Starting /dee2/code/volunteer_pipeline.sh ERR1864469 current disk space = 3091757862912 free memory = 1436091220 ERR1864469 SRAfilesize f14402248cec71a57d381831d9afc747 ERR1864469.sra ERR1864469.sra file validated ERR1864469 is paired end ERR1864469 is conventional basespace ERR1864469 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864469_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.612 34.0 31.0 34.0 26.0 34.0 2 31.554 34.0 31.0 34.0 28.0 34.0 3 32.14575 34.0 31.0 34.0 29.0 34.0 4 35.54625 37.0 35.0 37.0 33.0 37.0 5 35.58575 37.0 35.0 37.0 33.0 37.0 6 35.53725 37.0 35.0 37.0 33.0 37.0 7 35.45425 37.0 35.0 37.0 33.0 37.0 8 35.494 37.0 35.0 37.0 33.0 37.0 9 37.20925 39.0 38.0 39.0 34.0 39.0 10-11 37.1075 39.0 37.5 39.0 34.0 39.0 12-13 37.07575 39.0 38.0 39.0 34.0 39.0 14-15 38.450874999999996 41.0 39.0 41.0 34.0 41.0 16-17 38.357875 41.0 38.0 41.0 33.5 41.0 18-19 38.4195 41.0 38.5 41.0 33.5 41.0 20-21 38.326875 41.0 38.5 41.0 34.0 41.0 22-23 38.215125 40.0 38.0 41.0 33.5 41.0 24-25 38.049625000000006 40.0 38.0 41.0 33.0 41.0 26-27 38.124 40.0 38.0 41.0 33.5 41.0 28-29 37.94 40.0 38.0 41.0 33.0 41.0 30-31 37.806875000000005 40.0 38.0 41.0 33.0 41.0 32-33 37.722375 40.0 38.0 41.0 32.0 41.0 34-35 37.590374999999995 40.0 38.0 41.0 32.0 41.0 36-37 37.474625 40.0 38.0 41.0 32.0 41.0 38-39 37.3515 40.0 38.0 41.0 32.0 41.0 40-41 37.277625 40.0 38.0 41.0 31.5 41.0 42-43 37.111374999999995 40.0 37.0 41.0 31.0 41.0 44-45 37.04875 40.0 37.5 41.0 30.5 41.0 46-47 37.142624999999995 40.0 38.0 41.0 31.0 41.0 48-49 37.207 40.0 38.0 41.0 32.0 41.0 50-51 37.067875 40.0 37.0 41.0 31.0 41.0 52-53 36.8455 40.0 37.0 41.0 30.5 41.0 54-55 36.748625000000004 40.0 36.5 41.0 30.5 41.0 56-57 36.576125 40.0 36.5 41.0 30.5 41.0 58-59 36.2695 39.5 36.0 41.0 29.0 41.0 60-61 36.0505 39.0 36.0 41.0 28.5 41.0 62-63 35.759375000000006 39.0 35.0 40.5 28.0 41.0 64-65 35.287375 38.0 35.0 40.0 28.0 41.0 66-67 34.945625 38.0 34.0 40.0 28.0 41.0 68-69 34.6895 37.0 34.0 40.0 27.0 41.0 70-71 34.333124999999995 37.0 34.0 39.0 28.0 41.0 72-73 33.785624999999996 36.0 34.0 39.0 26.0 40.0 74-75 33.173249999999996 35.5 33.0 37.5 26.0 39.5 76-77 32.119625 35.0 31.5 36.5 25.0 39.0 78-79 32.341875 35.0 32.5 37.0 25.0 39.0 80-81 32.223375 35.0 33.0 36.0 26.0 37.5 82-83 31.989375000000003 35.0 32.5 36.0 26.0 37.0 84-85 31.52225 35.0 32.0 35.0 23.5 37.0 86-87 30.849125 34.0 31.0 35.0 20.0 36.0 88-89 30.749875000000003 34.0 31.0 35.0 20.5 36.0 90-91 30.58625 34.0 31.0 35.0 20.0 36.0 92-93 30.292875 34.0 31.0 35.0 19.0 35.0 94-95 30.077875 34.0 31.0 35.0 17.5 35.0 96-97 29.90475 34.0 31.0 35.0 4.5 35.0 98-99 29.37725 34.0 30.5 35.0 2.0 35.0 100-101 28.411250000000003 33.5 28.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 32.0 3 13.0 4 10.0 5 6.0 6 6.0 7 10.0 8 6.0 9 6.0 10 12.0 11 10.0 12 8.0 13 8.0 14 8.0 15 7.0 16 14.0 17 10.0 18 9.0 19 13.0 20 15.0 21 12.0 22 18.0 23 23.0 24 21.0 25 25.0 26 20.0 27 29.0 28 45.0 29 43.0 30 61.0 31 79.0 32 94.0 33 138.0 34 166.0 35 247.0 36 423.0 37 943.0 38 1227.0 39 183.