Starting /dee2/code/volunteer_pipeline.sh ERR1864474 current disk space = 3091160997888 free memory = 1425190856 ERR1864474 SRAfilesize 44bec37d25413065497d6fd1ca9bcdab ERR1864474.sra ERR1864474.sra file validated ERR1864474 is paired end ERR1864474 is conventional basespace ERR1864474 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864474_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.8385 34.0 31.0 34.0 30.0 34.0 2 32.00525 34.0 31.0 34.0 30.0 34.0 3 32.247 34.0 31.0 34.0 30.0 34.0 4 35.74975 37.0 35.0 37.0 35.0 37.0 5 35.40375 37.0 35.0 37.0 33.0 37.0 6 35.36475 37.0 35.0 37.0 33.0 37.0 7 35.352 37.0 35.0 37.0 33.0 37.0 8 35.2665 37.0 35.0 37.0 33.0 37.0 9 37.02775 39.0 37.0 39.0 33.0 39.0 10-11 36.874125 39.0 37.0 39.0 33.0 39.0 12-13 36.915375 39.0 37.0 39.0 33.0 39.0 14-15 38.1755 41.0 38.0 41.0 33.0 41.0 16-17 38.158500000000004 40.5 38.0 41.0 33.0 41.0 18-19 38.07875 40.0 38.0 41.0 33.5 41.0 20-21 38.04025 40.0 38.0 41.0 33.0 41.0 22-23 37.86725 40.0 38.0 41.0 32.5 41.0 24-25 37.831375 40.0 38.0 41.0 32.0 41.0 26-27 37.6535 40.0 38.0 41.0 32.0 41.0 28-29 37.642250000000004 40.0 38.0 41.0 32.0 41.0 30-31 37.549375 40.0 38.0 41.0 32.0 41.0 32-33 37.347875 40.0 38.0 41.0 31.5 41.0 34-35 37.321 40.0 38.0 41.0 31.5 41.0 36-37 37.161625 40.0 37.0 41.0 31.0 41.0 38-39 36.782375 40.0 37.0 41.0 30.0 41.0 40-41 36.7755 40.0 37.0 41.0 30.0 41.0 42-43 36.687125 40.0 36.5 41.0 30.0 41.0 44-45 36.626999999999995 40.0 36.5 41.0 30.0 41.0 46-47 36.8315 40.0 37.0 41.0 30.0 41.0 48-49 36.702625 40.0 36.5 41.0 30.0 41.0 50-51 36.59725 40.0 36.0 41.0 30.0 41.0 52-53 36.25275 40.0 36.0 41.0 29.0 41.0 54-55 36.09025 39.0 35.0 41.0 29.0 41.0 56-57 35.704125 39.0 35.0 41.0 28.0 41.0 58-59 35.559375 39.0 35.0 40.0 28.0 41.0 60-61 35.460875 39.0 35.0 40.0 28.0 41.0 62-63 35.164875 38.0 34.5 40.0 27.0 41.0 64-65 34.711875 37.5 34.0 40.0 26.0 41.0 66-67 34.312375 37.0 34.0 40.0 25.5 41.0 68-69 33.995000000000005 36.5 33.5 39.0 26.0 41.0 70-71 33.725375 36.0 33.0 39.0 26.0 40.5 72-73 33.201625 35.5 33.0 38.5 25.0 40.0 74-75 32.760000000000005 35.0 32.5 37.5 24.5 39.5 76-77 31.807000000000002 34.5 31.5 36.5 23.0 39.0 78-79 32.022375 35.0 32.0 36.5 23.5 39.0 80-81 31.75525 35.0 32.0 36.0 22.5 37.5 82-83 31.607 35.0 32.0 36.0 23.5 37.0 84-85 31.183500000000002 35.0 32.0 35.0 20.5 37.0 86-87 30.888875 34.0 31.0 35.0 20.5 36.0 88-89 30.416625 34.0 31.0 35.0 18.0 36.0 90-91 30.314375 34.0 31.0 35.0 18.5 35.5 92-93 29.889625 34.0 30.5 35.0 12.5 35.0 94-95 29.495625 34.0 30.0 35.0 4.5 35.0 96-97 29.257625 34.0 30.0 35.0 2.0 35.0 98-99 28.881 34.0 30.0 35.0 2.0 35.0 100-101 28.100250000000003 33.5 29.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 32.0 3 19.0 4 11.0 5 14.0 6 6.0 7 4.0 8 5.0 9 12.0 10 8.0 11 8.0 12 8.0 13 9.0 14 13.0 15 11.0 16 10.0 17 11.0 18 12.0 19 10.0 20 16.0 21 16.0 22 16.0 23 18.0 24 30.0 25 28.0 26 45.0 27 41.0 28 42.0 29 55.0 30 60.0 31 86.0 32 103.0 33 130.0 34 194.0 35 310.0 36 474.0 37 836.0 38 1165.0 39 132.