Starting /dee2/code/volunteer_pipeline.sh ERR1864468 current disk space = 3091552944128 free memory = 1457727000 ERR1864468 SRAfilesize e6db52a3044b5ca853579b1085c0d176 ERR1864468.sra ERR1864468.sra file validated ERR1864468 is paired end ERR1864468 is conventional basespace ERR1864468 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864468_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.722 34.0 31.0 34.0 27.0 34.0 2 31.53125 34.0 31.0 34.0 28.0 34.0 3 32.19875 34.0 31.0 34.0 30.0 34.0 4 35.59475 37.0 35.0 37.0 33.0 37.0 5 35.579 37.0 35.0 37.0 35.0 37.0 6 35.48425 37.0 35.0 37.0 35.0 37.0 7 35.432 37.0 36.0 37.0 33.0 37.0 8 35.37325 37.0 35.0 37.0 33.0 37.0 9 37.164 39.0 38.0 39.0 35.0 39.0 10-11 37.168125 39.0 38.0 39.0 34.0 39.0 12-13 37.125875 39.0 38.0 39.0 34.5 39.0 14-15 38.496875 41.0 39.0 41.0 34.0 41.0 16-17 38.42 41.0 39.0 41.0 34.0 41.0 18-19 38.388999999999996 41.0 39.0 41.0 34.0 41.0 20-21 38.287125 41.0 39.0 41.0 34.0 41.0 22-23 38.133375 40.0 38.0 41.0 33.5 41.0 24-25 38.112875 40.0 38.0 41.0 33.5 41.0 26-27 38.08025 40.0 38.0 41.0 33.5 41.0 28-29 38.020125 40.0 38.0 41.0 33.5 41.0 30-31 37.885000000000005 40.0 38.0 41.0 33.0 41.0 32-33 37.84725 40.0 38.0 41.0 33.0 41.0 34-35 37.582875 40.0 38.0 41.0 32.0 41.0 36-37 37.619625 40.0 38.0 41.0 32.5 41.0 38-39 37.499375 40.0 38.0 41.0 32.0 41.0 40-41 37.452125 40.0 38.0 41.0 32.0 41.0 42-43 37.238375000000005 40.0 37.5 41.0 31.0 41.0 44-45 37.198499999999996 40.0 37.5 41.0 31.5 41.0 46-47 37.209500000000006 40.0 37.5 41.0 31.5 41.0 48-49 37.248375 40.0 37.5 41.0 31.5 41.0 50-51 37.156125 40.0 37.0 41.0 31.0 41.0 52-53 36.944874999999996 40.0 37.0 41.0 31.0 41.0 54-55 36.76575 40.0 37.0 41.0 30.5 41.0 56-57 36.619749999999996 40.0 36.0 41.0 30.0 41.0 58-59 36.4125 39.5 36.0 41.0 30.0 41.0 60-61 36.135999999999996 39.0 35.5 41.0 29.0 41.0 62-63 35.825874999999996 39.0 35.0 40.5 29.0 41.0 64-65 35.434 38.0 35.0 40.0 28.5 41.0 66-67 35.03425 38.0 34.5 40.0 28.0 41.0 68-69 34.77525 37.0 34.0 40.0 28.0 41.0 70-71 34.385 37.0 34.0 39.0 27.5 41.0 72-73 33.87325 36.0 34.0 39.0 26.5 40.0 74-75 33.277625 35.5 33.0 38.0 26.0 40.0 76-77 32.253625 35.0 31.5 37.0 25.5 39.0 78-79 32.53425 35.0 33.0 37.0 25.5 39.0 80-81 32.331 35.0 33.0 36.5 26.0 38.0 82-83 32.057625 35.0 33.0 36.0 26.0 37.0 84-85 31.655375 35.0 32.0 35.5 25.0 37.0 86-87 31.072875 34.5 31.5 35.0 21.0 36.0 88-89 30.922375000000002 34.0 31.5 35.0 22.0 36.0 90-91 30.69775 34.0 31.5 35.0 19.5 36.0 92-93 30.42275 34.0 31.5 35.0 19.0 35.0 94-95 30.201999999999998 34.0 31.0 35.0 17.0 35.0 96-97 29.944249999999997 34.0 31.0 35.0 4.5 35.0 98-99 29.62025 34.0 31.0 35.0 2.0 35.0 100-101 28.548875000000002 33.5 29.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 41.0 3 13.0 4 7.0 5 7.0 6 3.0 7 6.0 8 6.0 9 5.0 10 6.0 11 11.0 12 6.0 13 15.0 14 10.0 15 6.0 16 12.0 17 14.0 18 13.0 19 15.0 20 14.0 21 14.0 22 8.0 23 11.0 24 19.0 25 21.0 26 27.0 27 31.0 28 28.0 29 43.0 30 69.0 31 66.0 32 106.0 33 120.0 34 179.0 35 263.0 36 423.0 37 904.0 38 1240.0 39 218.