Starting /dee2/code/volunteer_pipeline.sh ERR1864470 current disk space = 3091244830720 free memory = 1449800232 ERR1864470 SRAfilesize 019bf689edd8d1bfbb11ca44b9fb65a1 ERR1864470.sra ERR1864470.sra file validated ERR1864470 is paired end ERR1864470 is conventional basespace ERR1864470 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864470_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.7405 34.0 31.0 34.0 27.0 34.0 2 31.6265 34.0 31.0 34.0 28.0 34.0 3 32.2945 34.0 31.0 34.0 30.0 34.0 4 35.664 37.0 35.0 37.0 35.0 37.0 5 35.6115 37.0 35.0 37.0 35.0 37.0 6 35.56475 37.0 36.0 37.0 35.0 37.0 7 35.606 37.0 36.0 37.0 35.0 37.0 8 35.54375 37.0 36.0 37.0 33.0 37.0 9 37.3755 39.0 38.0 39.0 35.0 39.0 10-11 37.294375 39.0 38.0 39.0 35.0 39.0 12-13 37.227875 39.0 38.0 39.0 34.5 39.0 14-15 38.63375 41.0 39.0 41.0 34.5 41.0 16-17 38.497125 41.0 38.5 41.0 34.0 41.0 18-19 38.566 41.0 39.0 41.0 34.5 41.0 20-21 38.477125 41.0 39.0 41.0 34.0 41.0 22-23 38.338 40.5 39.0 41.0 34.0 41.0 24-25 38.35925 41.0 39.0 41.0 34.0 41.0 26-27 38.302625 40.5 38.5 41.0 34.0 41.0 28-29 38.2055 40.0 38.0 41.0 34.0 41.0 30-31 38.0935 40.0 38.0 41.0 34.0 41.0 32-33 37.981875 40.0 38.0 41.0 33.0 41.0 34-35 37.8925 40.0 38.0 41.0 33.0 41.0 36-37 37.759 40.0 38.0 41.0 33.0 41.0 38-39 37.677875 40.0 38.0 41.0 32.5 41.0 40-41 37.510000000000005 40.0 38.0 41.0 32.0 41.0 42-43 37.31525 40.0 38.0 41.0 31.0 41.0 44-45 37.334125 40.0 37.5 41.0 32.0 41.0 46-47 37.439625 40.0 38.0 41.0 32.0 41.0 48-49 37.457750000000004 40.0 38.0 41.0 32.0 41.0 50-51 37.297875000000005 40.0 37.0 41.0 31.5 41.0 52-53 37.088375 40.0 37.0 41.0 31.0 41.0 54-55 36.852625 40.0 37.0 41.0 31.0 41.0 56-57 36.702 40.0 36.5 41.0 30.5 41.0 58-59 36.62525 40.0 36.0 41.0 30.5 41.0 60-61 36.370125 39.0 36.0 41.0 30.0 41.0 62-63 36.075500000000005 39.0 35.0 41.0 29.5 41.0 64-65 35.661125 38.0 35.0 40.0 29.0 41.0 66-67 35.348875 38.0 35.0 40.0 28.5 41.0 68-69 35.04475 37.0 34.5 40.0 28.5 41.0 70-71 34.501625000000004 37.0 34.0 39.0 28.0 41.0 72-73 34.113875 36.0 34.0 39.0 27.0 40.5 74-75 33.563 36.0 33.5 38.5 26.0 40.0 76-77 32.5195 35.0 32.0 37.0 26.0 39.0 78-79 32.766375 35.0 33.0 37.0 26.0 39.0 80-81 32.601124999999996 35.0 33.0 36.5 26.0 38.5 82-83 32.2305 35.0 33.0 36.0 26.0 37.0 84-85 31.841875 35.0 33.0 35.5 25.5 37.0 86-87 31.205 35.0 32.0 35.0 23.0 36.5 88-89 31.095625 34.0 32.0 35.0 22.5 36.0 90-91 30.730125 34.0 31.0 35.0 20.0 36.0 92-93 30.56425 34.0 31.5 35.0 20.0 35.0 94-95 30.384375 34.0 31.0 35.0 19.5 35.0 96-97 30.175874999999998 34.0 31.0 35.0 17.0 35.0 98-99 29.802125 34.0 31.0 35.0 3.5 35.0 100-101 28.80025 33.5 30.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 33.0 3 10.0 4 10.0 5 9.0 6 4.0 7 3.0 8 3.0 9 6.0 10 6.0 11 9.0 12 3.0 13 6.0 14 10.0 15 13.0 16 8.0 17 7.0 18 14.0 19 13.0 20 16.0 21 16.0 22 14.0 23 20.0 24 14.0 25 15.0 26 27.0 27 18.0 28 45.0 29 41.0 30 58.0 31 72.0 32 84.0 33 128.0 34 174.0 35 254.0 36 462.0 37 902.0 38 1272.0 39 201.