Starting /dee2/code/volunteer_pipeline.sh ERR1864471 current disk space = 3091452485632 free memory = 1426240128 ERR1864471 SRAfilesize 956fc5c01181a1a0438bf12e7f741398 ERR1864471.sra ERR1864471.sra file validated ERR1864471 is paired end ERR1864471 is conventional basespace ERR1864471 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864471_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.50875 33.0 31.0 34.0 30.0 34.0 2 31.7585 34.0 31.0 34.0 29.0 34.0 3 31.94775 34.0 31.0 34.0 30.0 34.0 4 35.41575 37.0 35.0 37.0 33.0 37.0 5 35.104 37.0 35.0 37.0 32.0 37.0 6 35.1105 37.0 35.0 37.0 32.0 37.0 7 35.122 37.0 35.0 37.0 32.0 37.0 8 35.13675 37.0 35.0 37.0 32.0 37.0 9 36.6735 39.0 37.0 39.0 32.0 39.0 10-11 36.565124999999995 39.0 37.0 39.0 32.0 39.0 12-13 36.561875 39.0 37.0 39.0 32.5 39.0 14-15 37.8295 40.0 38.0 41.0 32.5 41.0 16-17 37.50075 40.0 38.0 41.0 32.0 41.0 18-19 37.619875 40.0 38.0 41.0 32.0 41.0 20-21 37.549125000000004 40.0 38.0 41.0 32.0 41.0 22-23 37.529624999999996 40.0 38.0 41.0 31.5 41.0 24-25 37.359750000000005 40.0 38.0 41.0 31.5 41.0 26-27 37.297875000000005 40.0 38.0 41.0 31.5 41.0 28-29 36.871125 40.0 36.5 41.0 30.5 41.0 30-31 36.834 40.0 37.0 41.0 30.0 41.0 32-33 36.66225 40.0 37.0 41.0 30.0 41.0 34-35 36.5355 40.0 36.0 41.0 30.0 41.0 36-37 36.6175 40.0 37.0 41.0 30.0 41.0 38-39 36.63975 40.0 37.0 41.0 30.0 41.0 40-41 36.462875 40.0 36.5 41.0 30.0 41.0 42-43 36.17425 40.0 35.5 41.0 29.5 41.0 44-45 36.14325 39.5 36.0 41.0 29.0 41.0 46-47 35.867125 39.0 35.5 41.0 28.0 41.0 48-49 36.11425 40.0 36.0 41.0 28.0 41.0 50-51 35.8985 39.5 35.5 41.0 27.5 41.0 52-53 35.908125 39.0 35.0 41.0 28.0 41.0 54-55 35.733875 39.0 35.0 41.0 27.5 41.0 56-57 35.526250000000005 39.0 35.0 41.0 27.5 41.0 58-59 35.325625 39.0 35.0 41.0 26.5 41.0 60-61 35.12875 38.5 34.5 40.5 26.0 41.0 62-63 34.70725 38.0 34.0 40.0 26.0 41.0 64-65 34.405249999999995 38.0 34.0 40.0 25.5 41.0 66-67 34.08625 37.0 34.0 40.0 24.0 41.0 68-69 33.71525 37.0 33.0 39.0 25.0 41.0 70-71 33.1345 36.0 32.5 39.0 22.5 40.5 72-73 32.489125 35.5 32.0 38.5 20.0 40.0 74-75 32.25175 35.0 32.0 37.5 21.0 39.5 76-77 31.0435 34.0 30.5 36.0 18.0 39.0 78-79 31.418625 35.0 31.5 36.5 19.5 39.0 80-81 31.35 35.0 32.0 36.0 19.0 37.5 82-83 31.067124999999997 35.0 32.0 36.0 18.0 37.0 84-85 30.595 35.0 31.0 35.0 17.0 37.0 86-87 30.184375 34.0 31.0 35.0 9.5 36.0 88-89 29.905 34.0 30.0 35.0 7.0 36.0 90-91 29.643124999999998 34.0 30.0 35.0 3.5 35.5 92-93 29.193625 34.0 30.0 35.0 2.0 35.0 94-95 28.882125000000002 34.0 29.0 35.0 2.0 35.0 96-97 28.52225 34.0 29.0 35.0 2.0 35.0 98-99 28.0965 34.0 29.0 35.0 2.0 35.0 100-101 26.625875 33.0 26.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 47.0 3 22.0 4 9.0 5 8.0 6 7.0 7 10.0 8 9.0 9 7.0 10 12.0 11 7.0 12 8.0 13 17.0 14 8.0 15 10.0 16 16.0 17 21.0 18 11.0 19 15.0 20 26.0 21 11.0 22 29.0 23 18.0 24 32.0 25 32.0 26 37.0 27 49.0 28 62.0 29 49.0 30 78.0 31 96.0 32 125.0 33 152.0 34 213.0 35 274.0 36 454.0 37 822.0 38 1026.0 39 171.