Starting /dee2/code/volunteer_pipeline.sh ERR1864472 current disk space = 3090776289280 free memory = 1464389712 ERR1864472 SRAfilesize 76836b0466274beb21728f3eed41f2d3 ERR1864472.sra ERR1864472.sra file validated ERR1864472 is paired end ERR1864472 is conventional basespace ERR1864472 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864472_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.47525 33.0 31.0 34.0 30.0 34.0 2 31.751 34.0 31.0 34.0 30.0 34.0 3 32.02425 34.0 31.0 34.0 30.0 34.0 4 35.42375 37.0 35.0 37.0 33.0 37.0 5 35.063 37.0 35.0 37.0 32.0 37.0 6 35.13675 37.0 35.0 37.0 32.0 37.0 7 35.15175 37.0 35.0 37.0 33.0 37.0 8 35.07225 37.0 35.0 37.0 32.0 37.0 9 36.673 39.0 37.0 39.0 33.0 39.0 10-11 36.507125 39.0 37.0 39.0 32.5 39.0 12-13 36.481624999999994 39.0 37.0 39.0 32.0 39.0 14-15 37.75475 40.0 38.0 41.0 32.5 41.0 16-17 37.496624999999995 40.0 38.0 41.0 32.0 41.0 18-19 37.510875 40.0 38.0 41.0 32.0 41.0 20-21 37.384875 40.0 38.0 41.0 31.5 41.0 22-23 37.431125 40.0 38.0 41.0 32.0 41.0 24-25 37.4255 40.0 38.0 41.0 32.0 41.0 26-27 37.279624999999996 40.0 38.0 41.0 31.0 41.0 28-29 36.845124999999996 40.0 36.5 41.0 30.5 41.0 30-31 36.8925 40.0 37.0 41.0 30.5 41.0 32-33 36.688625 40.0 37.0 41.0 30.0 41.0 34-35 36.52225 40.0 36.0 41.0 30.0 41.0 36-37 36.623999999999995 40.0 37.0 41.0 30.0 41.0 38-39 36.55975 40.0 37.0 41.0 30.0 41.0 40-41 36.351625 40.0 36.5 41.0 29.5 41.0 42-43 36.070375 39.5 36.0 41.0 28.5 41.0 44-45 36.09825 39.0 36.0 41.0 28.5 41.0 46-47 35.853125000000006 39.0 35.0 41.0 28.0 41.0 48-49 35.96 39.5 35.5 41.0 27.5 41.0 50-51 35.870875 39.0 35.0 41.0 28.0 41.0 52-53 35.85025 39.0 35.0 41.0 28.0 41.0 54-55 35.764250000000004 39.0 35.0 41.0 27.0 41.0 56-57 35.490750000000006 39.0 35.0 41.0 27.0 41.0 58-59 35.204499999999996 39.0 34.5 41.0 26.0 41.0 60-61 34.998875 38.0 34.5 40.0 26.0 41.0 62-63 34.6535 38.0 34.0 40.0 26.0 41.0 64-65 34.288250000000005 37.5 34.0 40.0 25.0 41.0 66-67 34.020125 37.0 34.0 40.0 25.0 41.0 68-69 33.563125 36.5 33.0 39.0 22.5 41.0 70-71 33.2225 36.0 33.0 39.0 23.0 40.5 72-73 32.635875 35.5 32.0 39.0 20.5 40.0 74-75 32.295 35.0 32.0 37.5 21.0 39.0 76-77 31.148625000000003 34.0 30.5 36.0 20.0 39.0 78-79 31.541874999999997 35.0 31.0 36.5 20.5 39.0 80-81 31.34075 35.0 31.0 36.0 20.0 37.5 82-83 31.002625000000002 35.0 31.0 36.0 18.5 37.0 84-85 30.695 35.0 31.0 35.0 18.0 37.0 86-87 30.18325 34.0 31.0 35.0 9.5 36.0 88-89 29.7935 34.0 30.0 35.0 4.5 36.0 90-91 29.579875 34.0 30.0 35.0 2.0 36.0 92-93 29.16425 34.0 29.5 35.0 2.0 35.0 94-95 28.942999999999998 34.0 29.0 35.0 2.0 35.0 96-97 28.648375 34.0 29.5 35.0 2.0 35.0 98-99 28.238125 34.0 29.0 35.0 2.0 35.0 100-101 26.641750000000002 33.0 26.