Starting /dee2/code/volunteer_pipeline.sh ERR1864473 current disk space = 3090776289280 free memory = 1475635292 ERR1864473 SRAfilesize 7ffb4c967ee2c7345618131cff487ffe ERR1864473.sra ERR1864473.sra file validated ERR1864473 is paired end ERR1864473 is conventional basespace ERR1864473 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864473_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.47575 33.0 31.0 34.0 30.0 34.0 2 31.77925 34.0 31.0 34.0 30.0 34.0 3 32.0755 34.0 31.0 34.0 30.0 34.0 4 35.47575 37.0 35.0 37.0 33.0 37.0 5 35.21175 37.0 35.0 37.0 33.0 37.0 6 35.1685 37.0 35.0 37.0 32.0 37.0 7 35.19125 37.0 35.0 37.0 32.0 37.0 8 35.2305 37.0 35.0 37.0 32.0 37.0 9 36.8485 39.0 37.0 39.0 33.0 39.0 10-11 36.674375 39.0 37.0 39.0 32.5 39.0 12-13 36.633624999999995 39.0 37.0 39.0 32.5 39.0 14-15 37.936875 40.0 38.0 41.0 33.0 41.0 16-17 37.605375 40.0 38.0 41.0 32.0 41.0 18-19 37.711625 40.0 38.0 41.0 32.0 41.0 20-21 37.599625 40.0 38.0 41.0 32.0 41.0 22-23 37.610625 40.0 38.0 41.0 32.0 41.0 24-25 37.41775 40.0 38.0 41.0 31.5 41.0 26-27 37.326625 40.0 37.5 41.0 31.5 41.0 28-29 36.84325 40.0 36.5 41.0 30.0 41.0 30-31 36.8885 40.0 37.0 41.0 30.0 41.0 32-33 36.63249999999999 40.0 36.0 41.0 30.0 41.0 34-35 36.556875000000005 40.0 36.0 41.0 30.0 41.0 36-37 36.63475 40.0 36.5 41.0 30.0 41.0 38-39 36.619 40.0 36.0 41.0 30.0 41.0 40-41 36.4175 40.0 36.0 41.0 30.0 41.0 42-43 36.1045 39.0 35.0 41.0 28.5 41.0 44-45 36.09075 39.0 36.0 41.0 29.5 41.0 46-47 35.957875 39.0 35.5 41.0 28.5 41.0 48-49 36.070499999999996 39.0 35.5 41.0 28.0 41.0 50-51 35.87175 39.0 35.0 41.0 28.0 41.0 52-53 35.806375 39.0 35.0 41.0 28.0 41.0 54-55 35.585 39.0 35.0 41.0 27.0 41.0 56-57 35.39075 39.0 35.0 41.0 27.0 41.0 58-59 35.242875 39.0 35.0 40.0 26.5 41.0 60-61 35.017624999999995 38.0 34.0 40.0 26.0 41.0 62-63 34.738625 38.0 34.0 40.0 26.0 41.0 64-65 34.297 37.0 34.0 40.0 26.0 41.0 66-67 34.03475 37.0 33.5 40.0 25.0 41.0 68-69 33.546625 36.5 33.0 39.0 24.5 41.0 70-71 33.043375 36.0 32.0 39.0 22.0 40.5 72-73 32.5465 35.0 32.0 38.5 21.5 40.0 74-75 32.23525 35.0 32.0 37.5 21.0 39.0 76-77 30.994125 34.0 30.5 36.0 19.5 39.0 78-79 31.4675 35.0 31.0 36.0 20.0 39.0 80-81 31.316125 35.0 32.0 36.0 19.0 37.0 82-83 30.994999999999997 35.0 31.0 36.0 18.5 37.0 84-85 30.557125 35.0 31.0 35.0 15.5 36.5 86-87 29.990875000000003 34.0 30.5 35.0 7.0 36.0 88-89 29.7225 34.0 30.0 35.0 4.5 36.0 90-91 29.55525 34.0 30.0 35.0 2.0 35.5 92-93 29.154875 34.0 30.0 35.0 2.0 35.0 94-95 28.968875 34.0 29.5 35.0 2.0 35.0 96-97 28.644875 34.0 29.0 35.0 2.0 35.0 98-99 28.299 34.0 29.0 35.0 2.0 35.0 100-101 26.695 32.5 26.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 34.0 3 15.0 4 16.0 5 12.0 6 7.0 7 7.0 8 8.0 9 6.0 10 11.0 11 16.0 12 16.0 13 17.0 14 4.0 15 13.0 16 15.0 17 12.0 18 17.0 19 19.0 20 20.0 21 21.0 22 16.0 23 29.0 24 29.0 25 28.0 26 38.0 27 41.0 28 39.0 29 81.0 30 81.0 31 103.0 32 112.0 33 159.0 34 210.0 35 324.0 36 488.0 37 847.0 38 948.0 39 141.