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.1180625630676 6.987891019172553 8.425832492431887 46.46821392532795 2 24.825 8.725 34.65 31.8 3 23.625 12.45 22.5 41.425 4 28.625 19.825 21.025 30.525000000000002 5 28.275 24.575 24.65 22.5 6 20.974999999999998 30.475 26.174999999999997 22.375 7 15.25 23.9 43.025000000000006 17.825 8 18.275 24.775 33.6 23.35 9 18.075 23.45 38.3 20.175 10-11 19.5875 32.3625 27.9125 20.1375 12-13 20.9375 27.3375 30.4375 21.2875 14-15 19.875 27.6 30.225 22.3 16-17 20.962500000000002 27.775 28.725 22.537499999999998 18-19 21.912499999999998 27.437499999999996 28.549999999999997 22.1 20-21 20.4375 27.224999999999998 28.549999999999997 23.7875 22-23 20.974999999999998 27.8375 28.849999999999998 22.3375 24-25 20.674999999999997 28.375 27.9125 23.0375 26-27 20.4125 28.075 28.199999999999996 23.3125 28-29 21.1375 28.4 27.0125 23.45 30-31 20.974999999999998 27.500000000000004 28.275 23.25 32-33 20.025000000000002 28.000000000000004 28.287499999999998 23.6875 34-35 21.224999999999998 27.5875 28.762500000000003 22.425 36-37 20.8125 27.6125 28.1125 23.4625 38-39 20.6875 28.512500000000003 28.1125 22.6875 40-41 20.925 26.974999999999998 28.7 23.400000000000002 42-43 20.424999999999997 27.3875 28.599999999999998 23.5875 44-45 20.3875 27.775 28.349999999999998 23.4875 46-47 20.7375 28.475 27.8125 22.975 48-49 19.9625 27.3625 29.425 23.25 50-51 20.825 27.0875 29.375 22.7125 52-53 20.325 28.1875 28.762500000000003 22.725 54-55 21.025 27.6375 28.499999999999996 22.8375 56-57 19.42742842855357 28.291036379547442 28.703587948493563 23.577947243405426 58-59 19.8 27.9375 28.675 23.5875 60-61 20.8125 28.050000000000004 27.425 23.7125 62-63 20.724999999999998 28.0625 28.1375 23.075000000000003 64-65 20.7 27.950000000000003 27.462500000000002 23.8875 66-67 20.342585646411603 27.169292323080768 28.207051762940733 24.281070267566893 68-69 20.5875 27.675 28.8625 22.875 70-71 21.12764095511939 27.903487935992 28.141017627203404 22.82785348168521 72-73 20.3375 27.925 28.3125 23.425 74-75 20.775 27.0875 28.199999999999996 23.9375 76-77 21.25 28.175 27.800000000000004 22.775000000000002 78-79 21.005251312828207 28.294573643410853 27.819454863715933 22.88072018004501 80-81 20.8625 28.287499999999998 28.249999999999996 22.6 82-83 21.467866966741685 27.656914228557138 27.631907976994246 23.243310827706924 84-85 21.8875 27.437499999999996 27.9125 22.7625 86-87 21.6625 27.437499999999996 28.125 22.775000000000002 88-89 22.3875 27.287499999999998 28.1625 22.162499999999998 90-91 21.66791697924481 27.369342335583895 28.069517379344838 22.893223305826456 92-93 21.80545136284071 27.46936734183546 28.207051762940733 22.518129532383096 94-95 20.825 28.425 27.9125 22.8375 96-97 21.277659707463435 27.565945743217902 27.753469183647955 23.40292536567071 98-99 21.5 28.237499999999997 27.5625 22.7 100-101 21.45 28.65 27.6375 22.2625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 1.0 22 0.5 23 1.0 24 2.0 25 2.0 26 2.5 27 10.0 28 14.5 29 14.5 30 17.5 31 21.0 32 26.0 33 37.5 34 50.5 35 59.5 36 75.5 37 98.5 38 124.5 39 157.5 40 186.5 41 216.5 42 246.0 43 270.0 44 257.5 45 245.0 46 253.0 47 242.0 48 247.0 49 228.0 50 175.0 51 134.5 52 110.0 53 93.0 54 84.0 55 68.0 56 46.0 57 37.5 58 29.0 59 22.5 60 21.0 61 15.0 62 8.0 63 10.0 64 9.5 65 7.0 66 8.5 67 4.0 68 1.0 69 1.5 70 1.0 71 1.0 72 0.5 73 0.