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.34681496461072 5.6622851365015165 9.479271991911022 46.51162790697674 2 24.625 6.8500000000000005 33.550000000000004 34.975 3 24.981245311327832 11.42785696424106 23.705926481620406 39.8849712428107 4 29.275000000000002 16.775000000000002 21.349999999999998 32.6 5 27.05 21.224999999999998 27.900000000000002 23.825 6 22.225 25.45 28.925 23.400000000000002 7 17.2 22.2 43.7 16.900000000000002 8 18.05 23.150000000000002 36.575 22.225 9 17.925 21.075 39.85 21.15 10-11 19.8125 30.625000000000004 29.7375 19.825 12-13 20.8625 25.412499999999998 32.7625 20.962500000000002 14-15 20.200000000000003 26.174999999999997 32.2 21.425 16-17 21.55 26.125 31.0375 21.2875 18-19 20.9375 27.075 28.925 23.0625 20-21 21.8875 27.2625 28.275 22.575 22-23 21.5375 26.5 30.049999999999997 21.912499999999998 24-25 21.087500000000002 26.900000000000002 28.6625 23.35 26-27 21.125 26.900000000000002 29.725 22.25 28-29 20.674999999999997 26.650000000000002 29.862499999999997 22.8125 30-31 21.25 26.700000000000003 28.075 23.974999999999998 32-33 19.75 27.462500000000002 29.3375 23.45 34-35 21.0375 27.8625 28.549999999999997 22.55 36-37 20.8 26.85 28.575 23.775 38-39 20.075000000000003 28.075 28.762500000000003 23.0875 40-41 20.5625 27.8625 28.975 22.6 42-43 20.6875 27.325 29.1125 22.875 44-45 20.6375 26.924999999999997 29.5875 22.85 46-47 20.9375 27.962500000000002 27.9375 23.1625 48-49 19.925 27.2625 29.075 23.7375 50-51 20.925 27.35 28.849999999999998 22.875 52-53 21.25 26.3125 28.8875 23.549999999999997 54-55 21.1375 26.450000000000003 29.8375 22.575 56-57 21.762500000000003 26.337500000000002 28.749999999999996 23.150000000000002 58-59 20.8125 27.900000000000002 28.9 22.3875 60-61 20.4875 26.437500000000004 29.612500000000004 23.4625 62-63 20.925 26.6625 30.2 22.2125 64-65 21.092773193298324 27.656914228557138 28.744686171542888 22.50562640660165 66-67 20.0125 27.4125 28.975 23.599999999999998 68-69 20.930232558139537 26.881720430107524 28.994748687171796 23.193298324581146 70-71 21.402675334416802 28.22852856607076 28.803600450056255 21.565195649456182 72-73 20.702587823477934 28.041005125640705 28.46605825728216 22.7903487935992 74-75 22.152769096137018 26.95336917114639 28.678584823102888 22.215276909613703 76-77 21.327665958244783 27.19089886235779 28.89111138892362 22.59032379047381 78-79 21.05 26.8375 28.125 23.9875 80-81 21.075 27.725 28.549999999999997 22.650000000000002 82-83 20.724999999999998 28.9125 28.6125 21.75 84-85 20.962500000000002 27.6875 28.6625 22.6875 86-87 21.8 26.2125 28.1875 23.799999999999997 88-89 21.675 28.025 28.487499999999997 21.8125 90-91 21.337500000000002 27.737499999999997 28.375 22.55 92-93 22.975 25.7625 28.1125 23.150000000000002 94-95 22.375 27.675 26.875 23.075000000000003 96-97 21.475 28.449999999999996 27.525 22.55 98-99 21.275 27.474999999999998 27.575 23.674999999999997 100-101 21.712500000000002 28.599999999999998 27.3 22.3875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 1.0 17 0.5 18 1.0 19 1.0 20 1.0 21 1.0 22 1.0 23 2.0 24 3.5 25 5.5 26 7.5 27 7.5 28 13.5 29 20.5 30 23.5 31 23.0 32 24.0 33 33.5 34 46.0 35 58.0 36 84.0 37 108.0 38 124.0 39 148.5 40 186.5 41 217.0 42 225.5 43 249.0 44 275.0 45 270.5 46 255.5 47 243.5 48 221.0 49 192.5 50 161.0 51 134.5 52 105.5 53 91.5 54 91.0 55 75.0 56 47.5 57 35.0 58 35.5 59 26.5 60 22.0 61 21.0 62 14.0 63 12.0 64 13.0 65 11.0 66 9.5 67 4.5 68 2.0 69 3.0 70 2.5 71 2.