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.472349061390155 5.93607305936073 7.331303906646372 47.26027397260274 2 24.6 7.1499999999999995 35.425000000000004 32.824999999999996 3 24.85 10.299999999999999 22.525000000000002 42.325 4 28.875 17.0 21.425 32.7 5 29.475 22.375 24.575 23.575 6 22.7 27.700000000000003 25.674999999999997 23.925 7 16.475 23.849999999999998 42.35 17.325 8 17.2 24.625 36.225 21.95 9 17.974999999999998 22.525000000000002 38.375 21.125 10-11 19.287499999999998 32.525 28.749999999999996 19.4375 12-13 20.5 26.6 30.9625 21.9375 14-15 20.4 27.1375 29.875 22.5875 16-17 20.599999999999998 27.212500000000002 29.037499999999998 23.150000000000002 18-19 20.1875 28.725 27.6625 23.425 20-21 20.9125 28.175 27.975 22.9375 22-23 20.75 29.275000000000002 27.187499999999996 22.787499999999998 24-25 20.7375 27.125 27.8375 24.3 26-27 21.475 27.2625 28.299999999999997 22.9625 28-29 20.7875 27.425 28.5625 23.225 30-31 21.275 27.575 27.35 23.799999999999997 32-33 20.6375 26.787499999999998 29.0875 23.4875 34-35 21.375 27.5125 27.975 23.1375 36-37 21.05 27.712500000000002 28.512500000000003 22.725 38-39 21.0625 27.5125 28.6125 22.8125 40-41 21.65 27.825 28.799999999999997 21.725 42-43 21.2 27.35 28.9875 22.4625 44-45 20.7875 28.4375 27.075 23.7 46-47 20.837500000000002 27.975 27.825 23.3625 48-49 20.875 28.225 28.4375 22.4625 50-51 21.75 27.650000000000002 28.299999999999997 22.3 52-53 20.9875 28.487499999999997 27.5125 23.0125 54-55 21.175 27.750000000000004 28.1125 22.9625 56-57 20.5 27.6 28.499999999999996 23.400000000000002 58-59 20.5375 27.6875 28.462500000000002 23.3125 60-61 20.825 27.725 27.737499999999997 23.7125 62-63 20.7375 27.037499999999998 29.3875 22.8375 64-65 20.9125 27.6375 28.212500000000002 23.2375 66-67 20.6875 28.462500000000002 27.675 23.175 68-69 21.6 26.637499999999996 28.762500000000003 23.0 70-71 21.65 26.8625 28.4125 23.075000000000003 72-73 20.549999999999997 27.275 29.2875 22.8875 74-75 20.7375 27.437499999999996 28.8625 22.9625 76-77 21.3875 26.9625 28.999999999999996 22.650000000000002 78-79 21.7 26.700000000000003 28.299999999999997 23.3 80-81 21.575 27.2625 28.262500000000003 22.900000000000002 82-83 21.712500000000002 27.3125 27.5875 23.3875 84-85 20.962500000000002 28.249999999999996 27.487499999999997 23.3 86-87 20.95 28.4 28.1125 22.537499999999998 88-89 21.7875 27.6 28.512500000000003 22.1 90-91 20.6375 27.450000000000003 27.762500000000003 24.15 92-93 21.637500000000003 27.187499999999996 27.625 23.549999999999997 94-95 20.549999999999997 28.499999999999996 28.237499999999997 22.7125 96-97 20.825 28.1875 27.6375 23.35 98-99 21.6625 27.975 27.200000000000003 23.1625 100-101 21.85 27.775 27.6625 22.7125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.5 20 1.0 21 1.0 22 1.0 23 0.5 24 1.5 25 2.5 26 4.0 27 7.0 28 8.0 29 10.0 30 16.0 31 20.0 32 23.5 33 34.5 34 52.0 35 70.5 36 86.0 37 95.5 38 117.0 39 144.5 40 182.5 41 210.5 42 219.0 43 232.5 44 256.0 45 261.5 46 268.0 47 267.5 48 228.0 49 203.0 50 188.0 51 155.5 52 121.5 53 102.5 54 83.5 55 64.0 56 52.0 57 45.0 58 33.0 59 24.0 60 23.5 61 21.0 62 14.5 63 12.0 64 9.5 65 7.5 66 6.5 67 3.0 68 1.0 69 0.0 70 0.0 71 0.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.5 77 1.0 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24395161290323 98.45 2 0.7056451612903225 1.4000000000000001 3 0.05040322580645161 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.07500000000000001 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.38749999999999996 0.0 0.0 0.0 0.0 84-85 0.5875 0.0 0.0 0.0 0.0 86-87 0.7375 0.0 0.0 0.0 0.0 88-89 0.