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8999999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0125 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.025 68-69 0.0 70-71 0.0125 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.025 80-81 0.0 82-83 0.025 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.025 92-93 0.025 94-95 0.0 96-97 0.0125 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47222920331743 98.95 2 0.5277707966825836 1.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.32499999999999996 0.0 0.0 0.0 0.0 80-81 0.4375 0.0 0.0 0.0 0.0 82-83 0.5 0.0 0.0 0.0 0.0 84-85 0.5625 0.0 0.0 0.0 0.0 86-87 0.7375 0.0 0.0 0.0 0.0 88-89 0.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864471 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864471_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.55425 33.0 31.0 34.0 30.0 34.0 2 31.6915 34.0 31.0 34.0 30.0 34.0 3 31.81125 34.0 31.0 34.0 30.0 34.0 4 35.2965 37.0 35.0 37.0 33.0 37.0 5 35.11075 37.0 35.0 37.0 33.0 37.0 6 35.0615 37.0 35.0 37.0 32.0 37.0 7 35.12 37.0 35.0 37.0 32.0 37.0 8 35.18425 37.0 35.0 37.0 33.0 37.0 9 36.75525 39.0 37.0 39.0 33.0 39.0 10-11 36.586 39.0 37.0 39.0 32.0 39.0 12-13 36.432 39.0 37.0 39.0 32.5 39.0 14-15 37.69375 40.0 38.0 41.0 32.0 41.0 16-17 37.718500000000006 40.0 38.0 41.0 32.0 41.0 18-19 37.68175 40.0 38.0 41.0 32.0 41.0 20-21 37.582625 40.0 38.0 41.0 32.0 41.0 22-23 37.514875 40.0 38.0 41.0 32.0 41.0 24-25 37.483625 40.0 38.0 41.0 32.0 41.0 26-27 37.26625 40.0 37.5 41.0 31.0 41.0 28-29 37.060625 40.0 37.0 41.0 30.0 41.0 30-31 37.13225 40.0 37.0 41.0 31.0 41.0 32-33 37.029375 40.0 37.0 41.0 30.5 41.0 34-35 36.85075 40.0 37.0 41.0 30.0 41.0 36-37 36.325375 40.0 36.0 41.0 29.0 41.0 38-39 35.964749999999995 39.0 35.5 41.0 27.0 41.0 40-41 36.05875 39.0 36.0 41.0 28.5 41.0 42-43 35.944625 39.0 36.0 40.5 28.0 41.0 44-45 35.671875 39.0 35.0 40.0 27.0 41.0 46-47 35.738375000000005 39.0 35.0 41.0 27.0 41.0 48-49 35.349374999999995 38.5 34.5 40.5 25.5 41.0 50-51 34.84375 38.0 34.0 39.5 25.5 40.5 52-53 34.81 38.0 34.0 40.0 26.0 40.5 54-55 35.814375 39.0 35.0 40.5 28.0 41.0 56-57 35.771 39.0 35.0 41.0 28.0 41.0 58-59 35.260125 39.0 35.0 41.0 26.0 41.0 60-61 35.276250000000005 39.0 35.0 41.0 26.0 41.0 62-63 35.056625 38.5 35.0 40.5 26.0 41.0 64-65 34.5815 37.5 34.0 40.0 25.5 41.0 66-67 34.201499999999996 37.0 34.0 40.0 24.5 41.0 68-69 33.888125 37.0 34.0 39.0 25.5 41.0 70-71 33.498374999999996 36.0 34.0 39.0 24.0 41.0 72-73 32.914500000000004 35.5 32.5 38.5 23.0 40.0 74-75 32.36575 35.0 32.0 37.5 22.0 39.0 76-77 31.74675 35.0 31.5 37.0 20.0 39.0 78-79 31.346625 35.0 31.5 36.5 18.5 38.0 80-81 30.962375 35.0 31.0 36.0 18.0 37.0 82-83 30.788 35.0 31.0 35.5 18.0 37.0 84-85 30.444875 35.0 31.0 35.0 15.5 36.5 86-87 30.196875 34.0 31.0 35.0 10.0 36.0 88-89 29.958375 34.0 31.0 35.0 7.0 36.0 90-91 29.590875 34.0 30.5 35.0 2.0 35.0 92-93 28.749 34.0 29.0 35.0 2.0 35.0 94-95 28.488374999999998 34.0 29.0 35.0 2.0 35.0 96-97 28.4155 34.0 29.0 35.0 2.0 35.0 98-99 28.1585 34.0 29.0 35.0 2.0 35.0 100-101 27.075875 33.0 27.