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.983385254413292 9.475597092419523 7.78816199376947 50.75285565939771 2 20.525 14.45 40.625 24.4 3 20.5 17.474999999999998 24.349999999999998 37.675 4 23.549999999999997 28.075 20.825 27.55 5 22.416812609457093 33.074806104578435 24.74355766825119 19.764823617713283 6 17.95 34.75 26.924999999999997 20.375 7 14.2 26.400000000000002 41.625 17.775 8 18.55 25.85 32.550000000000004 23.05 9 16.375 23.7 35.325 24.6 10-11 19.3375 33.887499999999996 25.75 21.025 12-13 21.1875 26.0625 28.4 24.349999999999998 14-15 19.25 27.375 29.562500000000004 23.8125 16-17 20.3125 27.5875 28.462500000000002 23.6375 18-19 19.8875 28.9125 27.6 23.599999999999998 20-21 20.0 28.625 27.275 24.099999999999998 22-23 18.89222305576394 30.24506126531633 27.84446111527882 23.018254563640912 24-25 19.675 28.725 27.950000000000003 23.65 26-27 20.150000000000002 27.737499999999997 28.8875 23.225 28-29 20.125 28.475 27.787499999999998 23.6125 30-31 19.5625 28.999999999999996 28.1625 23.275000000000002 32-33 20.42755344418052 28.291036379547442 27.928491061382672 23.35291911488936 34-35 20.6125 27.500000000000004 28.9875 22.900000000000002 36-37 19.900000000000002 28.125 27.800000000000004 24.175 38-39 19.375 28.6375 28.050000000000004 23.9375 40-41 19.8375 28.237499999999997 28.050000000000004 23.875 42-43 19.950000000000003 27.425 28.225 24.4 44-45 19.91996998874578 29.06089783668876 28.535700887832938 22.483431286732525 46-47 20.657746654995623 28.148055520820307 28.973365011879455 22.220832812304614 48-49 20.3625 28.6625 27.1125 23.8625 50-51 20.125 27.725 29.312500000000004 22.8375 52-53 19.912280701754387 28.233082706766915 28.18295739348371 23.671679197994987 54-55 19.71496437054632 28.66608326040755 28.22852856607076 23.39042380297537 56-57 19.775000000000002 28.3875 27.9125 23.925 58-59 20.474999999999998 28.8625 26.924999999999997 23.7375 60-61 19.787499999999998 28.3125 28.1625 23.7375 62-63 20.025000000000002 28.249999999999996 28.1875 23.5375 64-65 20.375 29.075 28.050000000000004 22.5 66-67 19.5625 29.099999999999998 27.900000000000002 23.4375 68-69 20.3625 27.500000000000004 28.95 23.1875 70-71 20.724999999999998 28.325 27.825 23.125 72-73 20.625 27.8625 27.462500000000002 24.05 74-75 20.7 28.5875 27.6 23.1125 76-77 20.025000000000002 29.1875 27.3875 23.400000000000002 78-79 19.807307307307305 28.290790790790794 27.3023023023023 24.5995995995996 80-81 20.655163790947736 28.657164291072768 27.644411102775695 23.0432608152038 82-83 20.682756033512568 28.373139927472803 27.12267100162561 23.82143303738902 84-85 20.925 28.962500000000002 27.1 23.0125 86-87 20.8 28.787499999999998 27.037499999999998 23.375 88-89 21.3875 28.9375 26.6125 23.0625 90-91 20.7125 30.1875 26.1125 22.9875 92-93 21.212500000000002 29.175 26.437500000000004 23.175 94-95 20.875 29.762499999999996 25.874999999999996 23.4875 96-97 20.974999999999998 29.175 25.674999999999997 24.175 98-99 21.6875 28.9375 25.5375 23.8375 100-101 21.6875 29.9625 25.5 22.85 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 1.5 23 2.0 24 1.0 25 1.5 26 3.5 27 6.5 28 9.5 29 17.0 30 20.5 31 23.0 32 32.5 33 43.0 34 51.5 35 58.0 36 86.5 37 118.0 38 146.0 39 166.5 40 186.0 41 214.0 42 234.5 43 265.0 44 272.0 45 271.5 46 274.5 47 266.5 48 240.0 49 204.5 50 177.0 51 137.0 52 110.0 53 94.5 54 70.0 55 44.0 56 33.5 57 31.0 58 22.5 59 14.0 60 8.5 61 8.5 62 8.5 63 4.5 64 2.5 65 3.0 66 2.0 67 1.5 68 2.0 69 2.