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.625486633791848 9.239553594601608 8.4609395276408 51.67402024396574 2 20.849999999999998 13.925 39.4 25.825 3 20.325 18.0 25.775 35.9 4 23.95 27.05 21.349999999999998 27.650000000000002 5 22.525000000000002 32.375 25.15 19.950000000000003 6 16.725 35.175 27.400000000000002 20.7 7 15.1 24.9 42.825 17.175 8 17.724999999999998 24.65 34.65 22.975 9 16.55 23.625 37.4 22.425 10-11 19.31491436429554 33.21665208151019 26.578322290286287 20.890111263907986 12-13 21.1625 27.05 28.012500000000003 23.775 14-15 20.177522190273784 28.56607075884486 28.491061382672832 22.765345668208525 16-17 19.382268350631488 29.09841190446417 28.23558834562961 23.28373139927473 18-19 18.952369046130766 29.22865358169771 27.790973871733964 24.028003500437556 20-21 19.72993248312078 28.51962990747687 28.59464866216554 23.15578894723681 22-23 19.85992996498249 28.61430715357679 28.214107053526767 23.311655827913956 24-25 19.432287107665374 29.310991621858197 28.223083656371138 23.03363761410529 26-27 19.45729648618232 29.035888458171815 28.073027385269476 23.43378767037639 28-29 19.694885582093285 29.173440040015002 27.960485181943227 23.17118919594848 30-31 19.7323996498687 28.848318119294735 28.2856071026635 23.133675128173063 32-33 20.482681005377014 28.523196198574464 28.185569588595722 22.808553207452796 34-35 20.19002375296912 29.2911613951744 27.61595199399925 22.90286285785723 36-37 19.767441860465116 28.507126781695426 28.769692423105774 22.95573893473368 38-39 19.757409028385645 28.473177441540575 28.360635238214332 23.40877829185945 40-41 20.652581572696587 28.728591073884235 28.166020752594072 22.452806600825102 42-43 19.572286143071533 27.726363181590795 28.526763381690845 24.174587293646823 44-45 19.73733583489681 28.705440900562852 28.15509693558474 23.402126328955596 46-47 20.152614460845633 28.946710032524393 28.383787840880657 22.516887665749312 48-49 19.929982495623904 28.294573643410853 27.59439859964991 24.18104526131533 50-51 19.53232462173315 29.14843066149806 28.348130548955858 22.97111416781293 52-53 20.631737277513164 28.152419152669843 28.45324642767611 22.762597142140887 54-55 20.545204451669377 28.2856071026635 27.435288233087405 23.733900212579716 56-57 19.925 28.012500000000003 29.1875 22.875 58-59 20.165020627578446 28.51606450806351 28.478559819977495 22.840355044380548 60-61 19.78997374671834 28.92861607700963 28.116014501812725 23.165395674459308 62-63 20.5125 28.287499999999998 27.900000000000002 23.3 64-65 19.9125 29.037499999999998 28.3375 22.7125 66-67 20.724999999999998 28.075 27.250000000000004 23.95 68-69 20.3625 29.3875 27.6875 22.5625 70-71 20.8 28.9125 27.737499999999997 22.55 72-73 19.8125 28.3375 27.737499999999997 24.1125 74-75 20.674999999999997 28.599999999999998 27.8875 22.8375 76-77 20.349999999999998 28.9375 27.175 23.5375 78-79 20.180157637933192 28.812711122231953 27.98698861503816 23.020142624796698 80-81 20.5375 28.512500000000003 28.812500000000004 22.1375 82-83 20.8875 29.15 26.437500000000004 23.525 84-85 20.5625 29.4 27.025 23.0125 86-87 21.05 28.6125 26.775 23.5625 88-89 20.7125 28.975 27.2625 23.05 90-91 21.375 29.1125 26.6 22.912499999999998 92-93 20.65 28.6875 27.474999999999998 23.1875 94-95 22.2625 28.7 26.1 22.9375 96-97 21.15 28.762500000000003 26.275 23.8125 98-99 22.2125 28.9375 26.275 22.575 100-101 22.1 29.1625 25.35 23.3875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 