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 48.0 3 25.0 4 10.0 5 10.0 6 8.0 7 7.0 8 12.0 9 11.0 10 9.0 11 5.0 12 8.0 13 21.0 14 12.0 15 14.0 16 10.0 17 10.0 18 16.0 19 12.0 20 17.0 21 19.0 22 16.0 23 30.0 24 23.0 25 29.0 26 32.0 27 40.0 28 47.0 29 82.0 30 73.0 31 113.0 32 114.0 33 177.0 34 212.0 35 307.0 36 436.0 37 773.0 38 1037.0 39 175.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.33838383838384 5.0 6.0858585858585865 47.57575757575758 2 23.925 7.1499999999999995 35.8 33.125 3 23.825 10.575 23.200000000000003 42.4 4 29.725 17.974999999999998 20.625 31.674999999999997 5 28.575 23.45 24.0 23.974999999999998 6 22.175 27.3 27.325 23.200000000000003 7 16.475 23.225 42.4 17.9 8 17.275 22.85 36.875 23.0 9 16.875 22.05 40.0 21.075 10-11 20.225 32.3625 28.1875 19.225 12-13 21.0625 25.525 31.225 22.1875 14-15 19.9125 27.175 30.2375 22.675 16-17 21.4375 28.1625 28.537499999999998 21.8625 18-19 21.3625 27.8125 28.5625 22.2625 20-21 20.4125 28.825 28.3125 22.45 22-23 21.425 27.250000000000004 28.825 22.5 24-25 20.2625 28.4375 29.299999999999997 22.0 26-27 20.4375 27.8625 28.975 22.725 28-29 21.0125 28.3125 28.325 22.35 30-31 20.0125 27.950000000000003 28.7375 23.3 32-33 20.6375 27.325 28.999999999999996 23.0375 34-35 21.75 27.3375 27.975 22.9375 36-37 21.1125 27.437499999999996 27.800000000000004 23.65 38-39 21.525 27.650000000000002 28.15 22.675 40-41 20.837500000000002 28.212500000000002 28.537499999999998 22.412499999999998 42-43 21.587500000000002 27.450000000000003 26.6125 24.349999999999998 44-45 20.8 29.025000000000002 27.775 22.400000000000002 46-47 21.1125 28.025 27.35 23.5125 48-49 21.087500000000002 27.5125 28.9375 22.4625 50-51 20.5875 27.462500000000002 28.549999999999997 23.400000000000002 52-53 21.0375 28.5875 27.6375 22.7375 54-55 20.9125 27.437499999999996 27.712500000000002 23.9375 56-57 20.0 28.4125 28.712500000000002 22.875 58-59 21.5 27.5625 27.725 23.2125 60-61 21.25 28.0625 27.1 23.5875 62-63 21.4875 26.7625 28.975 22.775000000000002 64-65 20.8875 27.2625 28.3375 23.5125 66-67 21.1875 28.1625 28.499999999999996 22.15 68-69 20.275000000000002 27.787499999999998 27.950000000000003 23.9875 70-71 21.087500000000002 27.462500000000002 27.8625 23.5875 72-73 21.05 27.1125 28.012500000000003 23.825 74-75 21.7 27.55 28.249999999999996 22.5 76-77 20.674999999999997 28.449999999999996 28.575 22.3 78-79 21.3875 26.8 28.537499999999998 23.275000000000002 80-81 21.099999999999998 28.1125 27.725 23.0625 82-83 20.0875 28.012500000000003 28.625 23.275000000000002 84-85 21.6625 27.800000000000004 27.200000000000003 23.3375 86-87 20.8125 28.1125 28.349999999999998 22.725 88-89 20.925 27.900000000000002 28.1125 23.0625 90-91 21.65 27.175 27.825 23.35 92-93 21.712500000000002 28.1875 27.737499999999997 22.3625 94-95 21.2625 28.7375 27.6 22.400000000000002 96-97 21.3 28.1625 27.5625 22.975 98-99 21.5 27.3125 28.275 22.912499999999998 100-101 21.45 28.3375 27.287499999999998 22.