Starting /dee2/code/volunteer_pipeline.sh ERR1864467 current disk space = 3091055620096 free memory = 1572365156 ERR1864467 SRAfilesize fbca3b8f6c5134ed11e571742da36793 ERR1864467.sra ERR1864467.sra file validated ERR1864467 is paired end ERR1864467 is conventional basespace ERR1864467 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864467_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.35575 34.0 31.0 34.0 30.0 34.0 2 31.92875 34.0 31.0 34.0 30.0 34.0 3 32.45625 34.0 31.0 34.0 30.0 34.0 4 35.88425 37.0 35.0 37.0 35.0 37.0 5 35.7115 37.0 35.0 37.0 35.0 37.0 6 35.569 37.0 36.0 37.0 35.0 37.0 7 35.68075 37.0 36.0 37.0 35.0 37.0 8 35.6975 37.0 37.0 37.0 35.0 37.0 9 37.40775 39.0 38.0 39.0 35.0 39.0 10-11 37.329625 39.0 38.0 39.0 35.0 39.0 12-13 37.124875 39.0 38.0 39.0 34.0 39.0 14-15 38.786 41.0 39.0 41.0 35.0 41.0 16-17 38.62875 41.0 39.0 41.0 34.5 41.0 18-19 38.637875 41.0 39.0 41.0 34.5 41.0 20-21 38.522 41.0 39.0 41.0 34.0 41.0 22-23 38.57225 41.0 39.0 41.0 34.0 41.0 24-25 38.503625 41.0 39.0 41.0 34.0 41.0 26-27 38.45675 41.0 39.0 41.0 34.0 41.0 28-29 38.342 40.0 38.0 41.0 34.0 41.0 30-31 38.2115 40.0 38.0 41.0 33.5 41.0 32-33 38.19175 40.0 38.0 41.0 34.0 41.0 34-35 37.924 40.0 38.0 41.0 33.0 41.0 36-37 37.9315 40.0 38.0 41.0 33.0 41.0 38-39 37.881625 40.0 38.0 41.0 33.0 41.0 40-41 37.7345 40.0 38.0 41.0 33.0 41.0 42-43 37.570499999999996 40.0 38.0 41.0 32.5 41.0 44-45 37.45675 40.0 37.5 41.0 32.0 41.0 46-47 37.657250000000005 40.0 38.0 41.0 32.5 41.0 48-49 37.629875 40.0 38.0 41.0 32.5 41.0 50-51 37.473375000000004 40.0 37.5 41.0 32.0 41.0 52-53 37.207375 40.0 37.0 41.0 31.5 41.0 54-55 37.006875 40.0 37.0 41.0 31.0 41.0 56-57 36.898624999999996 40.0 36.0 41.0 31.0 41.0 58-59 36.624875 39.5 36.0 41.0 31.0 41.0 60-61 36.38225 39.0 35.5 41.0 30.5 41.0 62-63 36.077124999999995 39.0 35.0 40.5 29.5 41.0 64-65 35.583625 38.0 35.0 40.0 28.5 41.0 66-67 35.41225 37.5 35.0 40.0 29.0 41.0 68-69 35.037625000000006 37.0 34.0 39.5 28.0 41.0 70-71 34.52175 37.0 34.0 39.0 28.0 41.0 72-73 34.1305 36.0 34.0 39.0 27.5 40.0 74-75 33.68775 35.5 34.0 37.5 26.5 39.5 76-77 32.557249999999996 35.0 32.0 36.5 26.0 39.0 78-79 32.7785 35.0 33.0 37.0 26.0 39.0 80-81 32.533249999999995 35.0 33.0 36.0 26.0 37.5 82-83 32.199749999999995 35.0 32.5 36.0 25.5 37.0 84-85 31.914625 35.0 32.0 35.0 26.0 37.0 86-87 31.703 35.0 32.0 35.0 25.5 36.0 88-89 31.474125 34.5 32.0 35.0 25.5 36.0 90-91 31.079375 34.0 31.5 35.0 24.0 36.0 92-93 30.75225 34.0 31.5 35.0 21.5 35.0 94-95 30.542625 34.0 31.0 35.0 20.0 35.0 96-97 30.338375 34.0 31.0 35.0 19.5 35.0 98-99 30.065375 34.0 31.0 35.0 10.0 35.0 100-101 29.097625 34.0 30.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 21.0 4 4.0 5 4.0 6 4.0 7 4.0 8 10.0 9 5.0 10 8.0 11 4.0 12 6.0 13 9.0 14 11.0 15 8.0 16 7.0 17 8.0 18 10.0 19 12.0 20 8.0 21 10.0 22 16.0 23 15.0 24 18.0 25 24.0 26 24.0 27 23.0 28 44.0 29 56.0 30 57.0 31 65.0 32 90.0 33 107.0 34 183.0 35 238.0 36 451.0 37 950.0 38 1279.0 39 190.