0.5 25 0.5 26 2.5 27 6.5 28 7.0 29 10.5 30 25.0 31 33.5 32 39.5 33 47.5 34 60.0 35 79.5 36 100.5 37 118.0 38 135.5 39 170.5 40 206.5 41 221.0 42 242.5 43 276.0 44 277.0 45 272.0 46 261.0 47 247.5 48 242.0 49 202.0 50 150.0 51 111.0 52 99.0 53 89.0 54 71.5 55 52.5 56 30.5 57 23.5 58 21.5 59 20.0 60 15.5 61 10.5 62 7.0 63 4.0 64 1.5 65 1.0 66 0.5 67 0.0 68 0.0 69 0.0 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0125 12-13 0.0 14-15 0.0125 16-17 0.0375 18-19 0.0125 20-21 0.025 22-23 0.05 24-25 0.0375 26-27 0.0375 28-29 0.0375 30-31 0.0375 32-33 0.0375 34-35 0.0125 36-37 0.025 38-39 0.0375 40-41 0.0125 42-43 0.05 44-45 0.0625 46-47 0.075 48-49 0.025 50-51 0.0375 52-53 0.27499999999999997 54-55 0.0375 56-57 0.0 58-59 0.0125 60-61 0.0125 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.08750000000000001 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.0875 0.0 0.0 0.0 0.0 56-57 0.1375 0.0 0.0 0.0 0.0 58-59 0.1875 0.0 0.0 0.0 0.0 60-61 0.3375 0.0 0.0 0.0 0.0 62-63 0.42500000000000004 0.0 0.0 0.0 0.0 64-65 0.5125 0.0 0.0 0.0 0.0 66-67 0.6000000000000001 0.0 0.0 0.0 0.0 68-69 0.7875 0.0 0.0 0.0 0.0 70-71 1.025 0.0 0.0 0.0 0.0 72-73 1.25 0.0 0.0 0.0 0.0 74-75 1.4875 0.0 0.0 0.0 0.0 76-77 1.775 0.0 0.0 0.0 0.0 78-79 2.2 0.0 0.0 0.0 0.0 80-81 2.675 0.0 0.0 0.0 0.0 82-83 3.0875 0.0 0.0 0.0 0.0 84-85 3.7375 0.0 0.0 0.0 0.0 86-87 4.300000000000001 0.0 0.0 0.0 0.0 88-89 5.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864470 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864470_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.22225 34.0 31.0 34.0 31.0 34.0 2 32.27275 34.0 31.0 34.0 30.0 34.0 3 32.33775 34.0 31.0 34.0 30.0 34.0 4 35.63925 37.0 37.0 37.0 35.0 37.0 5 35.675 37.0 37.0 37.0 35.0 37.0 6 35.648 37.0 37.0 37.0 35.0 37.0 7 35.64275 37.0 37.0 37.0 35.0 37.0 8 35.71575 37.0 36.0 37.0 35.0 37.0 9 37.31475 39.0 38.0 39.0 35.0 39.0 10-11 37.222875 39.0 38.0 39.0 34.0 39.0 12-13 37.2615 39.0 38.0 39.0 34.5 39.0 14-15 38.6005 41.0 39.0 41.0 34.5 41.0 16-17 38.460625 41.0 38.5 41.0 33.5 41.0 18-19 38.529125 41.0 38.5 41.0 33.5 41.0 20-21 38.443124999999995 41.0 38.5 41.0 34.0 41.0 22-23 38.183625 40.0 38.0 41.0 33.0 41.0 24-25 38.259625 40.0 38.0 41.0 34.0 41.0 26-27 38.0835 40.0 38.0 41.0 33.0 41.0 28-29 38.010875 40.0 38.0 41.0 33.0 41.0 30-31 37.913624999999996 40.0 38.0 41.0 33.0 41.0 32-33 37.79375 40.0 38.0 41.0 33.0 41.0 34-35 37.79375 40.0 38.0 41.0 33.0 41.0 36-37 37.57575 40.0 38.0 41.0 32.0 41.0 38-39 37.4165 40.0 37.5 41.0 31.5 41.0 40-41 37.343 40.0 38.0 41.0 31.0 41.0 42-43 37.3095 40.0 38.0 41.0 31.0 41.0 44-45 37.012 40.0 37.0 41.0 30.5 41.0 46-47 36.9025 40.0 37.0 41.0 30.5 41.0 48-49 36.6815 40.0 37.0 41.0 30.0 41.0 50-51 36.3905 39.5 36.5 40.5 30.0 41.0 52-53 36.625125 39.5 36.5 40.5 30.5 41.0 54-55 36.937625 40.0 37.0 41.0 31.0 41.0 56-57 36.777125 40.0 37.0 41.0 30.5 41.0 58-59 36.546875 39.5 36.0 41.0 30.0 41.0 60-61 36.305625 39.0 36.0 41.0 29.5 41.0 62-63 36.031499999999994 39.0 35.5 41.0 29.0 41.0 64-65 35.661249999999995 38.5 35.0 40.5 28.5 41.0 66-67 35.297125 38.0 35.0 40.0 28.0 41.0 68-69 34.811125000000004 37.0 34.0 39.5 28.0 41.0 70-71 34.297250000000005 