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 2.0 25 3.5 26 3.0 27 4.5 28 10.5 29 10.5 30 15.0 31 25.5 32 28.0 33 30.5 34 44.0 35 60.5 36 76.0 37 100.0 38 118.0 39 143.0 40 187.5 41 222.0 42 230.5 43 237.5 44 270.0 45 269.0 46 261.0 47 278.0 48 244.5 49 201.5 50 187.0 51 146.5 52 107.0 53 96.5 54 83.5 55 68.0 56 52.0 57 35.0 58 29.0 59 27.5 60 17.0 61 12.0 62 13.0 63 12.5 64 8.5 65 4.5 66 4.5 67 5.0 68 3.5 69 2.0 70 1.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29435483870968 98.5 2 0.655241935483871 1.3 3 0.025201612903225805 0.075 4 0.0 0.0 5 0.025201612903225805 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAGCTTGAAAGACAAGAGTGATGGTTTGGTGGGCACAACGCCACAGGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.07500000000000001 0.0 0.0 0.0 0.0 64-65 0.1125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.275 0.0 0.0 0.0 0.0 74-75 0.32499999999999996 0.0 0.0 0.0 0.0 76-77 0.3625 0.0 0.0 0.0 0.0 78-79 0.4375 0.0 0.0 0.0 0.0 80-81 0.55 0.0 0.0 0.0 0.0 82-83 0.625 0.0 0.0 0.0 0.0 84-85 0.675 0.0 0.0 0.0 0.0 86-87 0.8500000000000001 0.0 0.0 0.0 0.0 88-89 1.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864472 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864472_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.5175 33.0 31.0 34.0 28.0 34.0 2 31.6385 34.0 31.0 34.0 30.0 34.0 3 31.71775 34.0 31.0 34.0 28.0 34.0 4 35.18075 37.0 35.0 37.0 33.0 37.0 5 34.98225 37.0 35.0 37.0 32.0 37.0 6 35.05975 37.0 35.0 37.0 32.0 37.0 7 34.9695 37.0 35.0 37.0 32.0 37.0 8 35.1265 37.0 35.0 37.0 33.0 37.0 9 36.757 39.0 37.0 39.0 33.0 39.0 10-11 36.549875 39.0 37.0 39.0 32.0 39.0 12-13 36.43425 39.0 37.0 39.0 32.0 39.0 14-15 37.627875 40.0 38.0 41.0 32.0 41.0 16-17 37.734875 40.0 38.0 41.0 32.0 41.0 18-19 37.76975 40.0 38.0 41.0 32.0 41.0 20-21 37.565625 40.0 38.0 41.0 31.5 41.0 22-23 37.57325 40.0 38.0 41.0 32.0 41.0 24-25 37.576125 40.0 38.0 41.0 32.0 41.0 26-27 37.394875 40.0 38.0 41.0 31.5 41.0 28-29 37.188375 40.0 37.5 41.0 31.0 41.0 30-31 37.180625 40.0 37.0 41.0 30.5 41.0 32-33 36.955749999999995 40.0 37.0 41.0 30.0 41.0 34-35 36.781375 40.0 37.0 41.0 30.0 41.0 36-37 36.303375 39.5 36.0 41.0 29.0 41.0 38-39 35.92825 39.0 35.5 41.0 27.5 41.0 40-41 36.05825 39.0 36.0 41.0 28.5 41.0 42-43 36.007999999999996 39.0 35.5 40.5 28.0 41.0 44-45 35.65775 39.0 35.0 40.0 27.0 41.0 46-47 35.764624999999995 39.0 35.0 40.5 27.5 41.0 48-49 35.375375000000005 39.0 34.5 40.0 25.5 41.0 50-51 34.808 38.5 34.0 39.5 25.0 40.5 52-53 34.738 38.0 34.0 40.0 25.0 40.5 54-55 35.796625 39.0 35.0 40.5 27.5 41.0 56-57 35.834625 39.0 35.0 41.0 28.0 41.0 58-59 35.31075 39.0 35.0 41.0 26.0 41.0 60-61 35.2155 39.0 35.0 41.0 26.0 41.0 62-63 35.046375 38.0 34.5 40.5 26.5 41.0 64-65 34.527874999999995 37.5 34.0 40.0 24.5 41.0 66-67 34.093125 37.0 34.0 39.5 24.5 41.0 68-69 33.79975 36.5 33.5 39.0 25.0 41.0 70-71 33.351375000000004 36.0 33.0 39.0 24.0 41.0 72-73 