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.6999999999999997 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.025 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0125 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0375 46-47 0.0375 48-49 0.0 50-51 0.0 52-53 0.25 54-55 0.0125 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.1 80-81 0.025 82-83 0.0375 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79954898521673 99.575 2 0.17539463793535454 0.35000000000000003 3 0.025056376847907794 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0125 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.0625 0.0 0.0 0.0 0.0 50-51 0.1125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.175 0.0 0.0 0.0 0.0 56-57 0.25 0.0 0.0 0.0 0.0 58-59 0.2625 0.0 0.0 0.0 0.0 60-61 0.30000000000000004 0.0 0.0 0.0 0.0 62-63 0.4375 0.0 0.0 0.0 0.0 64-65 0.575 0.0 0.0 0.0 0.0 66-67 0.75 0.0 0.0 0.0 0.0 68-69 0.875 0.0 0.0 0.0 0.0 70-71 1.0375 0.0 0.0 0.0 0.0 72-73 1.3875000000000002 0.0 0.0 0.0 0.0 74-75 1.7374999999999998 0.0 0.0 0.0 0.0 76-77 2.3 0.0 0.0 0.0 0.0 78-79 2.8 0.0 0.0 0.0 0.0 80-81 3.4375 0.0 0.0 0.0 0.0 82-83 3.925 0.0 0.0 0.0 0.0 84-85 4.6 0.0 0.0 0.0 0.0 86-87 5.6125 0.0 0.0 0.0 0.0 88-89 6.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864468 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864468_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.199 34.0 31.0 34.0 31.0 34.0 2 32.22175 34.0 31.0 34.0 30.0 34.0 3 32.29175 34.0 31.0 34.0 30.0 34.0 4 35.65425 37.0 37.0 37.0 33.0 37.0 5 35.5825 37.0 37.0 37.0 35.0 37.0 6 35.6855 37.0 37.0 37.0 35.0 37.0 7 35.60425 37.0 37.0 37.0 35.0 37.0 8 35.542 37.0 37.0 37.0 35.0 37.0 9 37.30925 39.0 38.0 39.0 35.0 39.0 10-11 37.137875 39.0 38.0 39.0 34.0 39.0 12-13 37.122749999999996 39.0 38.0 39.0 33.5 39.0 14-15 38.46175 41.0 38.5 41.0 34.0 41.0 16-17 38.421875 41.0 38.5 41.0 33.5 41.0 18-19 38.362875 41.0 38.0 41.0 33.5 41.0 20-21 38.31 41.0 39.0 41.0 34.0 41.0 22-23 38.116625 40.0 38.0 41.0 33.0 41.0 24-25 38.180375 40.0 38.0 41.0 34.0 41.0 26-27 38.146375 40.0 38.0 41.0 33.5 41.0 28-29 37.982749999999996 40.0 38.0 41.0 33.0 41.0 30-31 37.908875 40.0 38.0 41.0 33.0 41.0 32-33 37.718625 40.0 38.0 41.0 32.5 41.0 34-35 37.7415 40.0 38.0 41.0 32.5 41.0 36-37 37.42 40.0 38.0 41.0 31.0 41.0 38-39 37.294624999999996 40.0 38.0 41.0 31.0 41.0 40-41 37.2965 40.0 38.0 41.0 31.0 41.0 42-43 37.118875 40.0 38.0 41.0 31.0 41.0 44-45 36.973 40.0 37.0 41.0 30.0 41.0 46-47 36.750875 40.0 37.0 41.0 30.0 41.0 48-49 36.582375 40.0 36.0 41.0 30.0 41.0 50-51 36.242625 39.5 36.5 40.5 29.5 41.0 52-53 36.492000000000004 39.0 37.0 40.5 30.0 41.0 54-55 36.795249999999996 40.0 37.0 41.0 30.5 41.0 56-57 36.698375 40.0 37.0 41.0 30.5 41.0 58-59 36.374125 39.5 36.0 41.0 29.0 41.0 60-61 36.1255 39.0 36.0 41.0 29.0 41.0 62-63 35.843625 39.0 35.0 41.0 28.0 41.0 64-65 35.524125 38.5 35.0 40.5 28.0 41.0 66-67 35.217875 38.0 35.0 40.0 28.5 41.0 68-69 34.7205 37.0 34.0 40.0 27.5 41.0 70-71 34.274875 36.5 34.0 39.0 26.5 41.0 72-73 33.845375000000004 36.0 34.0 39.0 26.0 40.5 74-75 33.348375000000004 