.0 35.0 25.0 37.0 86-87 31.37625 35.0 32.0 35.0 24.5 36.0 88-89 31.165374999999997 34.5 32.0 35.0 24.0 36.0 90-91 30.875 34.0 32.0 35.0 23.0 35.5 92-93 30.63625 34.0 31.0 35.0 20.0 35.0 94-95 30.32 34.0 31.0 35.0 18.5 35.0 96-97 30.06475 34.0 31.0 35.0 12.5 35.0 98-99 29.82725 34.0 31.0 35.0 2.0 35.0 100-101 28.911875000000002 33.5 30.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 29.0 3 20.0 4 6.0 5 9.0 6 5.0 7 5.0 8 4.0 9 7.0 10 7.0 11 14.0 12 10.0 13 9.0 14 8.0 15 5.0 16 8.0 17 16.0 18 8.0 19 15.0 20 9.0 21 7.0 22 13.0 23 21.0 24 20.0 25 15.0 26 24.0 27 37.0 28 43.0 29 55.0 30 48.0 31 72.0 32 76.0 33 99.0 34 168.0 35 272.0 36 439.0 37 1038.0 38 1220.0 39 139.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.228690228690226 7.276507276507277 7.224532224532225 45.27027027027027 2 25.3 9.575 35.025 30.099999999999998 3 24.456114028507127 11.552888222055515 23.305826456614152 40.685171292823206 4 29.425 19.725 20.1 30.75 5 28.4 24.575 24.925 22.1 6 21.0 30.075000000000003 26.6 22.325 7 16.275000000000002 24.575 42.449999999999996 16.7 8 19.825 23.775 34.9 21.5 9 19.15 21.475 38.15 21.224999999999998 10-11 20.549999999999997 32.75 27.987499999999997 18.712500000000002 12-13 20.474999999999998 26.125 30.7625 22.6375 14-15 20.5 27.825 29.462500000000002 22.2125 16-17 21.55 28.037499999999998 27.425 22.9875 18-19 20.6625 28.787499999999998 27.437499999999996 23.1125 20-21 21.375 28.449999999999996 28.675 21.5 22-23 20.95 28.3875 27.725 22.9375 24-25 20.549999999999997 28.9375 27.450000000000003 23.0625 26-27 20.7625 27.800000000000004 28.050000000000004 23.3875 28-29 21.3 28.0875 27.375 23.2375 30-31 21.25 27.537499999999998 27.762500000000003 23.45 32-33 21.0 27.750000000000004 28.5875 22.662499999999998 34-35 21.5375 28.1 27.975 22.3875 36-37 20.837500000000002 28.225 27.6875 23.25 38-39 21.5375 26.737499999999997 27.5625 24.1625 40-41 21.325 26.937499999999996 28.512500000000003 23.225 42-43 21.55 27.9125 27.200000000000003 23.3375 44-45 20.7875 28.037499999999998 28.1625 23.0125 46-47 21.2 28.6125 27.55 22.6375 48-49 20.45 28.675 26.337500000000002 24.5375 50-51 20.7625 28.5875 27.650000000000002 23.0 52-53 21.74130597948461 28.946710032524393 26.45734300725544 22.854640980735553 54-55 20.849999999999998 27.8625 27.6625 23.625 56-57 21.587500000000002 27.6375 27.6125 23.1625 58-59 21.675 27.962500000000002 27.450000000000003 22.912499999999998 60-61 21.25 27.775 27.537499999999998 23.4375 62-63 21.637500000000003 27.55 27.3125 23.5 64-65 20.80520130032508 28.60715178794699 27.33183295823956 23.25581395348837 66-67 21.633112417156433 28.010503938977116 27.622858571964485 22.733525071901965 68-69 21.553665248936703 27.995996997748314 27.220415311483613 23.229922441831373 70-71 21.580395098774694 28.60715178794699 27.406851712928233 22.405601400350086 72-73 21.590198774846854 27.82847855981998 27.465933241655204 23.11538942367796 74-75 21.123061530765384 27.63881940970485 27.801400700350175 23.43671835917959 76-77 21.192798199549888 28.832208052013 27.619404851212803 