32.685500000000005 35.5 32.5 38.5 21.5 40.0 74-75 32.235875 35.0 32.0 37.0 21.0 39.0 76-77 31.74375 35.0 31.5 37.0 20.0 39.0 78-79 31.32875 35.0 31.0 36.0 18.0 38.5 80-81 30.929000000000002 35.0 31.0 36.0 17.5 37.0 82-83 30.656875 35.0 31.0 35.5 16.5 37.0 84-85 30.42625 34.0 31.0 35.0 13.5 36.5 86-87 30.148625 34.0 31.0 35.0 7.5 36.0 88-89 29.8415 34.0 31.0 35.0 6.0 36.0 90-91 29.5365 34.0 30.5 35.0 2.0 35.5 92-93 28.7515 34.0 29.0 35.0 2.0 35.0 94-95 28.426125 34.0 29.0 35.0 2.0 35.0 96-97 28.39275 34.0 29.0 35.0 2.0 35.0 98-99 27.990625 34.0 29.0 35.0 2.0 35.0 100-101 26.898125 33.0 26.5 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 31.0 3 7.0 4 6.0 5 13.0 6 4.0 7 7.0 8 16.0 9 10.0 10 8.0 11 15.0 12 15.0 13 16.0 14 18.0 15 16.0 16 22.0 17 11.0 18 18.0 19 18.0 20 21.0 21 19.0 22 20.0 23 34.0 24 37.0 25 27.0 26 26.0 27 52.0 28 62.0 29 88.0 30 86.0 31 86.0 32 130.0 33 168.0 34 189.0 35 284.0 36 464.0 37 866.0 38 959.0 39 131.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.0 18.55 13.55 37.9 2 23.775 24.775 35.525 15.925 3 19.15 29.65 30.175 21.025 4 23.375 33.2 23.125 20.3 5 23.549999999999997 36.925000000000004 22.7 16.825000000000003 6 20.175 39.074999999999996 22.925 17.825 7 20.3 21.4 38.625 19.675 8 20.175 25.025 30.049999999999997 24.75 9 21.55 25.025 31.35 22.075 10-11 22.925 32.574999999999996 23.9375 20.5625 12-13 23.724999999999998 26.087500000000002 26.9625 23.225 14-15 21.712500000000002 28.675 27.237499999999997 22.375 16-17 22.7 29.049999999999997 26.8375 21.4125 18-19 22.900000000000002 28.787499999999998 27.0875 21.224999999999998 20-21 22.6875 28.762500000000003 27.187499999999996 21.3625 22-23 22.825 28.825 27.5875 20.7625 24-25 22.125 29.062500000000004 27.5875 21.224999999999998 26-27 22.6 29.65 26.3625 21.3875 28-29 22.975 28.225 27.85 20.95 30-31 22.05 27.6625 28.3125 21.975 32-33 22.3125 28.575 27.55 21.5625 34-35 22.925 28.037499999999998 27.55 21.4875 36-37 22.45 28.3375 27.6625 21.55 38-39 22.0625 28.787499999999998 27.737499999999997 21.4125 40-41 23.0 28.1 28.1875 20.7125 42-43 22.825 28.212500000000002 28.237499999999997 20.724999999999998 44-45 22.1375 28.925 27.625 21.3125 46-47 23.45 27.85 27.35 21.349999999999998 48-49 22.95 28.249999999999996 27.950000000000003 20.849999999999998 50-51 23.35 28.537499999999998 27.05 21.0625 52-53 23.8625 27.950000000000003 27.187499999999996 21.0 54-55 22.95 29.0875 26.85 21.1125 56-57 22.55 28.625 27.075 21.75 58-59 23.3625 27.4125 28.0625 21.1625 60-61 23.3125 27.487499999999997 27.325 21.875 62-63 23.549999999999997 27.85 28.1875 20.4125 64-65 23.3 28.325 27.224999999999998 21.15 66-67 22.8375 28.225 27.275 21.6625 68-69 22.85 29.012500000000003 27.5875 20.549999999999997 70-71 23.5 28.275 26.875 21.349999999999998 72-73 22.1875 28.7375 27.6 21.475 74-75 22.475 27.725 27.787499999999998 22.0125 76-77 23.325000000000003 