37.0 34.0 39.0 26.0 41.0 72-73 33.877125 36.0 34.0 39.0 26.0 40.5 74-75 33.460499999999996 36.0 34.0 38.0 26.0 39.5 76-77 32.780375 35.0 33.0 37.0 25.0 39.0 78-79 32.41975 35.0 32.5 37.0 25.5 39.0 80-81 32.068625 35.0 32.5 36.0 25.0 37.0 82-83 31.785875 35.0 32.5 36.0 24.0 37.0 84-85 31.34025 35.0 32.0 35.0 23.0 37.0 86-87 30.817625 34.5 31.0 35.0 19.5 36.0 88-89 30.438499999999998 34.0 31.0 35.0 18.0 36.0 90-91 30.410249999999998 34.0 31.0 35.0 18.0 36.0 92-93 30.096125 34.0 31.0 35.0 11.5 35.0 94-95 29.750124999999997 34.0 31.0 35.0 2.0 35.0 96-97 29.025125 34.0 29.5 35.0 2.0 35.0 98-99 28.548000000000002 34.0 29.0 35.0 2.0 35.0 100-101 27.307875 33.0 27.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 7.0 4 6.0 5 3.0 6 4.0 7 2.0 8 7.0 9 10.0 10 13.0 11 6.0 12 11.0 13 11.0 14 16.0 15 10.0 16 17.0 17 10.0 18 11.0 19 9.0 20 12.0 21 19.0 22 16.0 23 32.0 24 20.0 25 25.0 26 33.0 27 33.0 28 54.0 29 53.0 30 68.0 31 70.0 32 110.0 33 138.0 34 158.0 35 274.0 36 410.0 37 964.0 38 1158.0 39 181.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.03951975987994 17.258629314657327 13.1815907953977 40.52026013006503 2 23.66183091545773 24.537268634317158 36.91845922961481 14.882441220610303 3 20.130032508127034 28.057014253563388 29.40735183795949 22.405601400350086 4 22.81711283462597 34.35076307230423 23.217413059794847 19.614711033274958 5 23.736868434217108 36.36818409204602 23.1615807903952 16.73336668334167 6 19.950000000000003 38.4 24.05 17.599999999999998 7 19.75 20.549999999999997 39.300000000000004 20.4 8 21.15 24.575 30.4 23.875 9 21.224999999999998 23.5 33.1 22.175 10-11 23.025000000000002 32.05 24.4375 20.4875 12-13 24.152171192591666 25.62883243649105 26.705043173570264 23.513953197347014 14-15 22.593984962406015 28.082706766917294 28.345864661654137 20.977443609022554 16-17 23.923923923923923 28.703703703703702 27.38988988988989 19.98248248248248 18-19 24.056014003500874 28.232058014503625 27.694423605901473 20.017504376094024 20-21 23.002875359419928 28.84110513814227 28.20352544068008 19.95249406175772 22-23 22.775000000000002 29.299999999999997 27.55 20.375 24-25 22.037499999999998 28.9 28.3625 20.7 26-27 22.75 28.625 28.212500000000002 20.4125 28-29 23.1 28.237499999999997 27.950000000000003 20.7125 30-31 23.674999999999997 27.787499999999998 27.800000000000004 20.7375 32-33 22.4875 28.787499999999998 27.3875 21.337500000000002 34-35 23.5125 28.549999999999997 27.4125 20.525 36-37 22.650000000000002 27.762500000000003 29.349999999999998 20.2375 38-39 23.474999999999998 28.199999999999996 28.3875 19.9375 40-41 22.99037379672459 28.178522315289413 28.27853481685211 20.55256907113389 42-43 23.5 27.537499999999998 28.3625 20.599999999999998 44-45 23.6125 28.575 27.925 19.8875 46-47 23.200000000000003 27.987499999999997 27.987499999999997 20.825 48-49 23.1125 28.1 28.0625 20.724999999999998 50-51 23.125 27.625 28.65 20.599999999999998 52-53 23.6375 28.0875 28.237499999999997 20.0375 54-55 23.568392098024507 28.369592398099524 28.019504876219052 20.042510627656913 56-57 23.449224612306153 28.251625812906454 27.301150575287643 20.99799899949975 58-59 23.24040505063133 28.091011376422053 28.153519189898734 20.515064383047882 