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0999999999999999 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.025 66-67 0.0 68-69 0.025 70-71 0.0125 72-73 0.0125 74-75 0.0125 76-77 0.0125 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.625 #Duplication Level Percentage of deduplicated Percentage of total 1 98.91001267427123 97.55 2 0.9125475285171103 1.7999999999999998 3 0.10139416983523447 0.3 4 0.050697084917617236 0.2 5 0.0 0.0 6 0.025348542458808618 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCCTCTTCAAATCCATGTTCTTCGATCCCATATTCTTCTGCTAAAATCC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.037500000000000006 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1375 0.0 0.0 0.0 0.0 60-61 0.175 0.0 0.0 0.0 0.0 62-63 0.2125 0.0 0.0 0.0 0.0 64-65 0.25 0.0 0.0 0.0 0.0 66-67 0.3 0.0 0.0 0.0 0.0 68-69 0.3625 0.0 0.0 0.0 0.0 70-71 0.4625 0.0 0.0 0.0 0.0 72-73 0.5625 0.0 0.0 0.0 0.0 74-75 0.7375 0.0 0.0 0.0 0.0 76-77 0.8374999999999999 0.0 0.0 0.0 0.0 78-79 0.9874999999999999 0.0 0.0 0.0 0.0 80-81 1.25 0.0 0.0 0.0 0.0 82-83 1.525 0.0 0.0 0.0 0.0 84-85 1.9874999999999998 0.0 0.0 0.0 0.0 86-87 2.4625000000000004 0.0 0.0 0.0 0.0 88-89 3.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864474 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864474_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.118 34.0 31.0 34.0 30.0 34.0 2 32.1825 34.0 31.0 34.0 30.0 34.0 3 32.1865 34.0 31.0 34.0 30.0 34.0 4 35.548 37.0 35.0 37.0 33.0 37.0 5 35.51575 37.0 35.0 37.0 33.0 37.0 6 35.4845 37.0 35.0 37.0 33.0 37.0 7 35.523 37.0 35.0 37.0 33.0 37.0 8 35.4585 37.0 35.0 37.0 33.0 37.0 9 37.0905 39.0 38.0 39.0 34.0 39.0 10-11 37.067125000000004 39.0 37.5 39.0 33.0 39.0 12-13 36.95675 39.0 37.0 39.0 33.0 39.0 14-15 38.315625 41.0 38.0 41.0 33.0 41.0 16-17 38.189750000000004 41.0 38.0 41.0 33.0 41.0 18-19 38.13525 40.0 38.0 41.0 33.0 41.0 20-21 38.159375 40.0 38.0 41.0 33.0 41.0 22-23 38.024125 40.0 38.0 41.0 33.0 41.0 24-25 38.033125 40.0 38.0 41.0 33.0 41.0 26-27 37.757625 40.0 38.0 41.0 32.5 41.0 28-29 37.704125000000005 40.0 38.0 41.0 32.0 41.0 30-31 37.527625 40.0 38.0 41.0 31.5 41.0 32-33 37.415625000000006 40.0 38.0 41.0 31.5 41.0 34-35 37.3845 40.0 38.0 41.0 31.0 41.0 36-37 37.286249999999995 40.0 37.5 41.0 31.0 41.0 38-39 37.19925 40.0 37.5 41.0 30.5 41.0 40-41 37.0255 40.0 37.5 41.0 30.5 41.0 42-43 36.91275 40.0 37.0 41.0 30.0 41.0 44-45 36.623875 40.0 36.5 41.0 30.0 41.0 46-47 36.527375 39.5 36.5 41.0 30.0 41.0 48-49 36.30075 39.0 36.0 41.0 29.5 41.0 50-51 36.116749999999996 39.0 35.5 40.5 29.5 41.0 52-53 36.23524999999999 39.0 36.0 40.5 30.0 41.0 54-55 36.469125000000005 40.0 36.0 41.0 30.0 41.0 56-57 36.313 39.5 