22.355588897224308 78-79 21.637500000000003 27.175 27.8125 23.375 80-81 21.5625 28.3125 27.275 22.85 82-83 21.3 28.1875 27.962500000000002 22.55 84-85 21.5 27.6875 27.3875 23.425 86-87 21.7875 27.6375 27.575 23.0 88-89 21.712500000000002 28.1625 27.750000000000004 22.375 90-91 21.925 27.650000000000002 26.4125 24.0125 92-93 22.1833187445292 28.398149305989744 27.160185069401027 22.25834688008003 94-95 22.030507626906726 28.49462365591398 27.04426106526632 22.43060765191298 96-97 21.275 28.175 26.737499999999997 23.8125 98-99 23.0 27.3375 27.487499999999997 22.175 100-101 21.825 28.3625 26.9125 22.900000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 2.0 26 2.5 27 4.5 28 8.5 29 6.5 30 9.0 31 17.0 32 23.5 33 27.0 34 38.0 35 55.5 36 60.0 37 73.5 38 111.5 39 150.5 40 184.5 41 210.0 42 226.0 43 249.5 44 270.0 45 286.5 46 295.5 47 289.0 48 268.0 49 224.0 50 180.0 51 148.0 52 129.5 53 104.5 54 76.5 55 63.5 56 47.5 57 37.5 58 27.5 59 17.5 60 14.0 61 9.0 62 10.0 63 11.5 64 7.0 65 5.5 66 5.5 67 2.5 68 2.0 69 2.5 70 1.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.8 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.075 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.025 66-67 0.0375 68-69 0.075 70-71 0.025 72-73 0.0125 74-75 0.05 76-77 0.025 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0375 94-95 0.025 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19354838709677 98.4 2 0.8064516129032258 1.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.037500000000000006 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.2 0.0 0.0 0.0 0.0 68-69 0.25 0.0 0.0 0.0 0.0 70-71 0.275 0.0 0.0 0.0 0.0 72-73 0.3125 0.0 0.0 0.0 0.0 74-75 0.3625 0.0 0.0 0.0 0.0 76-77 0.475 0.0 0.0 0.0 0.0 78-79 0.575 0.0 0.0 0.0 0.0 80-81 0.675 0.0 0.0 0.0 0.0 82-83 0.85 0.0 0.0 0.0 0.0 84-85 0.95 0.0 0.0 0.0 0.0 86-87 1.0125 0.0 0.0 0.0 0.0 88-89 1.3875000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864466 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864466_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.21425 34.0 31.0 34.0 30.0 34.0 2 32.32025 34.0 31.0 34.0 30.0 34.0 3 32.338 34.0 31.0 34.0 30.0 34.0 4 35.62275 37.0 37.0 37.0 33.0 37.0 5 35.584 37.0 37.0 37.0 35.0 37.0 6 35.616 37.0 37.0 37.0 35.0 37.0 7 35.632 37.0 36.0 37.0 33.0 37.0 8 35.55425 37.0 36.0 37.0 33.0 37.0 9 37.29275 39.0 38.0 39.0 34.0 39.0 10-11 37.167 39.0 38.0 39.0 34.0 39.0 12-13 37.165875 39.0 37.5 39.0 34.0 39.0 14-15 38.389375 41.0 38.0 41.0 33.5 41.0 16-17 38.40975 41.0 38.0 41.0 34.0 41.0 18-19 38.43325 41.0 38.5 41.0 34.0 41.0 20-21 38.264375 40.5 38.5 41.0 33.5 41.0 22-23 38.253125 40.0 38.0 41.0 34.0 41.0 24-25 37.98350000000001 40.0 38.0 41.0 32.5 41.0 26-27 37.876625000000004 40.0 38.0 41.0 33.0 41.0 28-29 37.837 40.0 38.0 41.0 33.0 41.0 30-31 37.758624999999995 40.0 38.0 41.0 32.0 41.0 32-33 37.599000000000004 40.0 38.0 41.0 32.0 41.0 34-35 37.64625 40.0 38.0 41.0 32.0 41.0 36-37 37.5495 40.0 38.0 41.0 32.5 41.0 38-39 37.45125 40.0 38.0 41.0 31.5 41.0 40-41 37.309125 40.0 38.0 41.0 31.0 