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864473 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864473_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.38925 33.0 31.0 34.0 28.0 34.0 2 31.50175 33.0 31.0 34.0 28.0 34.0 3 31.585 34.0 31.0 34.0 28.0 34.0 4 34.95675 37.0 35.0 37.0 32.0 37.0 5 34.929 37.0 35.0 37.0 32.0 37.0 6 35.00425 37.0 35.0 37.0 32.0 37.0 7 34.9 37.0 35.0 37.0 32.0 37.0 8 34.99125 37.0 35.0 37.0 32.0 37.0 9 36.49025 39.0 37.0 39.0 32.0 39.0 10-11 36.372 39.0 37.0 39.0 32.0 39.0 12-13 36.164 39.0 37.0 39.0 31.0 39.0 14-15 37.287875 40.0 37.0 41.0 30.5 41.0 16-17 37.399875 40.0 37.5 41.0 31.5 41.0 18-19 37.489125 40.0 38.0 41.0 31.5 41.0 20-21 37.35225 40.0 37.5 41.0 31.0 41.0 22-23 37.36175 40.0 38.0 41.0 31.5 41.0 24-25 37.367000000000004 40.0 37.5 41.0 31.5 41.0 26-27 37.02875 40.0 37.0 41.0 30.5 41.0 28-29 36.784875 40.0 37.0 41.0 30.0 41.0 30-31 36.851124999999996 40.0 37.0 41.0 30.0 41.0 32-33 36.698375 40.0 36.5 41.0 30.0 41.0 34-35 36.4585 40.0 36.0 41.0 29.5 41.0 36-37 36.1095 39.0 36.0 41.0 28.5 41.0 38-39 35.650875 39.0 35.0 40.0 25.5 41.0 40-41 35.667 39.0 35.0 40.0 25.5 41.0 42-43 35.627875 39.0 35.0 40.0 26.5 41.0 44-45 35.287499999999994 38.0 34.5 40.0 25.0 41.0 46-47 35.40025 39.0 35.0 40.0 25.5 41.0 48-49 35.122875 38.5 34.5 40.0 25.0 41.0 50-51 34.52525 38.0 33.5 39.5 25.0 40.5 52-53 34.478875 38.0 33.5 39.5 24.0 40.5 54-55 35.365875 39.0 35.0 40.5 26.0 41.0 56-57 35.368 39.0 35.0 41.0 26.0 41.0 58-59 34.828625 39.0 34.0 41.0 24.5 41.0 60-61 34.88875 38.5 34.0 41.0 24.0 41.0 62-63 34.80875 38.0 34.0 40.0 26.0 41.0 64-65 34.23025 37.5 33.5 40.0 24.0 41.0 66-67 33.81337499999999 37.0 33.5 40.0 22.5 41.0 68-69 33.474000000000004 36.5 33.0 39.0 22.5 41.0 70-71 33.11225 36.0 33.0 39.0 22.0 40.5 72-73 32.53675 35.5 32.5 38.5 20.0 40.0 74-75 32.040124999999996 35.0 32.0 37.0 19.5 39.0 76-77 31.41825 35.0 31.0 37.0 17.5 39.0 78-79 31.00625 35.0 31.0 36.0 15.0 38.5 80-81 30.703875 35.0 31.0 36.0 13.0 37.0 82-83 30.389375 34.5 30.5 35.5 9.5 37.0 84-85 30.045125 34.0 30.5 35.0 7.0 36.0 86-87 29.865125 34.0 30.5 35.0 4.5 36.0 88-89 29.482375 34.0 30.0 35.0 2.0 36.0 90-91 29.060875 34.0 29.0 35.0 2.0 35.0 92-93 28.260375 34.0 28.0 35.0 2.0 35.0 94-95 27.968249999999998 34.0 27.0 35.0 2.0 35.0 96-97 27.979 34.0 29.0 35.0 2.0 35.0 98-99 27.7225 34.0 28.0 35.0 2.0 35.0 100-101 26.585625 33.0 25.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 34.0 3 8.0 4 6.0 5 4.0 6 10.0 7 7.0 8 10.0 9 14.0 10 22.0 11 15.0 12 17.0 13 20.0 14 14.0 15 18.0 16 20.0 17 17.0 18 25.0 19 23.0 20 16.0 21 27.0 22 18.0 23 31.0 24 38.0 25 34.0 26 47.0 27 45.0 28 75.0 29 60.0 30 89.0 31 105.0 32 119.0 33 166.0 34 204.0 35 324.0 36 450.0 37 866.0 38 899.0 39 103.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 27.3 19.1 13.25 40.35 2 22.400000000000002 25.7 36.3 15.6 3 18.825 28.525 30.775000000000002 21.875 4 20.625 33.875 24.95 20.549999999999997 5 24.275 34.65 24.175 16.900000000000002 6 19.875 37.974999999999994 24.85 17.299999999999997 7 18.775 22.1 38.275 20.849999999999998 8 21.675 25.124999999999996 29.875 23.325000000000003 9 21.224999999999998 23.875 30.099999999999998 24.8 10-11 22.0625 31.775 25.0375 21.125 12-13 23.599999999999998 