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 32.0 3 8.0 4 7.0 5 7.0 6 14.0 7 10.0 8 11.0 9 16.0 10 9.0 11 15.0 12 14.0 13 10.0 14 12.0 15 15.0 16 12.0 17 16.0 18 17.0 19 24.0 20 12.0 21 36.0 22 26.0 23 24.0 24 27.0 25 46.0 26 39.0 27 37.0 28 53.0 29 56.0 30 84.0 31 90.0 32 134.0 33 152.0 34 197.0 35 279.0 36 478.0 37 900.0 38 963.0 39 118.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.025 18.7 15.925 37.35 2 25.724999999999998 23.575 33.175 17.525 3 19.950000000000003 28.000000000000004 29.975 22.075 4 22.0 32.15 25.025 20.825 5 24.525 35.6 21.825 18.05 6 19.05 38.925 23.724999999999998 18.3 7 20.825 20.375 37.775 21.025 8 21.075 24.6 30.175 24.15 9 21.4 25.224999999999998 29.675 23.7 10-11 23.1875 31.612499999999997 24.6625 20.5375 12-13 23.724999999999998 25.837500000000002 27.1375 23.3 14-15 21.6625 28.9875 27.537499999999998 21.8125 16-17 22.75284410551319 27.55344418052256 27.903487935992 21.790223777972244 18-19 22.05 29.799999999999997 26.85 21.3 20-21 22.7625 28.925 27.3375 20.974999999999998 22-23 22.9875 28.175 27.725 21.1125 24-25 22.25 28.6875 26.924999999999997 22.1375 26-27 22.825 28.787499999999998 27.900000000000002 20.4875 28-29 23.2625 28.299999999999997 27.400000000000002 21.0375 30-31 22.6 28.199999999999996 27.975 21.224999999999998 32-33 22.2 29.799999999999997 26.900000000000002 21.099999999999998 34-35 23.225 28.025 27.35 21.4 36-37 23.9125 28.599999999999998 26.3125 21.175 38-39 22.2 28.7375 28.1 20.962500000000002 40-41 23.32791598949869 27.84098012251531 27.403425428178522 21.427678459807474 42-43 21.8125 28.375 28.375 21.4375 44-45 23.302912864108013 27.990998874859358 27.303412926615827 21.402675334416802 46-47 22.05 29.1625 26.950000000000003 21.837500000000002 48-49 22.412499999999998 28.1375 27.900000000000002 21.55 50-51 22.925 27.8625 27.8625 21.349999999999998 52-53 22.5625 29.037499999999998 27.275 21.125 54-55 22.7625 28.025 27.712500000000002 21.5 56-57 22.780695173793447 27.731932983245812 28.032008002000502 21.45536384096024 58-59 23.493373343335833 27.644411102775695 27.206801700425103 21.655413853463365 60-61 22.95 28.762500000000003 27.375 20.9125 62-63 22.86535816977122 28.353544193024128 27.303412926615827 21.477684710588825 64-65 22.680670167541887 28.157039259814955 28.182045511377847 20.980245061265315 66-67 23.193298324581146 27.019254813703427 29.057264316079017 20.730182545636406 68-69 23.35 27.8125 27.8875 20.95 70-71 22.787499999999998 28.487499999999997 27.925 20.8 72-73 21.987499999999997 27.6875 28.499999999999996 21.825 74-75 22.843210802700675 28.557139284821204 27.419354838709676 21.180295073768445 76-77 22.95573893473368 28.26956739184796 27.569392348087025 21.205301325331334 78-79 22.9375 29.325000000000003 