41.0 42-43 37.18837499999999 40.0 38.0 41.0 31.0 41.0 44-45 36.905874999999995 40.0 37.0 41.0 30.0 41.0 46-47 36.657625 40.0 37.0 41.0 30.0 41.0 48-49 36.557625 40.0 37.0 41.0 30.0 41.0 50-51 36.288375 39.5 36.5 40.5 30.0 41.0 52-53 36.481 39.5 37.0 40.5 30.0 41.0 54-55 36.58475 40.0 37.0 41.0 30.0 41.0 56-57 36.599999999999994 40.0 36.5 41.0 30.0 41.0 58-59 36.471000000000004 40.0 36.0 41.0 30.0 41.0 60-61 35.91 39.0 35.0 41.0 28.0 41.0 62-63 35.822500000000005 39.0 35.0 41.0 28.5 41.0 64-65 35.44225 38.5 35.0 40.0 28.0 41.0 66-67 35.12425 37.5 35.0 40.0 28.0 41.0 68-69 34.60075 37.0 34.5 39.5 27.0 41.0 70-71 34.305875 36.5 34.0 39.0 28.0 41.0 72-73 33.857 36.0 34.0 39.0 26.5 40.0 74-75 33.323375 35.5 34.0 37.5 26.0 39.0 76-77 32.869749999999996 35.0 33.5 37.0 26.0 39.0 78-79 32.353625 35.0 33.0 36.5 25.0 38.5 80-81 31.944125 35.0 33.0 36.0 24.0 37.0 82-83 31.2935 35.0 32.0 36.0 20.0 37.0 84-85 31.245625 35.0 32.0 35.0 22.5 36.5 86-87 31.040875 35.0 32.0 35.0 21.0 36.0 88-89 30.86025 35.0 32.0 35.0 20.0 36.0 90-91 30.655124999999998 35.0 31.5 35.0 19.0 36.0 92-93 30.365375 34.0 31.0 35.0 18.0 35.0 94-95 30.129125000000002 34.0 31.0 35.0 17.0 35.0 96-97 29.841875 34.0 31.0 35.0 4.5 35.0 98-99 29.485875 34.0 31.0 35.0 2.0 35.0 100-101 28.604125 33.5 29.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 11.0 4 4.0 5 8.0 6 7.0 7 5.0 8 10.0 9 8.0 10 8.0 11 16.0 12 12.0 13 13.0 14 6.0 15 14.0 16 13.0 17 16.0 18 19.0 19 15.0 20 12.0 21 19.0 22 17.0 23 16.0 24 19.0 25 28.0 26 28.0 27 29.0 28 36.0 29 44.0 30 56.0 31 83.0 32 87.0 33 128.0 34 180.0 35 246.0 36 457.0 37 909.0 38 1207.0 39 196.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.375 17.1 14.549999999999999 38.975 2 25.174999999999997 23.5 35.625 15.7 3 19.7 26.950000000000003 29.875 23.474999999999998 4 23.875 32.375 23.3 20.45 5 24.675 34.8 23.45 17.075000000000003 6 20.325 38.675 23.375 17.625 7 20.175 21.224999999999998 37.025000000000006 21.575 8 21.95 23.425 29.575000000000003 25.05 9 22.15 23.525 30.325000000000003 24.0 10-11 22.775000000000002 31.7375 24.1375 21.349999999999998 12-13 24.4875 24.45 27.250000000000004 23.8125 14-15 22.425 27.3875 28.275 21.912499999999998 16-17 23.6625 27.375 27.250000000000004 21.712500000000002 18-19 22.537499999999998 29.049999999999997 27.1375 21.275 20-21 23.2625 27.875 27.5875 21.275 22-23 22.9375 27.625 27.712500000000002 21.725 24-25 22.05 28.875 27.85 21.224999999999998 26-27 22.400000000000002 27.825 28.175 21.6 28-29 22.6375 28.275 27.700000000000003 21.3875 30-31 22.8125 27.474999999999998 27.737499999999997 21.975 32-33 23.5625 28.299999999999997 26.674999999999997 21.462500000000002 34-35 23.25 27.400000000000002 27.55 21.8 36-37 22.787499999999998 26.8 28.6625 21.75 38-39 22.237499999999997 27.8625 28.762500000000003 21.1375 40-41 22.4625 27.8125 27.0625 22.662499999999998 42-43 22.5125 27.5875 28.5625 21.337500000000002 44-45 23.3875 28.175 27.287499999999998 21.15 46-47 22.075 28.1 28.3375 21.4875 48-49 22.975 27.500000000000004 28.775000000000002 20.75 50-51 