36.0 41.0 29.5 41.0 58-59 35.894499999999994 39.0 35.0 41.0 28.0 41.0 60-61 35.633624999999995 39.0 35.0 41.0 28.0 41.0 62-63 35.408 38.5 35.0 40.5 28.0 41.0 64-65 35.210875 38.0 34.5 40.0 28.0 41.0 66-67 34.852375 37.5 34.5 40.0 26.5 41.0 68-69 34.335125 37.0 34.0 39.5 26.0 41.0 70-71 33.930499999999995 36.0 34.0 39.0 26.0 41.0 72-73 33.626000000000005 36.0 34.0 39.0 26.0 40.0 74-75 33.232 35.0 33.5 37.5 26.0 39.5 76-77 32.792249999999996 35.0 33.0 37.0 25.0 39.0 78-79 32.2215 35.0 33.0 36.5 24.0 39.0 80-81 31.8445 35.0 32.0 36.0 22.5 37.0 82-83 31.574375 35.0 32.0 36.0 23.0 37.0 84-85 31.076375 35.0 31.5 35.0 20.5 36.5 86-87 30.7685 34.5 31.0 35.0 19.5 36.0 88-89 30.5935 34.0 31.0 35.0 19.0 36.0 90-91 30.32125 34.0 31.0 35.0 18.0 35.5 92-93 30.021625 34.0 31.0 35.0 14.5 35.0 94-95 29.804625 34.0 31.0 35.0 5.0 35.0 96-97 29.247999999999998 34.0 30.0 35.0 2.0 35.0 98-99 28.840249999999997 34.0 30.0 35.0 2.0 35.0 100-101 27.81025 33.5 27.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 27.0 3 7.0 4 6.0 5 9.0 6 6.0 7 7.0 8 7.0 9 3.0 10 9.0 11 12.0 12 15.0 13 9.0 14 12.0 15 12.0 16 10.0 17 12.0 18 10.0 19 21.0 20 21.0 21 14.0 22 19.0 23 24.0 24 18.0 25 31.0 26 39.0 27 49.0 28 37.0 29 64.0 30 57.0 31 94.0 32 97.0 33 140.0 34 164.0 35 281.0 36 490.0 37 891.0 38 1087.0 39 189.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.2 18.925 16.125 34.75 2 27.224999999999998 22.625 32.574999999999996 17.575 3 19.875 27.900000000000002 29.975 22.25 4 23.225 32.775 23.474999999999998 20.525 5 26.6 33.675 21.349999999999998 18.375 6 20.275000000000002 38.525 23.075000000000003 18.125 7 21.275 22.1 37.675 18.95 8 21.075 25.7 28.499999999999996 24.725 9 21.975 25.2 29.7 23.125 10-11 23.6625 31.8 23.724999999999998 20.8125 12-13 24.3875 26.3 26.650000000000002 22.662499999999998 14-15 23.05 29.375 26.5875 20.9875 16-17 24.4375 28.0625 26.387500000000003 21.1125 18-19 23.075000000000003 29.175 26.35 21.4 20-21 23.3875 28.225 26.7125 21.675 22-23 23.825 28.462500000000002 26.400000000000002 21.3125 24-25 22.625 29.25 26.924999999999997 21.2 26-27 23.8625 29.099999999999998 26.5375 20.5 28-29 23.4875 29.025000000000002 25.5375 21.95 30-31 22.55 29.875 27.1375 20.4375 32-33 23.05 29.475 27.250000000000004 20.225 34-35 23.1625 28.925 26.674999999999997 21.2375 36-37 23.7625 28.1375 26.625 21.475 38-39 23.05 28.9375 27.762500000000003 20.25 40-41 23.525 28.225 27.275 20.974999999999998 42-43 22.925 29.15 27.462500000000002 20.4625 44-45 24.1125 28.375 27.237499999999997 20.275000000000002 46-47 23.7375 28.3375 27.400000000000002 20.525 48-49 22.95 28.749999999999996 27.500000000000004 20.8 50-51 22.5125 28.275 27.987499999999997 21.224999999999998 52-53 22.55 28.8375 27.500000000000004 21.1125 54-55 22.912499999999998 29.049999999999997 27.3375 20.7 56-57 23.225 29.7375 26.737499999999997 20.3 58-59 23.8125 29.325000000000003 26.0375 20.825 60-61 22.8375 30.25 26.900000000000002 20.0125 62-63 22.412499999999998 29.7 26.1 21.7875 64-65 22.9375 29.7125 26.3625 20.9875 66-67 22.8125 29.875 