27.9375 19.8 80-81 22.490311288911112 28.19102387798475 27.628453556694588 21.690211276409553 82-83 23.2625 27.85 27.950000000000003 20.9375 84-85 23.452931616452055 27.378422302787847 27.51593949243655 21.65270658832354 86-87 23.568392098024507 27.881970492623154 27.59439859964991 20.955238809702426 88-89 23.9 28.512500000000003 27.1125 20.474999999999998 90-91 24.3625 28.625 26.437500000000004 20.575 92-93 23.3375 30.2375 25.575 20.849999999999998 94-95 23.3875 28.6125 26.987499999999997 21.0125 96-97 23.590448806100763 29.078634829353668 27.053381672709087 20.27753469183648 98-99 24.103012876609576 28.79109888736092 26.903362920365048 20.202525315664456 100-101 23.2375 28.675 26.0 22.0875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 1.0 23 2.5 24 1.5 25 0.5 26 3.5 27 7.5 28 10.0 29 12.5 30 18.5 31 23.0 32 29.0 33 39.5 34 49.5 35 58.5 36 76.5 37 100.0 38 136.5 39 178.0 40 188.5 41 214.5 42 265.5 43 297.5 44 290.5 45 265.0 46 256.0 47 250.0 48 230.5 49 197.5 50 150.5 51 118.0 52 105.5 53 88.0 54 73.0 55 51.0 56 33.5 57 31.0 58 33.0 59 33.5 60 21.5 61 12.0 62 12.5 63 11.5 64 7.0 65 3.5 66 3.0 67 2.0 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0125 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0125 42-43 0.0 44-45 0.0125 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.025 58-59 0.025 60-61 0.0 62-63 0.0125 64-65 0.025 66-67 0.025 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.025 76-77 0.025 78-79 0.0 80-81 0.0125 82-83 0.0 84-85 0.0125 86-87 0.025 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0125 98-99 0.0125 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.4125 0.0 0.0 0.0 0.0 82-83 0.475 0.0 0.0 0.0 0.0 84-85 0.55 0.0 0.0 0.0 0.0 86-87 0.75 0.0 0.0 0.0 0.0 88-89 0.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 887005 spots for ERR1864471.sra Written 887005 spots for ERR1864471.sra Read 887005 spots for ERR1864471.sra Written 887005 spots for ERR1864471.sra Read 887005 spots for ERR1864471.sra Written 887005 spots for ERR1864471.sra Read 887005 spots for ERR1864471.sra Written 887005 spots for ERR1864471.sra Read 887005 spots for ERR1864471.sra Written 887005 spots for ERR1864471.sra Read 887005 spots for ERR1864471.sra Written 887005 spots for ERR1864471.sra Read 887005 spots for ERR1864471.sra Written 887005 spots for ERR1864471.sra Read 887005 spots for ERR1864471.sra Written 887005 spots for ERR1864471.sra Read 887005 spots for ERR1864471.sra Written 887005 spots for ERR1864471.sra Read 887005 spots for ERR1864471.sra Written 887005 spots for ERR1864471.sra Read 887005 spots for ERR1864471.sra Written 887005 spots for ERR1864471.sra Read 887005 spots for ERR1864471.sra Written 887005 spots for ERR1864471.sra Read 887005 spots for ERR1864471.sra Written 887005 spots for ERR1864471.sra Read 887005 spots for ERR1864471.sra Written 887005 spots for ERR1864471.sra Read 887005 spots for ERR1864471.sra Written 887005 spots for ERR1864471.sra Read 887005 spots for ERR1864471.sra Written 887005 spots for ERR1864471.sra Read 887024 spots for ERR1864471.sra Written 887024 spots for ERR1864471.sra Read 887005 spots for ERR1864471.sra Written 887005 spots for ERR1864471.sra Read 887005 spots for ERR1864471.sra Written 887005 spots for ERR1864471.sra Read 887005 spots for ERR1864471.sra Written 887005 spots for ERR1864471.sra SRR ids: ['ERR1864471.