25.900000000000002 26.937499999999996 23.5625 14-15 21.65 29.3375 26.950000000000003 22.0625 16-17 22.8125 28.975 27.1 21.1125 18-19 22.675 27.8875 27.400000000000002 22.037499999999998 20-21 23.05 29.65 26.9625 20.3375 22-23 22.237499999999997 29.25 27.2625 21.25 24-25 22.125 29.1125 27.6625 21.099999999999998 26-27 21.8625 29.7375 27.3625 21.0375 28-29 23.575 28.6875 26.2875 21.45 30-31 22.35 28.5875 27.737499999999997 21.325 32-33 22.875 28.549999999999997 27.0 21.575 34-35 21.7875 28.462500000000002 28.287499999999998 21.462500000000002 36-37 22.225 28.537499999999998 27.700000000000003 21.5375 38-39 22.7625 28.537499999999998 27.8375 20.8625 40-41 23.0375 27.6375 28.000000000000004 21.325 42-43 22.5625 27.8125 28.349999999999998 21.275 44-45 22.0625 28.000000000000004 28.549999999999997 21.3875 46-47 23.1625 27.224999999999998 27.875 21.7375 48-49 22.4875 29.425 27.762500000000003 20.325 50-51 22.7125 29.525000000000002 26.8 20.962500000000002 52-53 23.125 28.299999999999997 27.875 20.7 54-55 23.974999999999998 27.712500000000002 27.625 20.6875 56-57 23.2125 28.0875 28.175 20.525 58-59 23.1875 28.725 26.787499999999998 21.3 60-61 23.0125 28.749999999999996 27.375 20.8625 62-63 22.7 28.875 27.625 20.8 64-65 23.35 27.85 27.425 21.375 66-67 22.1 28.6375 27.950000000000003 21.3125 68-69 23.425 29.1375 26.9625 20.474999999999998 70-71 23.1875 28.125 27.05 21.637500000000003 72-73 22.412499999999998 27.8625 27.9375 21.7875 74-75 22.8375 28.812500000000004 27.3875 20.962500000000002 76-77 23.5625 27.8875 26.85 21.7 78-79 22.925 29.15 27.400000000000002 20.525 80-81 22.475 28.999999999999996 27.1 21.425 82-83 23.7625 27.650000000000002 27.6125 20.974999999999998 84-85 22.725 28.675 27.825 20.775 86-87 22.75 28.6625 27.750000000000004 20.837500000000002 88-89 24.1875 28.237499999999997 26.787499999999998 20.7875 90-91 23.9 28.0625 26.85 21.1875 92-93 22.8 29.262500000000003 27.0 20.9375 94-95 22.95 29.549999999999997 26.55 20.95 96-97 23.2875 28.9 27.025 20.7875 98-99 24.0 28.287499999999998 26.224999999999998 21.4875 100-101 24.3125 28.8875 26.474999999999998 20.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 0.5 22 0.0 23 1.0 24 1.5 25 1.5 26 5.5 27 8.0 28 11.0 29 12.0 30 14.5 31 22.0 32 30.5 33 41.5 34 50.0 35 69.0 36 95.5 37 113.5 38 135.0 39 172.5 40 208.0 41 234.5 42 254.5 43 260.0 44 271.5 45 277.0 46 250.5 47 235.5 48 234.5 49 202.0 50 162.5 51 123.0 52 96.0 53 93.0 54 71.0 55 50.0 56 46.0 57 36.0 58 23.5 59 18.5 60 15.0 61 9.0 62 8.0 63 7.5 64 5.5 65 6.0 66 3.5 67 2.5 68 2.0 69 1.0 70 1.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.07500000000000001 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.55 0.0 0.0 0.0 0.0 86-87 0.7124999999999999 0.0 0.0 0.0 0.0 88-89 0.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 913362 spots for ERR1864473.sra Written 913362 spots for ERR1864473.sra Read 913362 spots for ERR1864473.sra Written 913362 spots for ERR1864473.sra Read 913362 spots for ERR1864473.sra Written 913362 spots for ERR1864473.sra Read 913362 spots for ERR1864473.sra Written 913362 spots for ERR1864473.sra Read 913362 spots for ERR1864473.sra Written 913362 spots for ERR1864473.sra Read 913368 spots for ERR1864473.sra Written 913368 spots for ERR1864473.sra