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.76331514679137 6.443232008313848 7.820213042348661 46.97323980254612 2 25.4 8.7 34.625 31.275 3 22.772772772772772 13.238238238238237 23.573573573573572 40.41541541541542 4 28.675 18.7 21.15 31.474999999999998 5 26.70667666916729 24.781195298824706 26.281570392598148 22.230557639409852 6 21.875 30.225 26.0 21.9 7 15.875 22.55 43.925 17.65 8 18.3 24.075 35.449999999999996 22.175 9 17.65 23.575 38.25 20.525 10-11 20.4 32.737500000000004 27.3375 19.525000000000002 12-13 21.25 26.0625 30.012499999999996 22.675 14-15 20.837500000000002 28.025 29.799999999999997 21.337500000000002 16-17 20.9875 27.55 28.8875 22.575 18-19 20.3125 28.7375 28.237499999999997 22.7125 20-21 21.0125 27.55 28.9375 22.5 22-23 20.9875 27.9125 27.775 23.325000000000003 24-25 20.6375 28.012500000000003 27.3875 23.962500000000002 26-27 21.0625 28.4375 27.962500000000002 22.537499999999998 28-29 20.5625 28.375 28.925 22.1375 30-31 20.2625 28.1875 27.85 23.7 32-33 20.825 27.125 28.525 23.525 34-35 21.15 27.775 27.6875 23.3875 36-37 20.775 27.250000000000004 28.325 23.65 38-39 20.5125 28.349999999999998 27.9125 23.225 40-41 21.375 27.425 28.6875 22.5125 42-43 20.5125 27.987499999999997 28.0625 23.4375 44-45 20.625 27.450000000000003 28.4 23.525 46-47 20.5 27.925 28.012500000000003 23.5625 48-49 20.1 27.5625 28.9375 23.400000000000002 50-51 21.512500000000003 27.150000000000002 28.8875 22.45 52-53 21.025 27.9375 27.987499999999997 23.05 54-55 20.375 27.1375 28.349999999999998 24.1375 56-57 20.9375 27.700000000000003 28.6375 22.725 58-59 20.325 27.900000000000002 28.4 23.375 60-61 21.3875 27.787499999999998 27.4125 23.4125 62-63 21.637500000000003 27.125 28.4 22.8375 64-65 21.3625 27.150000000000002 27.85 23.6375 66-67 20.25 28.349999999999998 28.0625 23.3375 68-69 21.4125 27.4125 28.5625 22.6125 70-71 21.224999999999998 28.212500000000002 28.475 22.0875 72-73 21.1625 26.9625 28.212500000000002 23.6625 74-75 21.4125 27.700000000000003 28.425 22.4625 76-77 20.7625 28.0625 28.050000000000004 23.125 78-79 21.1625 28.050000000000004 27.625 23.1625 80-81 21.4125 28.775000000000002 27.775 22.037499999999998 82-83 21.712500000000002 28.675 27.625 21.987499999999997 84-85 21.3875 26.825 28.599999999999998 23.1875 86-87 20.474999999999998 29.0875 27.825 22.6125 88-89 21.6875 28.050000000000004 27.537499999999998 22.725 90-91 21.587500000000002 27.1375 28.012500000000003 23.2625 92-93 20.7375 27.6 28.625 23.0375 94-95 20.9 27.55 28.675 22.875 96-97 21.087500000000002 27.762500000000003 27.474999999999998 23.674999999999997 98-99 20.9125 28.6625 27.6875 22.7375 100-101 22.400000000000002 27.325 28.199999999999996 22.