36.0 34.0 38.5 25.5 39.5 76-77 32.6465 35.0 32.5 37.0 24.5 39.0 78-79 32.284 35.0 32.0 37.0 24.0 39.0 80-81 31.979375 35.0 32.0 36.0 23.5 37.5 82-83 31.6765 35.0 32.0 36.0 24.0 37.0 84-85 31.180125 35.0 32.0 35.0 20.5 37.0 86-87 30.634999999999998 34.5 31.0 35.0 19.0 36.0 88-89 30.194875 34.0 31.0 35.0 13.5 36.0 90-91 30.094749999999998 34.0 31.0 35.0 11.0 36.0 92-93 29.808125 34.0 30.5 35.0 6.5 35.0 94-95 29.68475 34.0 31.0 35.0 2.0 35.0 96-97 28.7295 34.0 29.5 35.0 2.0 35.0 98-99 28.234375 34.0 29.0 35.0 2.0 35.0 100-101 26.986625 33.0 27.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 22.0 3 8.0 4 5.0 5 4.0 6 4.0 7 6.0 8 7.0 9 12.0 10 5.0 11 12.0 12 10.0 13 14.0 14 16.0 15 13.0 16 19.0 17 8.0 18 15.0 19 10.0 20 15.0 21 15.0 22 23.0 23 20.0 24 27.0 25 30.0 26 38.0 27 41.0 28 49.0 29 45.0 30 63.0 31 68.0 32 105.0 33 123.0 34 188.0 35 262.0 36 487.0 37 849.0 38 1145.0 39 217.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.629629629629626 17.24224224224224 13.588588588588587 39.53953953953954 2 24.474474474474476 22.54754754754755 37.88788788788789 15.090090090090092 3 19.46459844883663 27.1703777833375 30.823117338003502 22.54190642982237 4 22.147147147147148 34.434434434434436 23.5985985985986 19.81981981981982 5 24.06805103827871 35.851888916687514 23.54265699274456 16.537403052289218 6 19.400000000000002 38.425 24.7 17.474999999999998 7 20.05 18.95 40.375 20.625 8 21.38569284642321 23.336668334167083 31.140570285142573 24.137068534267133 9 21.224999999999998 23.674999999999997 31.825 23.275000000000002 10-11 22.843210802700675 31.807951987997 24.69367341835459 20.655163790947736 12-13 24.005006257822277 25.46933667083855 27.972465581977474 22.5531914893617 14-15 22.31270358306189 27.411676271611125 29.403658231019797 20.871961914307192 16-17 23.36086086086086 27.677677677677675 28.34084084084084 20.62062062062062 18-19 23.92446223111556 29.00200100050025 26.075537768884445 20.99799899949975 20-21 23.68388145554583 28.660747780417655 27.77291484306615 19.88245592097036 22-23 22.5625 28.675 27.3375 21.425 24-25 22.8875 27.925 29.15 20.0375 26-27 23.9125 26.9125 28.5625 20.6125 28-29 23.20580145036259 27.53188297074269 28.032008002000502 21.230307576894223 30-31 22.6875 28.65 27.487499999999997 21.175 32-33 23.525 27.85 27.962500000000002 20.6625 34-35 23.200000000000003 27.962500000000002 28.0625 20.775 36-37 23.1625 27.3 29.1625 20.375 38-39 22.4625 28.5625 28.549999999999997 20.424999999999997 40-41 23.88395648368138 27.92297111416781 27.622858571964485 20.570213830186322 42-43 23.1 27.675 28.9 20.325 44-45 23.2125 28.025 28.712500000000002 20.05 46-47 22.9375 27.9125 28.287499999999998 20.8625 48-49 23.3625 28.6375 27.8375 20.1625 50-51 23.8375 28.175 27.5875 20.4 52-53 23.6125 27.9375 27.8875 20.5625 54-55 23.3991995997999 27.62631315657829 28.714357178589296 20.260130065032516 56-57 23.570624296259226 28.424871762792442 28.074565244589017 19.929938696359315 58-59 22.933600100037513 28.448168063023633 27.447792922345883 21.170438914592975 60-61 23.525 28.287499999999998 28.549999999999997 19.6375 62-63 23.3625 28.625 27.787499999999998 20.225 64-65 23.425 28.8375 27.8125 19.925 66-67 23.0625 