28.3375 27.0625 21.275 78-79 22.15 28.125 28.050000000000004 21.675 80-81 23.4125 29.15 26.450000000000003 20.9875 82-83 23.65 28.237499999999997 27.025 21.087500000000002 84-85 23.5 28.8375 26.950000000000003 20.7125 86-87 22.275 29.2375 27.875 20.6125 88-89 23.0375 28.975 26.424999999999997 21.5625 90-91 22.7 28.712500000000002 27.0625 21.525 92-93 23.150000000000002 28.549999999999997 27.0125 21.2875 94-95 24.5625 29.0875 26.1625 20.1875 96-97 22.625 29.65 26.937499999999996 20.7875 98-99 24.0625 27.625 27.200000000000003 21.1125 100-101 24.337500000000002 28.425 25.874999999999996 21.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 1.0 24 1.0 25 2.5 26 3.0 27 5.5 28 6.5 29 10.0 30 13.0 31 16.5 32 24.5 33 37.0 34 52.0 35 69.0 36 100.0 37 116.5 38 128.5 39 166.0 40 192.5 41 233.0 42 264.5 43 256.0 44 268.0 45 281.0 46 261.0 47 253.5 48 241.5 49 197.0 50 157.5 51 132.5 52 108.0 53 85.0 54 71.0 55 50.0 56 41.0 57 36.0 58 26.0 59 20.0 60 14.5 61 13.0 62 9.5 63 6.0 64 6.5 65 5.5 66 2.0 67 0.5 68 3.0 69 4.0 70 2.0 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.07500000000000001 0.0 0.0 0.0 0.0 64-65 0.1125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.25 0.0 0.0 0.0 0.0 74-75 0.32499999999999996 0.0 0.0 0.0 0.0 76-77 0.3625 0.0 0.0 0.0 0.0 78-79 0.45 0.0 0.0 0.0 0.0 80-81 0.575 0.0 0.0 0.0 0.0 82-83 0.6625000000000001 0.0 0.0 0.0 0.0 84-85 0.725 0.0 0.0 0.0 0.0 86-87 0.8999999999999999 0.0 0.0 0.0 0.0 88-89 1.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTTCT 15 0.009957196 47.5 34-35 >>END_MODULE Read 831240 spots for ERR1864472.sra Written 831240 spots for ERR1864472.sra Read 831240 spots for ERR1864472.sra Written 831240 spots for ERR1864472.sra Read 831240 spots for ERR1864472.sra Written 831240 spots for ERR1864472.sra Read 831240 spots for ERR1864472.sra Written 831240 spots for ERR1864472.sra Read 831240 spots for ERR1864472.sra Written 831240 spots for ERR1864472.sra Read 831240 spots for ERR1864472.sra Written 831240 spots for ERR1864472.sra Read 831240 spots for ERR1864472.sra Written 831240 spots for ERR1864472.sra Read 831240 spots for ERR1864472.sra Written 831240 spots for ERR1864472.sra Read 831240 spots for ERR1864472.sra Written 831240 spots for ERR1864472.sra Read 831240 spots for ERR1864472.sra Written 831240 spots for ERR1864472.sra Read 831240 spots for ERR1864472.sra Written 831240 spots for ERR1864472.sra Read 831240 spots for ERR1864472.sra Written 831240 spots for ERR1864472.sra Read 831240 spots for ERR1864472.sra Written 831240 spots for ERR1864472.sra Read 831240 spots for ERR1864472.sra Written 831240 spots for ERR1864472.sra Read 831240 spots for ERR1864472.sra Written 831240 spots for ERR1864472.sra Read 831240 spots for ERR1864472.sra Written 831240 spots for ERR1864472.sra Read 831240 spots for ERR1864472.sra Written 831240 spots for ERR1864472.sra Read 831240 spots for ERR1864472.sra Written 831240 spots for ERR1864472.sra Read 831240 spots for ERR1864472.sra Written 831240 spots for ERR1864472.sra Read 831259 spots for ERR1864472.sra Written 831259 spots for ERR1864472.sra SRR ids: ['ERR1864472.