60-61 22.425 28.325 29.612500000000004 19.6375 62-63 23.549999999999997 28.625 28.425 19.400000000000002 64-65 23.599999999999998 28.262500000000003 28.050000000000004 20.0875 66-67 22.8375 27.6 28.012500000000003 21.55 68-69 23.549999999999997 28.3625 27.750000000000004 20.3375 70-71 23.8625 28.0625 27.575 20.5 72-73 23.599999999999998 28.1 28.1125 20.1875 74-75 23.2875 27.3625 29.1625 20.1875 76-77 24.0125 28.5625 27.6125 19.8125 78-79 23.400000000000002 27.6375 28.7 20.2625 80-81 23.4625 29.175 27.5875 19.775000000000002 82-83 23.849999999999998 27.400000000000002 28.599999999999998 20.150000000000002 84-85 24.175 28.6625 27.2625 19.900000000000002 86-87 23.3 30.2375 27.5875 18.875 88-89 24.4375 28.425 27.05 20.0875 90-91 24.4 28.712500000000002 27.750000000000004 19.1375 92-93 23.875 28.0875 28.199999999999996 19.8375 94-95 25.924999999999997 28.225 26.737499999999997 19.112499999999997 96-97 24.725 28.5875 26.900000000000002 19.787499999999998 98-99 25.687500000000004 28.0875 26.787499999999998 19.4375 100-101 25.362499999999997 28.6375 26.700000000000003 19.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 1.5 23 1.0 24 2.0 25 2.5 26 1.5 27 3.0 28 7.0 29 10.5 30 18.5 31 23.5 32 31.5 33 49.0 34 60.0 35 65.0 36 83.5 37 109.5 38 135.5 39 170.0 40 205.5 41 226.5 42 253.0 43 286.5 44 289.5 45 290.0 46 287.0 47 260.0 48 227.0 49 191.0 50 149.0 51 114.5 52 102.5 53 86.5 54 61.0 55 51.0 56 39.0 57 20.5 58 17.0 59 15.0 60 11.0 61 9.5 62 6.0 63 4.5 64 4.5 65 4.0 66 3.5 67 3.0 68 1.0 69 0.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.05 3 0.025 4 0.075 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.11249999999999999 14-15 0.25 16-17 0.1 18-19 0.025 20-21 0.0125 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0125 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.025 56-57 0.05 58-59 0.0125 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.1125 0.0 0.0 0.0 0.0 56-57 0.1625 0.0 0.0 0.0 0.0 58-59 0.21250000000000002 0.0 0.0 0.0 0.0 60-61 0.3625 0.0 0.0 0.0 0.0 62-63 0.475 0.0 0.0 0.0 0.0 64-65 0.5625 0.0 0.0 0.0 0.0 66-67 0.6499999999999999 0.0 0.0 0.0 0.0 68-69 0.8500000000000001 0.0 0.0 0.0 0.0 70-71 1.1 0.0 0.0 0.0 0.0 72-73 1.3375 0.0 0.0 0.0 0.0 74-75 1.5875 0.0 0.0 0.0 0.0 76-77 1.9 0.0 0.0 0.0 0.0 78-79 2.2874999999999996 0.0 0.0 0.0 0.0 80-81 2.75 0.0 0.0 0.0 0.0 82-83 3.2249999999999996 0.0 0.0 0.0 0.0 84-85 3.9749999999999996 0.0 0.0 0.0 0.0 86-87 4.5875 0.0 0.0 0.0 0.0 88-89 5.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 605623 spots for ERR1864470.sra Written 605623 spots for ERR1864470.sra Read 605623 spots for ERR1864470.sra Written 605623 spots for ERR1864470.sra Read 605623 spots for ERR1864470.sra Written 605623 spots for ERR1864470.sra Read 605627 spots for ERR1864470.sra Written 605627 spots for ERR1864470.sra Read 605623 spots for ERR1864470.sra Written 605623 spots for ERR1864470.sra Read 605623 spots for ERR1864470.sra Written 605623 spots for ERR1864470.sra Read 605623 spots for ERR1864470.sra Written 605623 spots for ERR1864470.sra Read 605623 spots for ERR1864470.sra Written 605623 spots for ERR1864470.sra Read 605623 spots for ERR1864470.sra Written 605623 spots