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 1.0 24 3.5 25 4.0 26 3.0 27 6.0 28 10.0 29 8.5 30 14.5 31 20.0 32 20.5 33 36.0 34 51.5 35 64.5 36 78.5 37 99.5 38 130.0 39 157.0 40 183.5 41 206.5 42 235.5 43 266.5 44 265.0 45 257.5 46 268.0 47 266.5 48 243.5 49 199.5 50 167.5 51 145.0 52 118.5 53 108.0 54 86.5 55 55.5 56 47.5 57 41.0 58 28.0 59 23.0 60 19.0 61 15.0 62 9.0 63 5.5 64 6.5 65 7.0 66 4.5 67 3.0 68 2.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.775 2 0.0 3 0.1 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42109237352128 98.75 2 0.5285678328718851 1.05 3 0.025169896803423106 0.075 4 0.0 0.0 5 0.025169896803423106 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCCGGGATAACAGGCTTGATGACATACTCCTTTAGATCAGCGGCAATTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.3 0.0 0.0 0.0 0.0 76-77 0.325 0.0 0.0 0.0 0.0 78-79 0.35 0.0 0.0 0.0 0.0 80-81 0.4 0.0 0.0 0.0 0.0 82-83 0.5375 0.0 0.0 0.0 0.0 84-85 0.675 0.0 0.0 0.0 0.0 86-87 0.8500000000000001 0.0 0.0 0.0 0.0 88-89 0.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864467 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864467_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.20775 34.0 31.0 34.0 30.0 34.0 2 32.324 34.0 31.0 34.0 31.0 34.0 3 32.3445 34.0 31.0 34.0 31.0 34.0 4 35.70475 37.0 37.0 37.0 35.0 37.0 5 35.72375 37.0 37.0 37.0 35.0 37.0 6 35.71075 37.0 37.0 37.0 35.0 37.0 7 35.68475 37.0 37.0 37.0 35.0 37.0 8 35.59025 37.0 37.0 37.0 35.0 37.0 9 37.3825 39.0 38.0 39.0 35.0 39.0 10-11 37.281875 39.0 38.0 39.0 34.5 39.0 12-13 37.177625 39.0 38.0 39.0 34.0 39.0 14-15 38.57875 41.0 39.0 41.0 34.5 41.0 16-17 38.584375 41.0 39.0 41.0 34.0 41.0 18-19 38.56375 41.0 39.0 41.0 34.0 41.0 20-21 38.434375 41.0 38.5 41.0 34.0 41.0 22-23 38.4205 41.0 39.0 41.0 34.0 41.0 24-25 38.16475 40.5 38.0 41.0 33.5 41.0 26-27 38.1105 40.0 38.0 41.0 33.5 41.0 28-29 38.061125000000004 40.0 38.0 41.0 33.0 41.0 30-31 37.971875 40.0 38.0 41.0 33.0 41.0 32-33 37.80775 40.0 38.0 41.0 32.5 41.0 34-35 37.808125000000004 40.0 38.0 41.0 33.0 41.0 36-37 37.804500000000004 40.0 38.0 41.0 33.0 41.0 38-39 37.70975 40.0 38.0 41.0 33.0 41.0 40-41 37.567125000000004 40.0 38.0 41.0 32.5 41.0 42-43 37.463750000000005 40.0 38.0 41.0 32.0 41.0 44-45 37.132875 40.0 37.5 41.0 31.5 41.0 46-47 36.882999999999996 40.0 37.0 41.0 30.0 41.0 48-49 36.813625 40.0 37.0 41.0 30.0 41.0 50-51 36.532 39.5 36.5 40.5 30.0 41.0 52-53 36.789125 39.5 37.0 40.5 31.0 41.0 54-55 36.915875 40.0 37.0 41.0 30.5 41.0 56-57 37.0065 40.0 37.0 41.0 31.0 41.0 58-59 36.806875 40.0 36.5 41.0 31.0 41.0 60-61 36.292249999999996 39.0 36.0 41.0 29.0 41.0 62-63 36.121125 39.0 35.0 41.0 29.0 41.0 64-65 35.785125 38.5 35.0 40.5 28.5 41.0 66-67 35.47425 38.0 35.0 40.0 29.0 41.0 68-69 34.977500000000006 37.0 34.5 39.5 28.0 41.0 70-71 34.528375 37.0 34.0 39.0 27.5 41.0 72-73 34.12375 36.0 34.0 39.0 28.0 40.0 74-75 33.575125 35.5 34.0 37.5 26.5 39.5 76-77 33.160624999999996 35.0 34.0 37.0 26.0 39.0 78-79 32.695750000000004 