Read 913362 spots for ERR1864473.sra Written 913362 spots for ERR1864473.sra Read 913362 spots for ERR1864473.sra Written 913362 spots for ERR1864473.sra Read 913362 spots for ERR1864473.sra Written 913362 spots for ERR1864473.sra Read 913362 spots for ERR1864473.sra Written 913362 spots for ERR1864473.sra Read 913362 spots for ERR1864473.sra Written 913362 spots for ERR1864473.sra Read 913362 spots for ERR1864473.sra Written 913362 spots for ERR1864473.sra Read 913362 spots for ERR1864473.sra Written 913362 spots for ERR1864473.sra Read 913362 spots for ERR1864473.sra Written 913362 spots for ERR1864473.sra Read 913362 spots for ERR1864473.sra Written 913362 spots for ERR1864473.sra Read 913362 spots for ERR1864473.sra Written 913362 spots for ERR1864473.sra Read 913362 spots for ERR1864473.sra Written 913362 spots for ERR1864473.sra Read 913362 spots for ERR1864473.sra Written 913362 spots for ERR1864473.sra Read 913362 spots for ERR1864473.sra Written 913362 spots for ERR1864473.sra Read 913362 spots for ERR1864473.sra Written 913362 spots for ERR1864473.sra SRR ids: ['ERR1864473.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nv7p8xaz ERR1864473.sra spots: 18267246 blocks: [[1, 913362], [913363, 1826724], [1826725, 2740086], [2740087, 3653448], [3653449, 4566810], [4566811, 5480172], [5480173, 6393534], [6393535, 7306896], [7306897, 8220258], [8220259, 9133620], [9133621, 10046982], [10046983, 10960344], [10960345, 11873706], [11873707, 12787068], [12787069, 13700430], [13700431, 14613792], [14613793, 15527154], [15527155, 16440516], [16440517, 17353878], [17353879, 18267246]] ERR1864473 file size 4384559 ERR1864473 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864473 ERR1864473_1.fastq ERR1864473_2.fastq Input file: ERR1864473_1.fastq Paired file: ERR1864473_2.fastq trimmed: ERR1864473-trimmed-pair1.fastq, ERR1864473-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:34:29 2025 >> started Thu Feb 13 13:34:46 2025 >> done (17.458s) 18267246 read pairs processed; of these: 291222 ( 1.59%) short read pairs filtered out after trimming by size control 335586 ( 1.84%) empty read pairs filtered out after trimming by size control 17640438 (96.57%) read pairs available; of these: 4335565 (24.58%) trimmed read pairs available after processing 13304873 (75.42%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 160 0.00% 19 366 0.00% 20 572 0.00% 21 717 0.00% 22 944 0.01% 23 1199 0.01% 24 1407 0.01% 25 1714 0.01% 26 1933 0.01% 27 2285 0.01% 28 2646 0.01% 29 3132 0.02% 30 3491 0.02% 31 3847 0.02% 32 4353 0.02% 33 4942 0.03% 34 5264 0.03% 35 5739 0.03% 36 6110 0.03% 37 6709 0.04% 38 7084 0.04% 39 7684 0.04% 40 7931 0.04% 41 8573 0.05% 42 8956 0.05% 43 9447 0.05% 44 9889 0.06% 45 10413 0.06% 46 10945 0.06% 47 11225 0.06% 48 11677 0.07% 49 12407 0.07% 50 13052 0.07% 51 13436 0.08% 52 13875 0.08% 53 14392 0.08% 54 15283 0.09% 55 15781 0.09% 56 16860 0.10% 57 17549 0.10% 58 18442 0.10% 59 22380 0.13% 60 26045 0.15% 61 26243 0.15% 62 27396 0.16% 63 28404 0.16% 64 29417 0.17% 65 30602 0.17% 66 31407 0.18% 67 33131 0.19% 68 34310 0.19% 69 35643 0.20% 70 37178 0.21% 71 39030 0.22% 72 40756 0.23% 73 42370 0.24% 74 43822 0.25% 75 44381 0.25% 76 44186 0.25% 77 46093 0.26% 78 48088 0.27% 79 51260 0.29% 