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.07392996108949 10.350194552529182 9.130998702983138 47.44487678339818 2 20.925 15.299999999999999 36.6 27.175 3 20.575 17.95 24.325 37.15 4 23.75 27.825 21.675 26.75 5 23.36168084042021 31.740870435217612 25.237618809404704 19.65982991495748 6 17.479369842460617 36.084021005251316 25.906476619154787 20.530132533133283 7 14.003500875218805 25.406351587896975 42.66066516629157 17.92948237059265 8 17.60440110027507 26.38159539884971 31.882970742685675 24.131032758189548 9 17.27931982995749 24.131032758189548 35.3088272068017 23.280820205051263 10-11 19.51981993247468 34.42540952857321 24.97186444916844 21.082906089783666 12-13 21.34817408704352 25.950475237618807 28.414207103551774 24.287143571785894 14-15 19.697348674337167 27.313656828414207 29.927463731865934 23.06153076538269 16-17 19.884942471235618 29.052026013006504 27.37618809404702 23.686843421710854 18-19 19.78489244622311 28.88944472236118 27.963981990995496 23.36168084042021 20-21 19.247123561780892 28.38919459729865 28.039019509754876 24.324662331165584 22-23 20.39769884942471 29.664832416208103 27.101050525262632 22.836418209104554 24-25 19.422211105552776 28.55177588794397 28.101550775387697 23.92446223111556 26-27 19.834917458729365 28.864432216108053 27.851425712856425 23.449224612306153 28-29 19.18459229614807 29.514757378689342 28.23911955977989 23.06153076538269 30-31 19.797398699349674 29.052026013006504 27.651325662831418 23.499249624812407 32-33 19.5847923961981 28.789394697348676 28.076538269134566 23.54927463731866 34-35 19.957484056521196 29.59859947480305 27.560335125672125 22.883581343003627 36-37 20.12004501688133 28.335625859697387 28.048018006752535 23.49631111666875 38-39 20.247623811905953 28.301650825412704 28.001500750375186 23.449224612306153 40-41 19.78489244622311 29.127063531765884 28.001500750375186 23.08654327163582 42-43 19.072036018009005 28.114057028514257 28.414207103551774 24.399699849924964 44-45 19.93496748374187 28.339169584792394 28.214107053526767 23.51175587793897 46-47 20.972986493246623 27.901450725362682 27.41370685342671 23.71185592796398 48-49 20.110055027513756 27.838919459729865 28.2016008004002 23.84942471235618 50-51 20.522761380690348 28.83941970985493 27.62631315657829 23.011505752876438 52-53 21.24248496993988 29.10821643286573 27.530060120240478 22.11923847695391 54-55 19.89744872436218 28.751875937968986 27.901450725362682 23.449224612306153 56-57 20.420157559084657 28.2856071026635 27.49781167937977 23.796423658872076 58-59 20.27263631815908 28.53926963481741 27.063531765882942 24.12456228114057 60-61 19.872436218109055 28.5767883941971 27.501250625312657 24.049524762381193 62-63 20.525 28.725 27.737499999999997 23.0125 64-65 21.175 28.975 27.787499999999998 22.0625 66-67 20.7375 29.299999999999997 26.887499999999996 23.075000000000003 68-69 20.175 28.825 27.400000000000002 23.599999999999998 70-71 21.05 28.787499999999998 27.325 22.8375 72-73 20.7875 28.212500000000002 28.037499999999998 22.9625 74-75 20.25 28.1625 28.4 23.1875 76-77 20.875 28.799999999999997 27.5875 22.7375 78-79 21.286447253159803 28.882492804404958 27.74371167563509 22.08734826680015 80-81 20.665083135391924 28.59107388423553 27.103387923490434 23.64045505688211 82-83 21.705426356589147 28.619654913728432 26.469117279319832 23.20580145036259 84-85 20.9375 28.825 27.474999999999998 22.7625 86-87 21.087500000000002 29.1625 27.025 22.725 88-89 20.75 29.3875 26.224999999999998 23.6375 90-91 19.9625 29.3875 26.187500000000004 24.462500000000002 92-93 