35.0 33.0 37.0 26.0 39.0 80-81 32.194 35.0 33.0 36.0 25.5 37.0 82-83 31.6715 35.0 32.5 36.0 23.5 37.0 84-85 31.557499999999997 35.0 32.0 35.0 24.0 36.5 86-87 31.33925 35.0 32.0 35.0 24.0 36.0 88-89 31.156125000000003 35.0 32.0 35.0 23.0 36.0 90-91 30.899124999999998 35.0 32.0 35.0 20.5 36.0 92-93 30.676875000000003 34.0 32.0 35.0 19.5 35.0 94-95 30.424500000000002 34.0 31.0 35.0 18.5 35.0 96-97 30.176499999999997 34.0 31.0 35.0 16.5 35.0 98-99 29.847375 34.0 31.0 35.0 2.0 35.0 100-101 28.854875 33.5 30.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 24.0 3 7.0 4 2.0 5 0.0 6 5.0 7 13.0 8 3.0 9 6.0 10 7.0 11 11.0 12 8.0 13 14.0 14 5.0 15 7.0 16 6.0 17 15.0 18 14.0 19 23.0 20 19.0 21 20.0 22 18.0 23 18.0 24 26.0 25 18.0 26 25.0 27 22.0 28 36.0 29 51.0 30 71.0 31 62.0 32 93.0 33 115.0 34 150.0 35 253.0 36 436.0 37 951.0 38 1239.0 39 207.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.499999999999996 17.525 13.575000000000001 40.400000000000006 2 24.224999999999998 23.5 36.325 15.950000000000001 3 20.150000000000002 26.974999999999998 29.925 22.95 4 22.375 34.675 22.5 20.45 5 23.95 35.075 24.0 16.975 6 20.349999999999998 37.8 22.25 19.6 7 18.975 20.45 38.775 21.8 8 19.6 25.124999999999996 31.15 24.125 9 21.2 23.674999999999997 31.974999999999998 23.150000000000002 10-11 22.8375 31.324999999999996 24.575 21.2625 12-13 23.4375 25.624999999999996 27.575 23.3625 14-15 21.7875 28.6625 28.525 21.025 16-17 22.6875 28.4125 27.575 21.325 18-19 21.349999999999998 28.749999999999996 27.6625 22.237499999999997 20-21 23.175 28.8625 26.5875 21.375 22-23 22.3 28.7375 27.474999999999998 21.4875 24-25 22.125 28.8625 27.125 21.8875 26-27 22.55 28.65 27.3625 21.4375 28-29 22.5 28.549999999999997 27.85 21.099999999999998 30-31 22.175 28.775000000000002 28.675 20.375 32-33 23.175 27.962500000000002 28.249999999999996 20.6125 34-35 22.6125 28.237499999999997 27.487499999999997 21.6625 36-37 21.6125 28.262500000000003 27.750000000000004 22.375 38-39 22.3125 29.375 26.9125 21.4 40-41 22.975 28.1875 27.1 21.7375 42-43 22.175 27.6 28.462500000000002 21.762500000000003 44-45 22.375 29.0875 27.212500000000002 21.325 46-47 23.1375 28.237499999999997 27.025 21.6 48-49 22.112499999999997 28.9125 28.1125 20.8625 50-51 22.412499999999998 28.775000000000002 26.450000000000003 22.3625 52-53 21.925 28.462500000000002 27.474999999999998 22.1375 54-55 22.8875 28.6125 27.037499999999998 21.462500000000002 56-57 22.4875 28.475 27.750000000000004 21.2875 58-59 23.375 28.225 27.474999999999998 20.925 60-61 21.775 28.712500000000002 27.775 21.7375 62-63 22.8 28.9 27.450000000000003 20.849999999999998 64-65 22.7 27.5625 28.3875 21.349999999999998 66-67 23.0375 28.275 27.8125 20.875 68-69 23.0125 27.9125 28.249999999999996 20.825 70-71 22.875 28.6375 26.700000000000003 21.7875 72-73 22.4875 28.95 27.150000000000002 21.4125 74-75 22.75 28.7 27.3 21.25 76-77 