22.8875 28.375 27.212500000000002 21.525 52-53 23.025000000000002 28.000000000000004 27.55 21.425 54-55 22.4875 28.525 27.462500000000002 21.525 56-57 22.45 28.425 27.762500000000003 21.3625 58-59 24.1625 27.3125 27.675 20.849999999999998 60-61 22.0125 28.6125 27.375 22.0 62-63 23.525 27.537499999999998 28.025 20.9125 64-65 22.575 28.65 27.8125 20.962500000000002 66-67 22.95 27.85 28.65 20.549999999999997 68-69 23.3625 27.3875 27.712500000000002 21.5375 70-71 23.4625 27.5625 27.175 21.8 72-73 22.675 28.237499999999997 28.0875 21.0 74-75 23.375 27.800000000000004 27.35 21.475 76-77 22.9875 27.224999999999998 28.9125 20.875 78-79 24.25 26.937499999999996 27.700000000000003 21.1125 80-81 23.1875 27.8625 27.575 21.375 82-83 22.912499999999998 27.5125 28.275 21.3 84-85 22.75 27.762500000000003 27.825 21.6625 86-87 22.8 28.487499999999997 26.625 22.0875 88-89 23.3125 27.775 27.212500000000002 21.7 90-91 23.4125 27.375 27.8625 21.349999999999998 92-93 24.175 27.875 26.625 21.325 94-95 23.6875 27.712500000000002 27.0625 21.5375 96-97 23.2625 28.449999999999996 27.1 21.1875 98-99 23.275000000000002 28.925 26.224999999999998 21.575 100-101 23.825 28.0625 26.950000000000003 21.1625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 0.5 26 2.0 27 4.5 28 3.5 29 5.0 30 7.5 31 16.5 32 27.0 33 30.5 34 42.0 35 57.0 36 72.0 37 88.0 38 120.0 39 167.5 40 206.5 41 227.5 42 253.0 43 269.5 44 266.5 45 282.0 46 278.5 47 254.0 48 242.0 49 216.5 50 180.0 51 151.5 52 114.0 53 91.0 54 73.5 55 51.0 56 46.0 57 38.0 58 28.5 59 21.0 60 16.0 61 11.5 62 8.5 63 7.5 64 5.0 65 6.5 66 5.0 67 1.0 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.037500000000000006 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.2 0.0 0.0 0.0 0.0 68-69 0.25 0.0 0.0 0.0 0.0 70-71 0.275 0.0 0.0 0.0 0.0 72-73 0.3125 0.0 0.0 0.0 0.0 74-75 0.3625 0.0 0.0 0.0 0.0 76-77 0.475 0.0 0.0 0.0 0.0 78-79 0.575 0.0 0.0 0.0 0.0 80-81 0.675 0.0 0.0 0.0 0.0 82-83 0.825 0.0 0.0 0.0 0.0 84-85 0.925 0.0 0.0 0.0 0.0 86-87 0.9874999999999999 0.0 0.0 0.0 0.0 88-89 1.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 920821 spots for ERR1864466.sra Written 920821 spots for ERR1864466.sra Read 920821 spots for ERR1864466.sra Written 920821 spots for ERR1864466.sra Read 920821 spots for ERR1864466.sra Written 920821 spots for ERR1864466.sra Read 920821 spots for ERR1864466.sra Written 920821 spots for ERR1864466.sra Read 920821 spots for ERR1864466.sra Written 920821 spots for ERR1864466.sra Read 920821 spots for ERR1864466.sra Written 920821 spots for ERR1864466.sra Read 920821 spots for ERR1864466.sra Written 920821 spots for ERR1864466.sra Read 920821 spots for ERR1864466.sra Written 920821 spots for ERR1864466.sra Read 920821 spots for ERR1864466.sra Written 920821 spots for ERR1864466.sra Read 920821 spots for ERR1864466.sra Written 920821 spots for ERR1864466.sra Read 920821 spots for ERR1864466.sra Written 920821 spots for ERR1864466.sra Read 920821 spots for ERR1864466.sra Written 920821 spots for ERR1864466.sra Read 920821 spots for ERR1864466.sra