21.2625 29.549999999999997 25.85 23.3375 94-95 21.3875 29.9875 24.9 23.724999999999998 96-97 21.65 29.612500000000004 24.6875 24.05 98-99 21.6125 29.5875 25.924999999999997 22.875 100-101 21.45 29.4375 24.975 24.1375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 1.0 23 2.5 24 2.5 25 1.0 26 4.5 27 7.0 28 9.0 29 13.5 30 20.0 31 27.0 32 33.0 33 40.5 34 54.0 35 64.5 36 87.5 37 110.5 38 128.5 39 164.0 40 185.0 41 206.5 42 229.5 43 252.0 44 274.5 45 275.5 46 289.5 47 291.0 48 245.5 49 209.0 50 180.0 51 139.5 52 108.0 53 84.5 54 63.5 55 48.0 56 35.5 57 30.0 58 24.0 59 12.5 60 7.0 61 4.5 62 8.0 63 8.0 64 3.0 65 1.5 66 0.5 67 1.5 68 1.0 69 2.0 70 2.5 71 1.0 72 1.5 73 1.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.6249999999999996 2 0.0 3 0.0 4 0.0 5 0.05 6 0.025 7 0.025 8 0.025 9 0.025 10-11 0.0375 12-13 0.05 14-15 0.05 16-17 0.05 18-19 0.05 20-21 0.05 22-23 0.05 24-25 0.05 26-27 0.05 28-29 0.05 30-31 0.05 32-33 0.05 34-35 0.0375 36-37 0.0375 38-39 0.05 40-41 0.05 42-43 0.05 44-45 0.05 46-47 0.05 48-49 0.05 50-51 0.05 52-53 0.2 54-55 0.05 56-57 0.0375 58-59 0.05 60-61 0.05 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.11249999999999999 80-81 0.0125 82-83 0.025 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.1125 0.0 0.0 0.0 0.0 60-61 0.175 0.0 0.0 0.0 0.0 62-63 0.25 0.0 0.0 0.0 0.0 64-65 0.44999999999999996 0.0 0.0 0.0 0.0 66-67 0.5875 0.0 0.0 0.0 0.0 68-69 0.7749999999999999 0.0 0.0 0.0 0.0 70-71 1.0375 0.0 0.0 0.0 0.0 72-73 1.5625 0.0 0.0 0.0 0.0 74-75 1.9625 0.0 0.0 0.0 0.0 76-77 2.7125 0.0 0.0 0.0 0.0 78-79 3.25 0.0 0.0 0.0 0.0 80-81 3.7750000000000004 0.0 0.0 0.0 0.0 82-83 4.4125 0.0 0.0 0.0 0.0 84-85 5.2 0.0 0.0 0.0 0.0 86-87 6.074999999999999 0.0 0.0 0.0 0.0 88-89 7.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864469 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864469_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.05325 34.0 31.0 34.0 30.0 34.0 2 32.146 34.0 31.0 34.0 30.0 34.0 3 32.215 34.0 31.0 34.0 30.0 34.0 4 35.5995 37.0 35.0 37.0 33.0 37.0 5 35.5155 37.0 35.0 37.0 33.0 37.0 6 35.59275 37.0 36.0 37.0 33.0 37.0 7 35.541 37.0 36.0 37.0 33.0 37.0 8 35.49425 37.0 35.0 37.0 33.0 37.0 9 37.18 39.0 38.0 39.0 34.0 39.0 10-11 37.16225 39.0 38.0 39.0 34.0 39.0 12-13 37.07825 39.0 37.5 39.0 33.0 39.0 14-15 38.455124999999995 41.0 38.0 41.0 33.5 41.0 16-17 38.354 40.5 38.0 41.0 33.5 41.0 18-19 38.2705 41.0 38.0 41.0 33.0 41.0 20-21 38.285375 40.0 38.5 41.0 33.0 41.0 22-23 37.992999999999995 40.0 38.0 41.0 32.5 41.0 24-25 38.096999999999994 40.0 38.0 41.0 33.0 41.0 26-27 37.989875 40.0 38.0 41.0 32.5 41.0 28-29 37.860749999999996 40.0 38.0 41.0 33.0 41.0 30-31 37.741625 40.0 38.0 41.0 33.0 41.0 32-33 37.564875 40.0 38.0 41.0 31.5 41.0 34-35 37.547 40.0 38.0 41.0 32.0 41.0 36-37 37.334 40.0 38.0 41.0 31.0 41.0 38-39 37.175625 40.0 37.5 41.0 30.5 41.0 40-41 37.112625 40.0 37.0 41.0 30.0 41.0 42-43 36.97625 40.0 37.0 41.0 30.0 41.0 44-45 36.850625 40.0 37.0 41.0 30.0 41.0 46-47 36.674 40.0 37.0 41.0 30.0 41.0 48-49 36.501125 40.0 36.0 41.0 29.5 41.0 50-51 36.146625 39.0 36.0 40.5 29.0 41.0 52-53 36.404375 39.0 36.5 40.5 30.0 41.0 54-55 36.821124999999995 40.0 37.0 41.0 31.0 41.0 56-57 36.745875 40.0 36.5 41.0 30.0 41.0 58-59 36.397000000000006 39.5 36.0 41.0 29.0 41.0 60-61 36.064750000000004 