23.325000000000003 27.650000000000002 28.225 20.8 78-79 22.8 28.175 28.0875 20.9375 80-81 22.75 28.275 27.825 21.15 82-83 23.0 29.037499999999998 27.537499999999998 20.424999999999997 84-85 23.0625 27.8125 28.199999999999996 20.925 86-87 23.325000000000003 28.812500000000004 26.75 21.1125 88-89 22.662499999999998 29.2 26.674999999999997 21.462500000000002 90-91 23.0625 27.537499999999998 28.199999999999996 21.2 92-93 23.2375 28.425 26.137500000000003 22.2 94-95 23.962500000000002 28.537499999999998 26.2125 21.2875 96-97 23.2625 27.9125 27.5125 21.3125 98-99 22.825 28.962500000000002 26.674999999999997 21.5375 100-101 23.5 29.312500000000004 26.775 20.4125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 0.5 24 3.0 25 4.5 26 6.0 27 6.0 28 7.0 29 13.0 30 14.5 31 21.5 32 33.5 33 37.5 34 48.5 35 70.0 36 87.0 37 109.0 38 136.0 39 162.5 40 195.5 41 239.0 42 261.5 43 260.5 44 263.5 45 273.0 46 268.5 47 234.0 48 210.0 49 192.0 50 180.0 51 153.0 52 112.0 53 89.5 54 69.5 55 52.5 56 43.5 57 34.0 58 24.5 59 21.0 60 15.0 61 10.0 62 7.5 63 6.0 64 5.0 65 6.5 66 4.5 67 1.0 68 1.0 69 0.5 70 0.5 71 0.5 72 0.5 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.3 0.0 0.0 0.0 0.0 76-77 0.325 0.0 0.0 0.0 0.0 78-79 0.35 0.0 0.0 0.0 0.0 80-81 0.375 0.0 0.0 0.0 0.0 82-83 0.5125 0.0 0.0 0.0 0.0 84-85 0.6499999999999999 0.0 0.0 0.0 0.0 86-87 0.825 0.0 0.0 0.0 0.0 88-89 0.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 955987 spots for ERR1864467.sra Written 955987 spots for ERR1864467.sra Read 955987 spots for ERR1864467.sra Written 955987 spots for ERR1864467.sra Read 955987 spots for ERR1864467.sra Written 955987 spots for ERR1864467.sra Read 955987 spots for ERR1864467.sra Written 955987 spots for ERR1864467.sra Read 955987 spots for ERR1864467.sra Written 955987 spots for ERR1864467.sra Read 955987 spots for ERR1864467.sra Written 955987 spots for ERR1864467.sra Read 955987 spots for ERR1864467.sra Written 955987 spots for ERR1864467.sra Read 955987 spots for ERR1864467.sra Written 955987 spots for ERR1864467.sra Read 955987 spots for ERR1864467.sra Written 955987 spots for ERR1864467.sra Read 955987 spots for ERR1864467.sra Written 955987 spots for ERR1864467.sra Read 955987 spots for ERR1864467.sra Written 955987 spots for ERR1864467.sra Read 956006 spots for ERR1864467.sra Written 956006 spots for ERR1864467.sra Read 955987 spots for ERR1864467.sra Written 955987 spots for ERR1864467.sra Read 955987 spots for ERR1864467.sra Written 955987 spots for ERR1864467.sra Read 955987 spots for ERR1864467.sra Written 955987 spots for ERR1864467.sra Read 955987 spots for ERR1864467.sra Written 955987 spots for ERR1864467.sra Read 955987 spots for ERR1864467.sra Written 955987 spots for ERR1864467.sra Read 955987 spots for ERR1864467.sra Written 955987 spots for ERR1864467.sra Read 955987 spots for ERR1864467.sra Written 955987 spots for ERR1864467.sra Read 955987 spots for ERR1864467.sra Written 955987 spots for ERR1864467.sra SRR ids: ['ERR1864467.