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qms8ynz9 ERR1864471.sra spots: 17740119 blocks: [[1, 887005], [887006, 1774010], [1774011, 2661015], [2661016, 3548020], [3548021, 4435025], [4435026, 5322030], [5322031, 6209035], [6209036, 7096040], [7096041, 7983045], [7983046, 8870050], [8870051, 9757055], [9757056, 10644060], [10644061, 11531065], [11531066, 12418070], [12418071, 13305075], [13305076, 14192080], [14192081, 15079085], [15079086, 15966090], [15966091, 16853095], [16853096, 17740119]] ERR1864471 file size 4257410 ERR1864471 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864471 ERR1864471_1.fastq ERR1864471_2.fastq Input file: ERR1864471_1.fastq Paired file: ERR1864471_2.fastq trimmed: ERR1864471-trimmed-pair1.fastq, ERR1864471-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:00:25 2025 >> started Thu Feb 13 13:00:42 2025 >> done (16.367s) 17740119 read pairs processed; of these: 276314 ( 1.56%) short read pairs filtered out after trimming by size control 324070 ( 1.83%) empty read pairs filtered out after trimming by size control 17139735 (96.62%) read pairs available; of these: 4047072 (23.61%) trimmed read pairs available after processing 13092663 (76.39%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 125 0.00% 19 343 0.00% 20 504 0.00% 21 632 0.00% 22 879 0.01% 23 1114 0.01% 24 1326 0.01% 25 1499 0.01% 26 1784 0.01% 27 2122 0.01% 28 2445 0.01% 29 2637 0.02% 30 3162 0.02% 31 3555 0.02% 32 4026 0.02% 33 4396 0.03% 34 4747 0.03% 35 5121 0.03% 36 5608 0.03% 37 6030 0.04% 38 6322 0.04% 39 6814 0.04% 40 7209 0.04% 41 7490 0.04% 42 8025 0.05% 43 8485 0.05% 44 8964 0.05% 45 9264 0.05% 46 9689 0.06% 47 10139 0.06% 48 10457 0.06% 49 10844 0.06% 50 11445 0.07% 51 12027 0.07% 52 12527 0.07% 53 13019 0.08% 54 13620 0.08% 55 14315 0.08% 56 15201 0.09% 57 15882 0.09% 58 16789 0.10% 59 20126 0.12% 60 23371 0.14% 61 23956 0.14% 62 25092 0.15% 63 26228 0.15% 64 27130 0.16% 65 27862 0.16% 66 29148 0.17% 67 30595 0.18% 68 31755 0.19% 69 32831 0.19% 70 34630 0.20% 71 35639 0.21% 72 38052 0.22% 73 39229 0.23% 74 40431 0.24% 75 41494 0.24% 76 41259 0.24% 77 43191 0.25% 78 44686 0.26% 79 47459 0.28% 80 49707 0.29% 81 51748 0.30% 82 54409 0.32% 83 57565 0.34% 84 59795 0.35% 85 63661 0.37% 86 67976 0.40% 87 72254 0.42% 88 73420 0.43% 89 77121 0.45% 90 85893 0.50% 91 94990 0.55% 92 106533 0.62% 93 119460 0.70% 94 134889 0.79% 95 155570 0.91% 96 187311 1.09% 97 234415 1.37% 98 308203 1.80% 99 413408 2.41% 100 593998 3.47% 101 13092663 76.39% 17139735 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=5.08 fanout-score-rank=14 prefix-density=0.25 prefix-fanout=3.2 sequence=TCCTTGTCCTGGATCTTGGCCTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=24 