39.0 35.0 41.0 28.0 41.0 62-63 35.89075 39.0 35.0 41.0 28.5 41.0 64-65 35.542625 38.5 35.0 40.5 28.5 41.0 66-67 35.149625 38.0 34.5 40.0 27.0 41.0 68-69 34.7775 37.0 34.0 40.0 28.0 41.0 70-71 34.231125 36.5 34.0 39.0 26.0 41.0 72-73 33.67325 36.0 34.0 39.0 26.0 40.5 74-75 33.244749999999996 35.5 33.0 38.5 26.0 39.5 76-77 32.41825 35.0 32.5 37.0 23.0 39.0 78-79 32.077875 35.0 32.0 37.0 22.0 39.0 80-81 31.774500000000003 35.0 32.0 36.0 22.0 37.5 82-83 31.421125 35.0 32.0 36.0 21.5 37.0 84-85 30.89525 35.0 31.0 35.0 19.0 37.0 86-87 30.341375 34.5 31.0 35.0 15.0 36.0 88-89 30.015875 34.0 31.0 35.0 10.5 36.0 90-91 29.971 34.0 31.0 35.0 8.5 35.5 92-93 29.633875 34.0 30.0 35.0 2.0 35.0 94-95 29.277124999999998 34.0 30.0 35.0 2.0 35.0 96-97 28.44525 34.0 28.5 35.0 2.0 35.0 98-99 27.942749999999997 34.0 29.0 35.0 2.0 35.0 100-101 26.7575 33.0 26.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 8.0 4 6.0 5 3.0 6 5.0 7 8.0 8 10.0 9 10.0 10 6.0 11 10.0 12 7.0 13 15.0 14 10.0 15 11.0 16 19.0 17 15.0 18 18.0 19 23.0 20 27.0 21 15.0 22 22.0 23 22.0 24 20.0 25 34.0 26 33.0 27 51.0 28 42.0 29 60.0 30 60.0 31 85.0 32 99.0 33 140.0 34 170.0 35 267.0 36 463.0 37 900.0 38 1093.0 39 197.0 40 1.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.090545272636316 17.483741870935468 13.956978489244623 37.46873436718359 2 24.074074074074073 24.024024024024023 36.23623623623624 15.665665665665665 3 20.23511755877939 27.538769384692348 29.289644822411205 22.936468234117058 4 23.404255319148938 33.942428035043804 23.178973717146434 19.474342928660825 5 24.83741870935468 35.01750875437719 22.436218109054526 17.70885442721361 6 20.849999999999998 35.575 25.224999999999998 18.35 7 20.625 19.950000000000003 38.800000000000004 20.625 8 20.355088772193046 23.55588897224306 31.58289572393098 24.50612653163291 9 22.0 23.65 32.025 22.325 10-11 23.377922240280036 31.59144893111639 24.72809101137642 20.302537817227154 12-13 23.035535535535537 25.18768768768769 28.07807807807808 23.6986986986987 14-15 22.28900576008014 28.424743300776356 27.96143250688705 21.32481843225645 16-17 23.6986986986987 27.94044044044044 26.38888888888889 21.97197197197197 18-19 23.936968484242122 28.376688344172084 27.313656828414207 20.372686343171587 20-21 23.168292073018254 28.057014253563388 27.656914228557138 21.117779444861213 22-23 23.45 27.5625 28.525 20.4625 24-25 22.8125 27.950000000000003 28.812500000000004 20.424999999999997 26-27 22.727840980122515 28.528566070758842 28.103512939117394 20.64008001000125 28-29 22.677834729341168 28.56607075884486 28.378547318414803 20.377547193399177 30-31 23.2625 27.150000000000002 28.775000000000002 20.8125 32-33 23.525 27.625 28.925 19.925 34-35 23.599999999999998 27.462500000000002 28.287499999999998 20.65 36-37 23.35 27.8125 28.4 20.4375 38-39 22.85 27.8125 27.6 21.7375 40-41 23.980995248812203 28.107026756689173 27.781945486371594 20.130032508127034 42-43 23.0278784848106 27.65345668208526 28.57857232154019 20.740092511563944 44-45 23.474999999999998 28.1 28.7 19.725 46-47 23.525 28.025 28.125 20.325 48-49 22.475 28.725 28.199999999999996 20.599999999999998 50-51 22.975 28.499999999999996 28.7 19.825 52-53 22.930732683170792 28.094523630907727 28.057014253563388 20.91772943235809 54-55 22.53063265816454 27.581895473868467 