28.349999999999998 28.487499999999997 20.1 68-69 23.9875 27.712500000000002 27.825 20.474999999999998 70-71 23.775 27.6625 28.775000000000002 19.787499999999998 72-73 23.849999999999998 28.037499999999998 27.737499999999997 20.375 74-75 24.1125 28.1625 27.8125 19.9125 76-77 23.9 28.3875 27.800000000000004 19.9125 78-79 23.599999999999998 29.325000000000003 27.55 19.525000000000002 80-81 23.665458182272783 29.016127015876986 27.228403550443808 20.090011251406427 82-83 24.8125 26.85 27.675 20.6625 84-85 24.1375 27.962500000000002 27.3 20.599999999999998 86-87 25.4 28.825 26.2125 19.5625 88-89 24.6 28.7375 27.6 19.0625 90-91 24.5125 27.962500000000002 27.6 19.925 92-93 25.35 28.725 27.425 18.5 94-95 25.924999999999997 28.787499999999998 25.95 19.3375 96-97 25.7875 29.3375 25.924999999999997 18.95 98-99 26.525 28.249999999999996 26.275 18.95 100-101 26.825 28.3125 25.5625 19.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 1.5 24 1.0 25 2.5 26 3.0 27 3.5 28 6.5 29 10.5 30 15.5 31 16.5 32 22.0 33 41.5 34 62.0 35 75.0 36 93.5 37 117.0 38 139.5 39 167.5 40 200.0 41 220.5 42 235.0 43 261.5 44 285.5 45 274.0 46 253.5 47 242.0 48 232.5 49 217.5 50 187.5 51 153.5 52 112.0 53 88.0 54 65.5 55 45.0 56 35.0 57 27.0 58 25.0 59 16.5 60 10.5 61 8.5 62 5.5 63 3.5 64 3.5 65 3.5 66 2.0 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.1 3 0.075 4 0.1 5 0.075 6 0.0 7 0.0 8 0.05 9 0.0 10-11 0.025 12-13 0.125 14-15 0.22499999999999998 16-17 0.1 18-19 0.05 20-21 0.0375 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.025 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0375 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.05 56-57 0.08750000000000001 58-59 0.0375 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0125 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0125 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.0625 0.0 0.0 0.0 0.0 50-51 0.1125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.175 0.0 0.0 0.0 0.0 56-57 0.25 0.0 0.0 0.0 0.0 58-59 0.275 0.0 0.0 0.0 0.0 60-61 0.32499999999999996 0.0 0.0 0.0 0.0 62-63 0.4625 0.0 0.0 0.0 0.0 64-65 0.6 0.0 0.0 0.0 0.0 66-67 0.775 0.0 0.0 0.0 0.0 68-69 0.8999999999999999 0.0 0.0 0.0 0.0 70-71 1.0875 0.0 0.0 0.0 0.0 72-73 1.4375 0.0 0.0 0.0 0.0 74-75 1.7875 0.0 0.0 0.0 0.0 76-77 2.325 0.0 0.0 0.0 0.0 78-79 2.825 0.0 0.0 0.0 0.0 80-81 3.4124999999999996 0.0 0.0 0.0 0.0 82-83 3.925 0.0 0.0 0.0 0.0 84-85 4.6 0.0 0.0 0.0 0.0 86-87 5.6625 0.0 0.0 0.0 0.0 88-89 6.675000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 605633 spots for ERR1864468.sra Written 605633 spots for ERR1864468.sra Read 605633 spots for ERR1864468.sra Written 605633 spots for ERR1864468.sra Read 605633 spots for ERR1864468.sra Written 605633 spots for ERR1864468.sra Read 605633 spots for ERR1864468.sra Written 605633 spots for ERR1864468.sra Read 605633 spots for ERR1864468.sra Written 605633 spots for ERR1864468.sra Read 605633 spots for ERR1864468.sra Written 605633 spots for ERR1864468.sra Read 605633 spots for ERR1864468.sra Written 605633 spots for ERR1864468.sra Read 605633 spots for ERR1864468.sra Written 605633 spots for ERR1864468.sra Read 605633 spots for ERR1864468.sra Written 605633 