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ydndjhhp ERR1864467.sra spots: 19119759 blocks: [[1, 955987], [955988, 1911974], [1911975, 2867961], [2867962, 3823948], [3823949, 4779935], [4779936, 5735922], [5735923, 6691909], [6691910, 7647896], [7647897, 8603883], [8603884, 9559870], [9559871, 10515857], [10515858, 11471844], [11471845, 12427831], [12427832, 13383818], [13383819, 14339805], [14339806, 15295792], [15295793, 16251779], [16251780, 17207766], [17207767, 18163753], [18163754, 19119759]] ERR1864467 file size 4590194 ERR1864467 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864467 ERR1864467_1.fastq ERR1864467_2.fastq Input file: ERR1864467_1.fastq Paired file: ERR1864467_2.fastq trimmed: ERR1864467-trimmed-pair1.fastq, ERR1864467-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:22:44 2025 >> started Thu Feb 13 13:23:03 2025 >> done (19.307s) 19119759 read pairs processed; of these: 256313 ( 1.34%) short read pairs filtered out after trimming by size control 280377 ( 1.47%) empty read pairs filtered out after trimming by size control 18583069 (97.19%) read pairs available; of these: 4107233 (22.10%) trimmed read pairs available after processing 14475836 (77.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 121 0.00% 19 286 0.00% 20 446 0.00% 21 613 0.00% 22 768 0.00% 23 939 0.01% 24 1099 0.01% 25 1281 0.01% 26 1543 0.01% 27 1837 0.01% 28 2088 0.01% 29 2462 0.01% 30 2655 0.01% 31 3091 0.02% 32 3475 0.02% 33 3973 0.02% 34 4256 0.02% 35 4619 0.02% 36 4993 0.03% 37 5396 0.03% 38 5818 0.03% 39 6173 0.03% 40 6760 0.04% 41 7083 0.04% 42 7576 0.04% 43 7964 0.04% 44 8341 0.04% 45 8690 0.05% 46 9101 0.05% 47 9749 0.05% 48 10232 0.06% 49 10658 0.06% 50 11090 0.06% 51 11537 0.06% 52 12077 0.06% 53 12693 0.07% 54 13023 0.07% 55 14096 0.08% 56 14450 0.08% 57 15455 0.08% 58 16345 0.09% 59 20482 0.11% 60 24491 0.13% 61 25368 0.14% 62 26266 0.14% 63 26949 0.15% 64 27585 0.15% 65 28919 0.16% 66 30349 0.16% 67 31227 0.17% 68 32973 0.18% 69 33900 0.18% 70 35805 0.19% 71 37008 0.20% 72 38514 0.21% 73 40697 0.22% 74 41880 0.23% 75 42380 0.23% 76 42477 0.23% 77 44409 0.24% 78 47334 0.25% 79 49477 0.27% 80 51889 0.28% 81 54086 0.29% 82 57053 0.31% 83 59441 0.32% 84 62865 0.34% 85 66367 0.36% 86 70349 0.38% 87 73679 0.40% 88 75316 0.41% 89 80092 0.43% 90 87841 0.47% 91 96619 0.52% 92 107322 0.58% 93 120727 0.65% 94 135727 0.73% 95 158197 0.85% 96 189067 1.02% 97 236065 1.27% 98 310320 1.67% 99 421086 2.27% 100 599783 3.23% 101 14475836 77.90% 18583069 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=34 prefix-density=0.16 prefix-fanout=2.1 sequence=CTTGTCAGCATC criterion=fanout-score sequence-density=0.08 sequence-density-rank=16 fanout-score=256.03 fanout-score-rank=1 prefix-density=0.74 