29.119779944986245 20.767691922980745 56-57 22.36118059029515 28.151575787893947 27.963981990995496 21.52326163081541 58-59 23.980995248812203 28.207051762940733 27.694423605901473 20.117529382345587 60-61 22.6375 28.6625 28.7375 19.9625 62-63 23.5 26.8625 29.6375 20.0 64-65 23.75 27.3125 29.0875 19.85 66-67 23.674999999999997 27.450000000000003 28.849999999999998 20.025000000000002 68-69 23.3375 28.050000000000004 28.625 19.9875 70-71 23.799999999999997 28.125 27.8875 20.1875 72-73 23.7875 27.762500000000003 28.499999999999996 19.950000000000003 74-75 24.349999999999998 28.1125 27.425 20.1125 76-77 23.5 28.575 27.8125 20.1125 78-79 23.75 28.1875 28.425 19.6375 80-81 25.090636329541194 27.3284160520065 27.528441055131893 20.052506563320417 82-83 25.162499999999998 27.987499999999997 26.85 20.0 84-85 25.05 27.975 27.3375 19.6375 86-87 24.887500000000003 27.6875 27.575 19.85 88-89 25.374999999999996 27.450000000000003 27.437499999999996 19.7375 90-91 25.2875 27.700000000000003 27.400000000000002 19.6125 92-93 26.0625 29.3375 25.35 19.25 94-95 25.837500000000002 28.1875 27.1625 18.8125 96-97 25.887500000000003 29.4125 26.150000000000002 18.55 98-99 26.2625 29.062500000000004 25.937500000000004 18.7375 100-101 27.5875 28.037499999999998 25.474999999999998 18.9 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.0 23 1.5 24 1.0 25 2.0 26 5.0 27 8.0 28 9.0 29 11.0 30 20.0 31 26.0 32 27.0 33 36.0 34 47.5 35 62.0 36 79.5 37 107.5 38 143.0 39 165.0 40 179.5 41 204.5 42 241.5 43 264.0 44 271.0 45 293.5 46 300.5 47 269.5 48 239.0 49 208.0 50 170.5 51 128.0 52 104.0 53 94.5 54 72.0 55 54.5 56 38.0 57 29.0 58 26.5 59 16.5 60 9.0 61 6.0 62 6.0 63 6.5 64 4.5 65 1.5 66 1.5 67 2.0 68 0.5 69 0.5 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.1 3 0.05 4 0.125 5 0.05 6 0.0 7 0.0 8 0.025 9 0.0 10-11 0.0125 12-13 0.1 14-15 0.17500000000000002 16-17 0.1 18-19 0.05 20-21 0.025 22-23 0.0 24-25 0.0 26-27 0.0125 28-29 0.0125 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.025 42-43 0.0125 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.025 54-55 0.025 56-57 0.05 58-59 0.025 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0125 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.0875 0.0 0.0 0.0 0.0 58-59 0.16249999999999998 0.0 0.0 0.0 0.0 60-61 0.225 0.0 0.0 0.0 0.0 62-63 0.30000000000000004 0.0 0.0 0.0 0.0 64-65 0.525 0.0 0.0 0.0 0.0 66-67 0.675 0.0 0.0 0.0 0.0 68-69 0.875 0.0 0.0 0.0 0.0 70-71 1.15 0.0 0.0 0.0 0.0 72-73 1.625 0.0 0.0 0.0 0.0 74-75 2.0125 0.0 0.0 0.0 0.0 76-77 2.75 0.0 0.0 0.0 0.0 78-79 3.2874999999999996 0.0 0.0 0.0 0.0 80-81 3.8 0.0 0.0 0.0 0.0 82-83 4.4 0.0 0.0 0.0 0.0 84-85 5.175 0.0 0.0 0.0 0.0 86-87 6.074999999999999 0.0 0.0 0.0 0.0 88-89 7.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 624232 spots for ERR1864469.sra Written 624232 spots for ERR1864469.sra Read 624232 spots for ERR1864469.sra Written 624232 spots for ERR1864469.sra Read 624232 spots for ERR1864469.sra Written 624232 spots for ERR1864469.sra Read 624232 spots for ERR1864469.sra Written 624232 spots for ERR1864469.sra Read 624232 spots for ERR1864469.sra Written 624232 spots for ERR1864469.sra Read 624232 spots for ERR1864469.sra Written 624232 spots for ERR1864469.sra Read 624232 spots for ERR1864469.sra Written 624232 spots for