27.700000000000003 19.6125 68-69 23.6875 28.9375 26.775 20.599999999999998 70-71 23.2625 28.3375 27.800000000000004 20.599999999999998 72-73 23.45 29.099999999999998 26.150000000000002 21.3 74-75 22.675 29.8375 26.674999999999997 20.8125 76-77 22.6125 28.9 27.525 20.962500000000002 78-79 22.85 28.962500000000002 27.025 21.1625 80-81 23.0875 29.65 26.025 21.2375 82-83 24.125 28.4 26.525 20.95 84-85 23.150000000000002 28.7375 26.525 21.587500000000002 86-87 22.5875 29.7 27.3875 20.325 88-89 23.8375 28.8625 26.9125 20.3875 90-91 23.5 29.5 26.3125 20.6875 92-93 23.325000000000003 29.25 26.325 21.099999999999998 94-95 23.4375 29.212500000000002 26.237500000000004 21.1125 96-97 23.9875 29.7125 26.0125 20.2875 98-99 23.9 30.6875 25.0 20.4125 100-101 24.775 30.525000000000002 24.275 20.424999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 2.0 22 2.0 23 1.5 24 3.0 25 5.5 26 6.5 27 9.0 28 12.0 29 13.0 30 16.0 31 26.5 32 36.0 33 39.0 34 46.5 35 69.5 36 85.5 37 111.0 38 140.0 39 160.0 40 196.0 41 229.0 42 254.0 43 259.0 44 263.5 45 252.0 46 242.0 47 250.0 48 213.0 49 196.0 50 176.0 51 127.0 52 97.0 53 79.0 54 65.5 55 52.5 56 51.0 57 43.5 58 30.0 59 25.0 60 21.5 61 14.5 62 14.5 63 14.0 64 11.0 65 9.0 66 8.0 67 7.5 68 4.0 69 1.5 70 2.0 71 1.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49710837314558 98.925 2 0.4777470455116922 0.95 3 0.0 0.0 4 0.0 0.0 5 0.025144581342720643 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCCATTTGACAAGAAGCAGTTTCTTACACAGATTAAGAAATTTATCAAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.037500000000000006 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1375 0.0 0.0 0.0 0.0 60-61 0.175 0.0 0.0 0.0 0.0 62-63 0.2125 0.0 0.0 0.0 0.0 64-65 0.25 0.0 0.0 0.0 0.0 66-67 0.3 0.0 0.0 0.0 0.0 68-69 0.3625 0.0 0.0 0.0 0.0 70-71 0.4625 0.0 0.0 0.0 0.0 72-73 0.55 0.0 0.0 0.0 0.0 74-75 0.7125 0.0 0.0 0.0 0.0 76-77 0.825 0.0 0.0 0.0 0.0 78-79 0.9625 0.0 0.0 0.0 0.0 80-81 1.225 0.0 0.0 0.0 0.0 82-83 1.5 0.0 0.0 0.0 0.0 84-85 1.9625 0.0 0.0 0.0 0.0 86-87 2.425 0.0 0.0 0.0 0.0 88-89 3.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 766887 spots for ERR1864474.sra Written 766887 spots for ERR1864474.sra Read 766887 spots for ERR1864474.sra Written 766887 spots for ERR1864474.sra Read 766887 spots for ERR1864474.sra Written 766887 spots for ERR1864474.sra Read 766887 spots for ERR1864474.sra Written 766887 spots for ERR1864474.sra Read 766887 spots for ERR1864474.sra Written 766887 spots for ERR1864474.sra Read 766887 spots for ERR1864474.sra Written 766887 spots for ERR1864474.sra Read 766887 spots for ERR1864474.sra Written 766887 spots for ERR1864474.sra Read 766887 spots for ERR1864474.sra Written 766887 spots for ERR1864474.sra Read 766887 spots for ERR1864474.sra Written 766887 spots for ERR1864474.sra Read 766887 spots for ERR1864474.sra Written 766887 spots for ERR1864474.sra Read 766887 spots for ERR1864474.sra Written 766887 spots for ERR1864474.sra Read 766887 spots for ERR1864474.sra Written 766887 spots for ERR1864474.sra Read 766887 spots for