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w1gevk_h ERR1864472.sra spots: 16624819 blocks: [[1, 831240], [831241, 1662480], [1662481, 2493720], [2493721, 3324960], [3324961, 4156200], [4156201, 4987440], [4987441, 5818680], [5818681, 6649920], [6649921, 7481160], [7481161, 8312400], [8312401, 9143640], [9143641, 9974880], [9974881, 10806120], [10806121, 11637360], [11637361, 12468600], [12468601, 13299840], [13299841, 14131080], [14131081, 14962320], [14962321, 15793560], [15793561, 16624819]] ERR1864472 file size 3988387 ERR1864472 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864472 ERR1864472_1.fastq ERR1864472_2.fastq Input file: ERR1864472_1.fastq Paired file: ERR1864472_2.fastq trimmed: ERR1864472-trimmed-pair1.fastq, ERR1864472-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:33:59 2025 >> started Thu Feb 13 13:34:23 2025 >> done (23.611s) 16624819 read pairs processed; of these: 287504 ( 1.73%) short read pairs filtered out after trimming by size control 333287 ( 2.00%) empty read pairs filtered out after trimming by size control 16004028 (96.27%) read pairs available; of these: 3798754 (23.74%) trimmed read pairs available after processing 12205274 (76.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 133 0.00% 19 307 0.00% 20 527 0.00% 21 648 0.00% 22 915 0.01% 23 1105 0.01% 24 1409 0.01% 25 1494 0.01% 26 1798 0.01% 27 2125 0.01% 28 2398 0.01% 29 2714 0.02% 30 3165 0.02% 31 3560 0.02% 32 3872 0.02% 33 4358 0.03% 34 4687 0.03% 35 5199 0.03% 36 5571 0.03% 37 5927 0.04% 38 6226 0.04% 39 6799 0.04% 40 7048 0.04% 41 7430 0.05% 42 7901 0.05% 43 8369 0.05% 44 8741 0.05% 45 9131 0.06% 46 9392 0.06% 47 10082 0.06% 48 10616 0.07% 49 10914 0.07% 50 11141 0.07% 51 11730 0.07% 52 12390 0.08% 53 12748 0.08% 54 13233 0.08% 55 13688 0.09% 56 14495 0.09% 57 15431 0.10% 58 16167 0.10% 59 19866 0.12% 60 23223 0.15% 61 23856 0.15% 62 24244 0.15% 63 25447 0.16% 64 25893 0.16% 65 26747 0.17% 66 28009 0.18% 67 29036 0.18% 68 30400 0.19% 69 31851 0.20% 70 32985 0.21% 71 34219 0.21% 72 36133 0.23% 73 37898 0.24% 74 38204 0.24% 75 38932 0.24% 76 38789 0.24% 77 40666 0.25% 78 42596 0.27% 79 44738 0.28% 80 46901 0.29% 81 48132 0.30% 82 51272 0.32% 83 53164 0.33% 84 56031 0.35% 85 59065 0.37% 86 62824 0.39% 87 66840 0.42% 88 68073 0.43% 89 71838 0.45% 90 78600 0.49% 91 87867 0.55% 92 98083 0.61% 93 110750 0.69% 94 125316 0.78% 95 143852 0.90% 96 173550 1.08% 97 218663 1.37% 98 287008 1.79% 99 385505 2.41% 100 556104 3.47% 101 12205274 76.26% 16004028 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=3.27 fanout-score-rank=31 