spots for ERR1864468.sra Read 605633 spots for ERR1864468.sra Written 605633 spots for ERR1864468.sra Read 605633 spots for ERR1864468.sra Written 605633 spots for ERR1864468.sra Read 605633 spots for ERR1864468.sra Written 605633 spots for ERR1864468.sra Read 605633 spots for ERR1864468.sra Written 605633 spots for ERR1864468.sra Read 605646 spots for ERR1864468.sra Written 605646 spots for ERR1864468.sra Read 605633 spots for ERR1864468.sra Written 605633 spots for ERR1864468.sra Read 605633 spots for ERR1864468.sra Written 605633 spots for ERR1864468.sra Read 605633 spots for ERR1864468.sra Written 605633 spots for ERR1864468.sra Read 605633 spots for ERR1864468.sra Written 605633 spots for ERR1864468.sra Read 605633 spots for ERR1864468.sra Written 605633 spots for ERR1864468.sra Read 605633 spots for ERR1864468.sra Written 605633 spots for ERR1864468.sra SRR ids: ['ERR1864468.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ypeuci_n ERR1864468.sra spots: 12112673 blocks: [[1, 605633], [605634, 1211266], [1211267, 1816899], [1816900, 2422532], [2422533, 3028165], [3028166, 3633798], [3633799, 4239431], [4239432, 4845064], [4845065, 5450697], [5450698, 6056330], [6056331, 6661963], [6661964, 7267596], [7267597, 7873229], [7873230, 8478862], [8478863, 9084495], [9084496, 9690128], [9690129, 10295761], [10295762, 10901394], [10901395, 11507027], [11507028, 12112673]] ERR1864468 file size 2900008 ERR1864468 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864468 ERR1864468_1.fastq ERR1864468_2.fastq Input file: ERR1864468_1.fastq Paired file: ERR1864468_2.fastq trimmed: ERR1864468-trimmed-pair1.fastq, ERR1864468-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 12:55:21 2025 >> started Thu Feb 13 12:55:39 2025 >> done (17.257s) 12112673 read pairs processed; of these: 125941 ( 1.04%) short read pairs filtered out after trimming by size control 130769 ( 1.08%) empty read pairs filtered out after trimming by size control 11855963 (97.88%) read pairs available; of these: 3520512 (29.69%) trimmed read pairs available after processing 8335451 (70.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 73 0.00% 19 160 0.00% 20 190 0.00% 21 292 0.00% 22 327 0.00% 23 425 0.00% 24 491 0.00% 25 588 0.00% 26 664 0.01% 27 801 0.01% 28 887 0.01% 29 966 0.01% 30 1155 0.01% 31 1386 0.01% 32 1616 0.01% 33 1804 0.02% 34 1881 0.02% 35 2117 0.02% 36 2348 0.02% 37 2477 0.02% 38 2753 0.02% 39 3003 0.03% 40 3341 0.03% 41 3462 0.03% 42 3819 0.03% 43 4161 0.04% 44 4421 0.04% 45 4735 0.04% 46 5086 0.04% 47 5415 0.05% 48 5913 0.05% 49 6375 0.05% 50 6742 0.06% 51 7139 0.06% 52 7867 0.07% 53 8393 0.07% 54 8928 0.08% 55 9537 0.08% 56 10532 0.09% 57 11144 0.09% 58 12200 0.10% 59 15116 0.13% 60 17803 0.15% 61 18847 0.16% 62 20215 0.17% 63 21211 0.18% 64 23145 0.20% 65 24061 0.20% 66 25423 0.21% 67 27392 0.23% 68 28773 0.24% 69 30718 0.26% 70 32883 0.28% 71 35101 0.30% 72 37682 0.32% 73 39934 0.34% 74 42161 0.36% 75 44321 0.37% 76 46523 0.39% 77 50158 0.42% 78 52974 0.45% 79 56218 0.47% 80 60032 0.51% 81 63981 0.54% 82 67905 0.57% 83 71086 0.60% 84 75829 0.64% 85 79721 0.67% 86 84097 0.71% 87 88082 0.74% 88 90959 0.77% 89 94444 0.80% 90 99993 