ERR1864474.sra Written 766887 spots for ERR1864474.sra Read 766887 spots for ERR1864474.sra Written 766887 spots for ERR1864474.sra Read 766887 spots for ERR1864474.sra Written 766887 spots for ERR1864474.sra Read 766898 spots for ERR1864474.sra Written 766898 spots for ERR1864474.sra Read 766887 spots for ERR1864474.sra Written 766887 spots for ERR1864474.sra Read 766887 spots for ERR1864474.sra Written 766887 spots for ERR1864474.sra Read 766887 spots for ERR1864474.sra Written 766887 spots for ERR1864474.sra Read 766887 spots for ERR1864474.sra Written 766887 spots for ERR1864474.sra SRR ids: ['ERR1864474.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2nd5j5l5 ERR1864474.sra spots: 15337751 blocks: [[1, 766887], [766888, 1533774], [1533775, 2300661], [2300662, 3067548], [3067549, 3834435], [3834436, 4601322], [4601323, 5368209], [5368210, 6135096], [6135097, 6901983], [6901984, 7668870], [7668871, 8435757], [8435758, 9202644], [9202645, 9969531], [9969532, 10736418], [10736419, 11503305], [11503306, 12270192], [12270193, 13037079], [13037080, 13803966], [13803967, 14570853], [14570854, 15337751]] ERR1864474 file size 3677932 ERR1864474 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864474 ERR1864474_1.fastq ERR1864474_2.fastq Input file: ERR1864474_1.fastq Paired file: ERR1864474_2.fastq trimmed: ERR1864474-trimmed-pair1.fastq, ERR1864474-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:17:07 2025 >> started Thu Feb 13 13:17:21 2025 >> done (14.080s) 15337751 read pairs processed; of these: 201828 ( 1.32%) short read pairs filtered out after trimming by size control 196702 ( 1.28%) empty read pairs filtered out after trimming by size control 14939221 (97.40%) read pairs available; of these: 4098025 (27.43%) trimmed read pairs available after processing 10841196 (72.57%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 87 0.00% 19 182 0.00% 20 306 0.00% 21 378 0.00% 22 531 0.00% 23 708 0.00% 24 837 0.01% 25 1028 0.01% 26 1192 0.01% 27 1380 0.01% 28 1568 0.01% 29 1817 0.01% 30 1996 0.01% 31 2410 0.02% 32 2653 0.02% 33 3044 0.02% 34 3408 0.02% 35 3627 0.02% 36 3906 0.03% 37 4174 0.03% 38 4492 0.03% 39 4737 0.03% 40 5287 0.04% 41 5578 0.04% 42 6176 0.04% 43 6246 0.04% 44 6432 0.04% 45 6898 0.05% 46 7308 0.05% 47 7814 0.05% 48 8214 0.05% 49 8725 0.06% 50 9085 0.06% 51 9501 0.06% 52 10169 0.07% 53 10735 0.07% 54 11420 0.08% 55 12085 0.08% 56 12772 0.09% 57 13848 0.09% 58 14877 0.10% 59 19051 0.13% 60 22945 0.15% 61 23905 0.16% 62 24754 0.17% 63 26231 0.18% 64 26847 0.18% 65 27608 0.18% 66 29125 0.19% 67 29891 0.20% 68 31383 0.21% 69 32351 0.22% 70 33832 0.23% 71 36167 0.24% 72 37302 0.25% 73 39314 0.26% 74 41195 0.28% 75 42582 0.29% 76 44096 0.30% 77 46586 0.31% 78 49170 0.33% 79 52650 0.35% 80 55445 0.37% 81 59016 0.40% 82 63875 0.43% 83 66853 0.45% 84 71112 0.48% 85 77282 0.52% 86 81625 0.55% 87 86059 0.58% 88 89207 0.60% 89 94628 0.63% 90 102871 0.69% 91 112248 0.75% 92 124545 0.83% 93 137297 0.92% 94 152502 1.02% 95 174606 1.17% 96 201302 1.35% 97 238056 1.59% 