prefix-density=0.19 prefix-fanout=2.4 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.07 sequence-density-rank=12 fanout-score=296.46 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=29.9 sequence=TTCTTCTTCTTT criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=5.24 fanout-score-rank=32 prefix-density=0.14 prefix-fanout=4.4 sequence=GGAAAGACCATCAC criterion=fanout-score sequence-density=0.07 sequence-density-rank=13 fanout-score=398.00 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=31.6 sequence=AAGAAGAAGAGA ERR1864472 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:34:56 Started mapping on | Feb 13 13:34:56 Finished on | Feb 13 13:35:36 Mapping speed, Million of reads per hour | 1440.36 Number of input reads | 16004028 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 15323603 Uniquely mapped reads % | 95.75% Average mapped length | 195.29 Number of splices: Total | 8454200 Number of splices: Annotated (sjdb) | 8316633 Number of splices: GT/AG | 8330076 Number of splices: GC/AG | 105684 Number of splices: AT/AC | 7392 Number of splices: Non-canonical | 11048 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 2.36 Insertion rate per base | 0.01% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 540410 % of reads mapped to multiple loci | 3.38% Number of reads mapped to too many loci | 26469 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.69% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 166381 166381 166381 N_multimapping 540410 540410 540410 N_noFeature 484858 15197373 549428 N_ambiguous 122843 694 60692 UnstrandedReadsAssigned:14715902 PositiveStrandReadsAssigned:125536 NegativeStrandReadsAssigned:14713483 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864472 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864472-trimmed-pair1.fastq ERR1864472-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,004,028 reads, 15,021,946 reads pseudoaligned [quant] estimated average fragment length: 167.224 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,085 rounds 52401 ERR1864472.ke.tsv 34699 ERR1864472.se.tsv 87100 total ==> ERR1864472.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1851.78 2829 121.913 Potri.005G024800.1.v4.1 1035 868.776 2380 218.613 Potri.004G059700.1.v4.1 961 794.776 26 2.61057 Potri.007G009000.2.v4.1 1416 1249.78 0 0 Potri.003G141000.2.v4.1 2943 2776.78 502 14.4268 Potri.016G087400.1.v4.1 270 113.168 1072 755.922 Potri.015G069301.1.v4.1 564 397.894 0 0 Potri.010G195200.1.v4.1 1773 1606.78 101 5.01618 Potri.012G127500.1.v4.1 977 810.776 1175 115.65 ==> ERR1864472.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 546 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 311 Potri.001G212900.v4.1 15 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 ERR1864472 completed mapping pipeline successfully