ERR1864469.sra Read 624232 spots for ERR1864469.sra Written 624232 spots for ERR1864469.sra Read 624232 spots for ERR1864469.sra Written 624232 spots for ERR1864469.sra Read 624232 spots for ERR1864469.sra Written 624232 spots for ERR1864469.sra Read 624232 spots for ERR1864469.sra Written 624232 spots for ERR1864469.sra Read 624232 spots for ERR1864469.sra Written 624232 spots for ERR1864469.sra Read 624232 spots for ERR1864469.sra Written 624232 spots for ERR1864469.sra Read 624232 spots for ERR1864469.sra Written 624232 spots for ERR1864469.sra Read 624232 spots for ERR1864469.sra Written 624232 spots for ERR1864469.sra Read 624232 spots for ERR1864469.sra Written 624232 spots for ERR1864469.sra Read 624232 spots for ERR1864469.sra Written 624232 spots for ERR1864469.sra Read 624232 spots for ERR1864469.sra Written 624232 spots for ERR1864469.sra Read 624232 spots for ERR1864469.sra Written 624232 spots for ERR1864469.sra Read 624241 spots for ERR1864469.sra Written 624241 spots for ERR1864469.sra SRR ids: ['ERR1864469.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__hgord3u ERR1864469.sra spots: 12484649 blocks: [[1, 624232], [624233, 1248464], [1248465, 1872696], [1872697, 2496928], [2496929, 3121160], [3121161, 3745392], [3745393, 4369624], [4369625, 4993856], [4993857, 5618088], [5618089, 6242320], [6242321, 6866552], [6866553, 7490784], [7490785, 8115016], [8115017, 8739248], [8739249, 9363480], [9363481, 9987712], [9987713, 10611944], [10611945, 11236176], [11236177, 11860408], [11860409, 12484649]] ERR1864469 file size 2989733 ERR1864469 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864469 ERR1864469_1.fastq ERR1864469_2.fastq Input file: ERR1864469_1.fastq Paired file: ERR1864469_2.fastq trimmed: ERR1864469-trimmed-pair1.fastq, ERR1864469-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 12:43:21 2025 >> started Thu Feb 13 12:43:33 2025 >> done (11.960s) 12484649 read pairs processed; of these: 118986 ( 0.95%) short read pairs filtered out after trimming by size control 116757 ( 0.94%) empty read pairs filtered out after trimming by size control 12248906 (98.11%) read pairs available; of these: 3737617 (30.51%) trimmed read pairs available after processing 8511289 (69.49%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 76 0.00% 19 111 0.00% 20 193 0.00% 21 257 0.00% 22 332 0.00% 23 371 0.00% 24 487 0.00% 25 555 0.00% 26 620 0.01% 27 727 0.01% 28 899 0.01% 29 974 0.01% 30 1179 0.01% 31 1371 0.01% 32 1528 0.01% 33 1802 0.01% 34 1953 0.02% 35 2052 0.02% 36 2277 0.02% 37 2599 0.02% 38 2829 0.02% 39 2995 0.02% 40 3376 0.03% 41 3529 0.03% 42 3903 0.03% 43 4267 0.03% 44 4394 0.04% 45 4837 0.04% 46 5270 0.04% 47 5565 0.05% 48 5986 0.05% 49 6388 0.05% 50 6863 0.06% 51 7547 0.06% 52 8211 0.07% 53 8745 0.07% 54 9254 0.08% 55 10113 0.08% 56 10901 0.09% 57 11705 0.10% 58 12859 0.10% 59 15995 0.13% 60 18565 0.15% 61 20046 0.16% 62 21079 0.17% 63 22134 0.18% 64 23733 0.19% 65 25504 0.21% 66 26962 0.22% 67 28602 0.23% 68 30446 0.25% 69 32243 0.26% 70 35105 0.29% 71 37054 0.30% 72 39851 0.33% 73 42937 0.35% 74 45460 0.37% 75 47608 0.39% 76 49976 0.41% 77 53408 0.44% 78 56690 0.46% 79 60476 0.49% 80 64496 0.53% 81 68014 0.56% 82 72508 0.59% 83 77177 0.63% 84 81625 0.67% 85 86273 0.70% 86 89990 0.73% 87 94912 0.77% 88 