Written 920821 spots for ERR1864466.sra Read 920821 spots for ERR1864466.sra Written 920821 spots for ERR1864466.sra Read 920821 spots for ERR1864466.sra Written 920821 spots for ERR1864466.sra Read 920833 spots for ERR1864466.sra Written 920833 spots for ERR1864466.sra Read 920821 spots for ERR1864466.sra Written 920821 spots for ERR1864466.sra Read 920821 spots for ERR1864466.sra Written 920821 spots for ERR1864466.sra Read 920821 spots for ERR1864466.sra Written 920821 spots for ERR1864466.sra Read 920821 spots for ERR1864466.sra Written 920821 spots for ERR1864466.sra SRR ids: ['ERR1864466.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ya5vi6fu ERR1864466.sra spots: 18416432 blocks: [[1, 920821], [920822, 1841642], [1841643, 2762463], [2762464, 3683284], [3683285, 4604105], [4604106, 5524926], [5524927, 6445747], [6445748, 7366568], [7366569, 8287389], [8287390, 9208210], [9208211, 10129031], [10129032, 11049852], [11049853, 11970673], [11970674, 12891494], [12891495, 13812315], [13812316, 14733136], [14733137, 15653957], [15653958, 16574778], [16574779, 17495599], [17495600, 18416432]] ERR1864466 file size 4420544 ERR1864466 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864466 ERR1864466_1.fastq ERR1864466_2.fastq Input file: ERR1864466_1.fastq Paired file: ERR1864466_2.fastq trimmed: ERR1864466-trimmed-pair1.fastq, ERR1864466-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:24:33 2025 >> started Thu Feb 13 13:24:49 2025 >> done (16.201s) 18416432 read pairs processed; of these: 245096 ( 1.33%) short read pairs filtered out after trimming by size control 266838 ( 1.45%) empty read pairs filtered out after trimming by size control 17904498 (97.22%) read pairs available; of these: 4234931 (23.65%) trimmed read pairs available after processing 13669567 (76.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 111 0.00% 19 272 0.00% 20 437 0.00% 21 574 0.00% 22 683 0.00% 23 910 0.01% 24 1054 0.01% 25 1290 0.01% 26 1485 0.01% 27 1717 0.01% 28 2082 0.01% 29 2303 0.01% 30 2771 0.02% 31 2969 0.02% 32 3345 0.02% 33 3894 0.02% 34 4128 0.02% 35 4500 0.03% 36 4962 0.03% 37 5258 0.03% 38 5665 0.03% 39 6197 0.03% 40 6536 0.04% 41 7031 0.04% 42 7598 0.04% 43 7920 0.04% 44 8380 0.05% 45 8801 0.05% 46 9164 0.05% 47 9571 0.05% 48 10181 0.06% 49 10579 0.06% 50 11157 0.06% 51 11533 0.06% 52 12290 0.07% 53 12754 0.07% 54 12985 0.07% 55 14061 0.08% 56 14992 0.08% 57 15542 0.09% 58 16614 0.09% 59 20644 0.12% 60 24268 0.14% 61 25464 0.14% 62 25998 0.15% 63 27144 0.15% 64 27800 0.16% 65 29396 0.16% 66 30553 0.17% 67 31471 0.18% 68 33014 0.18% 69 34195 0.19% 70 36057 0.20% 71 37675 0.21% 72 39191 0.22% 73 41486 0.23% 74 42808 0.24% 75 43683 0.24% 76 43876 0.25% 77 45922 0.26% 78 48407 0.27% 79 51840 0.29% 80 54582 0.30% 81 56763 0.32% 82 59709 0.33% 83 62951 0.35% 84 66766 0.37% 85 71144 0.40% 86 74915 0.42% 87 78198 0.44% 88 80421 0.45% 89 85596 0.48% 90 93900 0.52% 91 103667 0.58% 92 114825 0.64% 93 127030 0.71% 94 144432 0.81% 95 166870 0.93% 96 198425 1.11% 97 245804 1.37% 