prefix-fanout=26.6 sequence=CTTCTTCTTCTTTT criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=2.53 fanout-score-rank=29 prefix-density=0.13 prefix-fanout=2.3 sequence=ACTTCAATGACAATGGTGCAATGGTCCCTGTTCGTGTCCACACTGTTCTCATCTCTACTCAGCATGATGAGACTGTCACAAATGATGAAATTGCCGCTGATCTAAAGGAGTATGTCATCAAGCCTGTTATCCCGGAGAAGTACCTTGATGAGAAAACTATCTTTCACCTCAACCCATCTGGCCGTTTTGTTATTGGTGG criterion=fanout-score sequence-density=0.08 sequence-density-rank=13 fanout-score=229.72 fanout-score-rank=1 prefix-density=0.70 prefix-fanout=25.1 sequence=AAGAAGAAGAAA ERR1864467 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:23:32 Started mapping on | Feb 13 13:23:33 Finished on | Feb 13 13:24:16 Mapping speed, Million of reads per hour | 1555.79 Number of input reads | 18583069 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 18103159 Uniquely mapped reads % | 97.42% Average mapped length | 195.86 Number of splices: Total | 9949447 Number of splices: Annotated (sjdb) | 9793808 Number of splices: GT/AG | 9806764 Number of splices: GC/AG | 119234 Number of splices: AT/AC | 10510 Number of splices: Non-canonical | 12939 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 2.37 Insertion rate per base | 0.01% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 376979 % of reads mapped to multiple loci | 2.03% Number of reads mapped to too many loci | 28452 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.39% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 126707 126707 126707 N_multimapping 376979 376979 376979 N_noFeature 537848 17905983 615881 N_ambiguous 189797 815 70085 UnstrandedReadsAssigned:17375514 PositiveStrandReadsAssigned:196361 NegativeStrandReadsAssigned:17417193 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864467 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864467-trimmed-pair1.fastq ERR1864467-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,583,069 reads, 17,583,701 reads pseudoaligned [quant] estimated average fragment length: 166.952 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,055 rounds 52401 ERR1864467.ke.tsv 34699 ERR1864467.se.tsv 87100 total ==> ERR1864467.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1852.05 1231.57 49.8189 Potri.005G024800.1.v4.1 1035 869.048 173 14.9138 Potri.004G059700.1.v4.1 961 795.048 19 1.79039 Potri.007G009000.2.v4.1 1416 1250.05 0 0 Potri.003G141000.2.v4.1 2943 2777.05 478.458 12.9076 Potri.016G087400.1.v4.1 270 112.9 860 570.68 Potri.015G069301.1.v4.1 564 398.104 0 0 Potri.010G195200.1.v4.1 1773 1607.05 45 2.09783 Potri.012G127500.1.v4.1 977 811.048 348 32.1454 ==> ERR1864467.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1960 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 420 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 57 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 ERR1864467 completed mapping pipeline successfully