98 295523 1.98% 99 380479 2.55% 100 498878 3.34% 101 10841196 72.57% 14939221 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=113.24 fanout-score-rank=9 prefix-density=0.67 prefix-fanout=19.9 sequence=TCATCTTCATCAT criterion=fanout-score sequence-density=0.05 sequence-density-rank=25 fanout-score=632.10 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=32.6 sequence=TTCTTCTTCTCCT criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=279.04 fanout-score-rank=3 prefix-density=0.95 prefix-fanout=32.9 sequence=AAGAAGAAGAAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=20 fanout-score=373.37 fanout-score-rank=1 prefix-density=0.70 prefix-fanout=34.1 sequence=TGATGATGAAGA ERR1864474 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:17:52 Started mapping on | Feb 13 13:17:52 Finished on | Feb 13 13:19:01 Mapping speed, Million of reads per hour | 779.44 Number of input reads | 14939221 Average input read length | 194 UNIQUE READS: Uniquely mapped reads number | 13717323 Uniquely mapped reads % | 91.82% Average mapped length | 194.45 Number of splices: Total | 6839495 Number of splices: Annotated (sjdb) | 6633534 Number of splices: GT/AG | 6714057 Number of splices: GC/AG | 105031 Number of splices: AT/AC | 7449 Number of splices: Non-canonical | 12958 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 2.57 Insertion rate per base | 0.01% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 370384 % of reads mapped to multiple loci | 2.48% Number of reads mapped to too many loci | 90613 % of reads mapped to too many loci | 0.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.05% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 873073 873073 873073 N_multimapping 370384 370384 370384 N_noFeature 700686 13500356 842344 N_ambiguous 129202 758 53448 UnstrandedReadsAssigned:12887435 PositiveStrandReadsAssigned:216209 NegativeStrandReadsAssigned:12821531 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 ERR1864474 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864474-trimmed-pair1.fastq ERR1864474-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,939,221 reads, 13,045,836 reads pseudoaligned [quant] estimated average fragment length: 136.432 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,107 rounds 52401 ERR1864474.ke.tsv 34699 ERR1864474.se.tsv 87100 total ==> ERR1864474.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1882.57 1148 63.8145 Potri.005G024800.1.v4.1 1035 899.568 402 46.765 Potri.004G059700.1.v4.1 961 825.568 16 2.02813 Potri.007G009000.2.v4.1 1416 1280.57 0 0 Potri.003G141000.2.v4.1 2943 2807.57 405 15.0957 Potri.016G087400.1.v4.1 270 135.544 570 440.072 Potri.015G069301.1.v4.1 564 428.618 0 0 Potri.010G195200.1.v4.1 1773 1637.57 32 2.04493 Potri.012G127500.1.v4.1 977 841.568 1068 132.804 ==> ERR1864474.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 873 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 129 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 ERR1864474 completed mapping pipeline successfully