98 317755 1.77% 99 427167 2.39% 100 598823 3.34% 101 13669567 76.35% 17904498 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=3.50 fanout-score-rank=20 prefix-density=0.24 prefix-fanout=2.5 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.06 sequence-density-rank=23 fanout-score=242.55 fanout-score-rank=1 prefix-density=0.62 prefix-fanout=23.0 sequence=TCTTCTTCTTCCTTTGG criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=3.63 fanout-score-rank=22 prefix-density=0.14 prefix-fanout=3.5 sequence=GGAAAGACCATCAC criterion=fanout-score sequence-density=0.07 sequence-density-rank=17 fanout-score=252.96 fanout-score-rank=1 prefix-density=0.70 prefix-fanout=26.2 sequence=AAGAAGAAGAAA ERR1864466 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:25:23 Started mapping on | Feb 13 13:25:23 Finished on | Feb 13 13:26:04 Mapping speed, Million of reads per hour | 1572.10 Number of input reads | 17904498 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 17435735 Uniquely mapped reads % | 97.38% Average mapped length | 195.48 Number of splices: Total | 9560213 Number of splices: Annotated (sjdb) | 9416299 Number of splices: GT/AG | 9423522 Number of splices: GC/AG | 114567 Number of splices: AT/AC | 10200 Number of splices: Non-canonical | 11924 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 2.38 Insertion rate per base | 0.01% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 370509 % of reads mapped to multiple loci | 2.07% Number of reads mapped to too many loci | 29836 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.37% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 119882 119882 119882 N_multimapping 370509 370509 370509 N_noFeature 457357 17251086 531261 N_ambiguous 175795 754 64536 UnstrandedReadsAssigned:16802583 PositiveStrandReadsAssigned:183895 NegativeStrandReadsAssigned:16839938 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864466 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864466-trimmed-pair1.fastq ERR1864466-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,904,498 reads, 17,012,521 reads pseudoaligned [quant] estimated average fragment length: 158.048 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,208 rounds 52401 ERR1864466.ke.tsv 34699 ERR1864466.se.tsv 87100 total ==> ERR1864466.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1860.95 1155 47.7643 Potri.005G024800.1.v4.1 1035 877.952 150 13.1485 Potri.004G059700.1.v4.1 961 803.952 16 1.5316 Potri.007G009000.2.v4.1 1416 1258.95 0 0 Potri.003G141000.2.v4.1 2943 2785.95 449.33 12.4122 Potri.016G087400.1.v4.1 270 118.792 756 489.77 Potri.015G069301.1.v4.1 564 407.056 0 0 Potri.010G195200.1.v4.1 1773 1615.95 50 2.38121 Potri.012G127500.1.v4.1 977 819.952 704 66.0756 ==> ERR1864466.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1699 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 420 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 43 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 ERR1864466 completed mapping pipeline successfully