for ERR1864470.sra Read 605623 spots for ERR1864470.sra Written 605623 spots for ERR1864470.sra Read 605623 spots for ERR1864470.sra Written 605623 spots for ERR1864470.sra Read 605623 spots for ERR1864470.sra Written 605623 spots for ERR1864470.sra Read 605623 spots for ERR1864470.sra Written 605623 spots for ERR1864470.sra Read 605623 spots for ERR1864470.sra Written 605623 spots for ERR1864470.sra Read 605623 spots for ERR1864470.sra Written 605623 spots for ERR1864470.sra Read 605623 spots for ERR1864470.sra Written 605623 spots for ERR1864470.sra Read 605623 spots for ERR1864470.sra Written 605623 spots for ERR1864470.sra Read 605623 spots for ERR1864470.sra Written 605623 spots for ERR1864470.sra Read 605623 spots for ERR1864470.sra Written 605623 spots for ERR1864470.sra Read 605623 spots for ERR1864470.sra Written 605623 spots for ERR1864470.sra SRR ids: ['ERR1864470.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1m73itot ERR1864470.sra spots: 12112464 blocks: [[1, 605623], [605624, 1211246], [1211247, 1816869], [1816870, 2422492], [2422493, 3028115], [3028116, 3633738], [3633739, 4239361], [4239362, 4844984], [4844985, 5450607], [5450608, 6056230], [6056231, 6661853], [6661854, 7267476], [7267477, 7873099], [7873100, 8478722], [8478723, 9084345], [9084346, 9689968], [9689969, 10295591], [10295592, 10901214], [10901215, 11506837], [11506838, 12112464]] ERR1864470 file size 2899958 ERR1864470 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864470 ERR1864470_1.fastq ERR1864470_2.fastq Input file: ERR1864470_1.fastq Paired file: ERR1864470_2.fastq trimmed: ERR1864470-trimmed-pair1.fastq, ERR1864470-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:10:46 2025 >> started Thu Feb 13 13:10:57 2025 >> done (10.959s) 12112464 read pairs processed; of these: 115351 ( 0.95%) short read pairs filtered out after trimming by size control 117729 ( 0.97%) empty read pairs filtered out after trimming by size control 11879384 (98.08%) read pairs available; of these: 3333445 (28.06%) trimmed read pairs available after processing 8545939 (71.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 64 0.00% 19 125 0.00% 20 193 0.00% 21 246 0.00% 22 299 0.00% 23 402 0.00% 24 475 0.00% 25 536 0.00% 26 605 0.01% 27 747 0.01% 28 777 0.01% 29 924 0.01% 30 1138 0.01% 31 1238 0.01% 32 1391 0.01% 33 1551 0.01% 34 1819 0.02% 35 1962 0.02% 36 2124 0.02% 37 2352 0.02% 38 2467 0.02% 39 2690 0.02% 40 2898 0.02% 41 3036 0.03% 42 3312 0.03% 43 3753 0.03% 44 3865 0.03% 45 4142 0.03% 46 4530 0.04% 47 4917 0.04% 48 5192 0.04% 49 5600 0.05% 50 6009 0.05% 51 6527 0.05% 52 6937 0.06% 53 7443 0.06% 54 7904 0.07% 55 8410 0.07% 56 9048 0.08% 57 9901 0.08% 58 10732 0.09% 59 13556 0.11% 60 16304 0.14% 61 17062 0.14% 62 18057 0.15% 63 19047 0.16% 64 20452 0.17% 65 21604 0.18% 66 23022 0.19% 67 24645 0.21% 68 25932 0.22% 69 27522 0.23% 70 29703 0.25% 71 31779 0.27% 72 33721 0.28% 73 36587 0.31% 74 38794 0.33% 75 40465 0.34% 76 42392 0.36% 77 45505 0.38% 78 48316 0.41% 79 51940 0.44% 80 55226 0.46% 81 58486 0.49% 82 62148 0.52% 83 65828 0.55% 84 70117 0.59% 85 74568 0.63% 86 77792 0.65% 87 82142 0.69% 88 84799 0.71% 89 88632 0.75% 90 94858 0.80% 91 