0.84% 91 106774 0.90% 92 112572 0.95% 93 119791 1.01% 94 128330 1.08% 95 140843 1.19% 96 155167 1.31% 97 179008 1.51% 98 214669 1.81% 99 261631 2.21% 100 379325 3.20% 101 8335451 70.31% 11855963 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=3.49 fanout-score-rank=25 prefix-density=0.16 prefix-fanout=2.6 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.06 sequence-density-rank=27 fanout-score=351.71 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=26.5 sequence=CTTCTTCTTCTC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=36 prefix-density=0.11 prefix-fanout=2.3 sequence=CCAGACCAGCAGAGG criterion=fanout-score sequence-density=0.07 sequence-density-rank=20 fanout-score=292.25 fanout-score-rank=1 prefix-density=0.76 prefix-fanout=25.4 sequence=AAGAAGAAGAAA ERR1864468 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 12:56:10 Started mapping on | Feb 13 12:56:11 Finished on | Feb 13 12:56:42 Mapping speed, Million of reads per hour | 1376.82 Number of input reads | 11855963 Average input read length | 193 UNIQUE READS: Uniquely mapped reads number | 11450653 Uniquely mapped reads % | 96.58% Average mapped length | 193.46 Number of splices: Total | 6775663 Number of splices: Annotated (sjdb) | 6655676 Number of splices: GT/AG | 6673829 Number of splices: GC/AG | 87634 Number of splices: AT/AC | 5411 Number of splices: Non-canonical | 8789 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 2.21 Insertion rate per base | 0.01% Insertion average length | 1.85 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 237223 % of reads mapped to multiple loci | 2.00% Number of reads mapped to too many loci | 106443 % of reads mapped to too many loci | 0.90% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.45% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 181709 181709 181709 N_multimapping 237223 237223 237223 N_noFeature 365611 11322604 422195 N_ambiguous 116359 500 44577 UnstrandedReadsAssigned:10968683 PositiveStrandReadsAssigned:127549 NegativeStrandReadsAssigned:10983881 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=98 echo kmer=93 ERR1864468 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864468-trimmed-pair1.fastq ERR1864468-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,855,963 reads, 11,156,514 reads pseudoaligned [quant] estimated average fragment length: 145.891 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,078 rounds 52401 ERR1864468.ke.tsv 34699 ERR1864468.se.tsv 87100 total ==> ERR1864468.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1873.11 322 20.2028 Potri.005G024800.1.v4.1 1035 890.109 83 10.9586 Potri.004G059700.1.v4.1 961 816.117 2 0.288002 Potri.007G009000.2.v4.1 1416 1271.11 0 0 Potri.003G141000.2.v4.1 2943 2798.11 520.951 21.8802 Potri.016G087400.1.v4.1 270 132.455 746 661.893 Potri.015G069301.1.v4.1 564 419.209 0 0 Potri.010G195200.1.v4.1 1773 1628.11 32 2.30986 Potri.012G127500.1.v4.1 977 832.113 306 43.2173 ==> ERR1864468.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 823 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 330 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 ERR1864468 completed mapping pipeline successfully