97872 0.80% 89 102233 0.83% 90 108237 0.88% 91 114093 0.93% 92 120604 0.98% 93 128350 1.05% 94 137307 1.12% 95 149250 1.22% 96 165451 1.35% 97 189609 1.55% 98 226077 1.85% 99 275019 2.25% 100 394746 3.22% 101 8511289 69.49% 12248906 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=3.41 fanout-score-rank=27 prefix-density=0.15 prefix-fanout=2.6 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.06 sequence-density-rank=20 fanout-score=303.80 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=27.7 sequence=TTCTTCTTCTTC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=4.04 fanout-score-rank=22 prefix-density=0.12 prefix-fanout=3.1 sequence=GATGCTGACAAG criterion=fanout-score sequence-density=0.06 sequence-density-rank=14 fanout-score=289.26 fanout-score-rank=1 prefix-density=0.70 prefix-fanout=26.2 sequence=AAGAAGAAGAAA ERR1864469 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 12:44:11 Started mapping on | Feb 13 12:44:11 Finished on | Feb 13 12:44:39 Mapping speed, Million of reads per hour | 1574.86 Number of input reads | 12248906 Average input read length | 193 UNIQUE READS: Uniquely mapped reads number | 11895220 Uniquely mapped reads % | 97.11% Average mapped length | 193.21 Number of splices: Total | 6936278 Number of splices: Annotated (sjdb) | 6809451 Number of splices: GT/AG | 6834726 Number of splices: GC/AG | 86865 Number of splices: AT/AC | 5472 Number of splices: Non-canonical | 9215 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 2.20 Insertion rate per base | 0.01% Insertion average length | 1.83 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 233909 % of reads mapped to multiple loci | 1.91% Number of reads mapped to too many loci | 57711 % of reads mapped to too many loci | 0.47% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.47% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 133072 133072 133072 N_multimapping 233909 233909 233909 N_noFeature 409741 11753920 478130 N_ambiguous 117304 496 44100 UnstrandedReadsAssigned:11368175 PositiveStrandReadsAssigned:140804 NegativeStrandReadsAssigned:11372990 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=97 echo kmer=93 ERR1864469 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864469-trimmed-pair1.fastq ERR1864469-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,248,906 reads, 11,505,738 reads pseudoaligned [quant] estimated average fragment length: 142.745 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,071 rounds 52401 ERR1864469.ke.tsv 34699 ERR1864469.se.tsv 87100 total ==> ERR1864469.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1876.25 333 21.1624 Potri.005G024800.1.v4.1 1035 893.255 74 9.87801 Potri.004G059700.1.v4.1 961 819.255 0 0 Potri.007G009000.2.v4.1 1416 1274.25 0 0 Potri.003G141000.2.v4.1 2943 2801.25 432.378 18.4045 Potri.016G087400.1.v4.1 270 134.117 763 678.352 Potri.015G069301.1.v4.1 564 422.314 0 0 Potri.010G195200.1.v4.1 1773 1631.25 32 2.33906 Potri.012G127500.1.v4.1 977 835.255 103 14.7039 ==> ERR1864469.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 825 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 282 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 23 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 ERR1864469 completed mapping pipeline successfully