100662 0.85% 92 106887 0.90% 93 114016 0.96% 94 123033 1.04% 95 134830 1.13% 96 149440 1.26% 97 174137 1.47% 98 210814 1.77% 99 258742 2.18% 100 381602 3.21% 101 8545939 71.94% 11879384 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=3.73 fanout-score-rank=27 prefix-density=0.17 prefix-fanout=2.7 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.07 sequence-density-rank=15 fanout-score=270.69 fanout-score-rank=1 prefix-density=0.70 prefix-fanout=25.9 sequence=TTCTTCTTCTTC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=50.91 fanout-score-rank=6 prefix-density=0.38 prefix-fanout=13.6 sequence=GAAGAAGAGAAG criterion=fanout-score sequence-density=0.06 sequence-density-rank=18 fanout-score=299.97 fanout-score-rank=1 prefix-density=0.75 prefix-fanout=25.7 sequence=AAGAAGAAGAAA ERR1864470 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:11:31 Started mapping on | Feb 13 13:11:31 Finished on | Feb 13 13:11:59 Mapping speed, Million of reads per hour | 1527.35 Number of input reads | 11879384 Average input read length | 194 UNIQUE READS: Uniquely mapped reads number | 11514443 Uniquely mapped reads % | 96.93% Average mapped length | 194.11 Number of splices: Total | 6780532 Number of splices: Annotated (sjdb) | 6661382 Number of splices: GT/AG | 6677664 Number of splices: GC/AG | 88597 Number of splices: AT/AC | 5474 Number of splices: Non-canonical | 8797 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 2.22 Insertion rate per base | 0.01% Insertion average length | 1.87 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 231786 % of reads mapped to multiple loci | 1.95% Number of reads mapped to too many loci | 45428 % of reads mapped to too many loci | 0.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.71% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 147431 147431 147431 N_multimapping 231786 231786 231786 N_noFeature 352922 11390785 400996 N_ambiguous 120001 453 44164 UnstrandedReadsAssigned:11041520 PositiveStrandReadsAssigned:123205 NegativeStrandReadsAssigned:11069283 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=99 echo kmer=95 ERR1864470 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864470-trimmed-pair1.fastq ERR1864470-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,879,384 reads, 11,205,154 reads pseudoaligned [quant] estimated average fragment length: 150.204 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,138 rounds 52401 ERR1864470.ke.tsv 34699 ERR1864470.se.tsv 87100 total ==> ERR1864470.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1868.8 334.468 21.0708 Potri.005G024800.1.v4.1 1035 885.796 80 10.6327 Potri.004G059700.1.v4.1 961 811.796 1 0.145025 Potri.007G009000.2.v4.1 1416 1266.8 0 0 Potri.003G141000.2.v4.1 2943 2793.8 460.559 19.4079 Potri.016G087400.1.v4.1 270 129.503 695 631.82 Potri.015G069301.1.v4.1 564 414.899 0 0 Potri.010G195200.1.v4.1 1773 1623.8 23 1.66757 Potri.012G127500.1.v4.1 977 827.796 216 30.7198 ==> ERR1864470.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 800 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 322 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 ERR1864470 completed mapping pipeline successfully