80 53103 0.30% 81 55300 0.31% 82 58550 0.33% 83 60781 0.34% 84 64187 0.36% 85 67523 0.38% 86 72030 0.41% 87 76819 0.44% 88 77949 0.44% 89 82181 0.47% 90 91024 0.52% 91 100697 0.57% 92 113125 0.64% 93 126757 0.72% 94 144510 0.82% 95 165445 0.94% 96 199263 1.13% 97 250616 1.42% 98 329852 1.87% 99 442000 2.51% 100 629280 3.57% 101 13304873 75.42% 17640438 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=3.55 fanout-score-rank=29 prefix-density=0.29 prefix-fanout=2.6 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.08 sequence-density-rank=15 fanout-score=296.69 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=29.6 sequence=TTCTTCTTCTTTTT criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.80 fanout-score-rank=28 prefix-density=0.19 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.08 sequence-density-rank=7 fanout-score=312.66 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=29.2 sequence=AAGAAGAAGAAA ERR1864473 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:35:15 Started mapping on | Feb 13 13:35:15 Finished on | Feb 13 13:35:58 Mapping speed, Million of reads per hour | 1476.87 Number of input reads | 17640438 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 17044811 Uniquely mapped reads % | 96.62% Average mapped length | 195.07 Number of splices: Total | 9186800 Number of splices: Annotated (sjdb) | 9018787 Number of splices: GT/AG | 9046573 Number of splices: GC/AG | 117997 Number of splices: AT/AC | 9485 Number of splices: Non-canonical | 12745 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.01% Deletion average length | 2.45 Insertion rate per base | 0.01% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 460793 % of reads mapped to multiple loci | 2.61% Number of reads mapped to too many loci | 30772 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.57% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 161499 161499 161499 N_multimapping 460793 460793 460793 N_noFeature 601654 16883735 684671 N_ambiguous 154513 811 75962 UnstrandedReadsAssigned:16288644 PositiveStrandReadsAssigned:160265 NegativeStrandReadsAssigned:16284178 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864473 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864473-trimmed-pair1.fastq ERR1864473-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,640,438 reads, 16,500,377 reads pseudoaligned [quant] estimated average fragment length: 166.464 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,132 rounds 52401 ERR1864473.ke.tsv 34699 ERR1864473.se.tsv 87100 total ==> ERR1864473.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1852.54 3584.26 142.16 Potri.005G024800.1.v4.1 1035 869.536 2345 198.153 Potri.004G059700.1.v4.1 961 795.536 15 1.3854 Potri.007G009000.2.v4.1 1416 1250.54 0 0 Potri.003G141000.2.v4.1 2943 2777.54 589.951 15.6064 Potri.016G087400.1.v4.1 270 113.738 892.781 576.747 Potri.015G069301.1.v4.1 564 398.651 0 0 Potri.010G195200.1.v4.1 1773 1607.54 79 3.61086 Potri.012G127500.1.v4.1 977 811.536 914 82.7529 ==> ERR1864473.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1086 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 247 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 ERR1864473 completed mapping pipeline successfully