fanout-score=108.82 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=15.9 sequence=CCACCACCATGGGCTCCCCAGCCACCATAGGTGTCAATAATGATCTTGCGTCCAGTGAGACCTGCATCACCATGAGGACCACCAATAACAAAACGGCCAGATGGGTTGAGGTGAAAGATAGTTTTCTCATCAAGGTACTTCTCCGGGATAACAGGCTTGATGACATACTCCTTTAGATCAGCGGCAATTTCATCATTTGTGACAGTCTCATCATGCTGAGTAGAGATGAGAACAGTGTGGACACGAACAGGGACCATTGCACCATTGTCATTGAAGTACTC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.57 fanout-score-rank=37 prefix-density=0.17 prefix-fanout=2.2 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.07 sequence-density-rank=6 fanout-score=303.21 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=28.9 sequence=AAGAAGAAGAAA ERR1864471 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:01:14 Started mapping on | Feb 13 13:01:14 Finished on | Feb 13 13:01:53 Mapping speed, Million of reads per hour | 1582.13 Number of input reads | 17139735 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 16602451 Uniquely mapped reads % | 96.87% Average mapped length | 195.41 Number of splices: Total | 8981734 Number of splices: Annotated (sjdb) | 8822357 Number of splices: GT/AG | 8844189 Number of splices: GC/AG | 116189 Number of splices: AT/AC | 9130 Number of splices: Non-canonical | 12226 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 2.42 Insertion rate per base | 0.01% Insertion average length | 2.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 410179 % of reads mapped to multiple loci | 2.39% Number of reads mapped to too many loci | 41472 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.47% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 148970 148970 148970 N_multimapping 410179 410179 410179 N_noFeature 628183 16453799 694592 N_ambiguous 155737 696 73106 UnstrandedReadsAssigned:15818531 PositiveStrandReadsAssigned:147956 NegativeStrandReadsAssigned:15834753 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864471 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864471-trimmed-pair1.fastq ERR1864471-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,139,735 reads, 16,013,861 reads pseudoaligned [quant] estimated average fragment length: 160.932 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,087 rounds 52401 ERR1864471.ke.tsv 34699 ERR1864471.se.tsv 87100 total ==> ERR1864471.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1858.07 3199 131.025 Potri.005G024800.1.v4.1 1035 875.068 1972 171.501 Potri.004G059700.1.v4.1 961 801.078 13 1.23501 Potri.007G009000.2.v4.1 1416 1256.07 0 0 Potri.003G141000.2.v4.1 2943 2783.07 625.075 17.0927 Potri.016G087400.1.v4.1 270 115.694 704 463.086 Potri.015G069301.1.v4.1 564 404.139 0 0 Potri.010G195200.1.v4.1 1773 1613.07 81 3.8215 Potri.012G127500.1.v4.1 977 817.078 613 57.095 ==> ERR1864471.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1145 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 261 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 15 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 ERR1864471 completed mapping pipeline successfully