Starting /dee2/code/volunteer_pipeline.sh ERR1864475 current disk space = 3090679975936 free memory = 1449200844 ERR1864475 SRAfilesize 951dab60b8375d20cd99456027d719fa ERR1864475.sra ERR1864475.sra file validated ERR1864475 is paired end ERR1864475 is conventional basespace ERR1864475 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864475_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.95675 34.0 31.0 34.0 30.0 34.0 2 32.125 34.0 31.0 34.0 30.0 34.0 3 32.3985 34.0 31.0 34.0 30.0 34.0 4 35.82575 37.0 37.0 37.0 35.0 37.0 5 35.62125 37.0 35.0 37.0 35.0 37.0 6 35.5035 37.0 35.0 37.0 33.0 37.0 7 35.45575 37.0 35.0 37.0 33.0 37.0 8 35.48875 37.0 35.0 37.0 33.0 37.0 9 37.22975 39.0 38.0 39.0 34.0 39.0 10-11 37.132625 39.0 38.0 39.0 34.0 39.0 12-13 37.062625 39.0 37.0 39.0 34.0 39.0 14-15 38.5 41.0 38.5 41.0 34.0 41.0 16-17 38.469375 41.0 38.5 41.0 34.0 41.0 18-19 38.446124999999995 41.0 38.5 41.0 34.0 41.0 20-21 38.231375 40.5 38.5 41.0 33.5 41.0 22-23 38.14975 40.0 38.0 41.0 33.0 41.0 24-25 38.095749999999995 40.0 38.0 41.0 33.0 41.0 26-27 38.018625 40.0 38.0 41.0 33.0 41.0 28-29 38.047125 40.0 38.0 41.0 33.0 41.0 30-31 37.922 40.0 38.0 41.0 33.0 41.0 32-33 37.74825 40.0 38.0 41.0 33.0 41.0 34-35 37.6645 40.0 38.0 41.0 32.5 41.0 36-37 37.4615 40.0 38.0 41.0 31.5 41.0 38-39 37.291875000000005 40.0 38.0 41.0 31.5 41.0 40-41 37.174875 40.0 38.0 41.0 31.0 41.0 42-43 37.022625000000005 40.0 37.5 41.0 30.5 41.0 44-45 37.112 40.0 37.5 41.0 31.0 41.0 46-47 37.236374999999995 40.0 38.0 41.0 31.5 41.0 48-49 37.118375 40.0 37.5 41.0 31.0 41.0 50-51 36.97225 40.0 37.0 41.0 31.0 41.0 52-53 36.610749999999996 40.0 37.0 41.0 30.0 41.0 54-55 36.646249999999995 40.0 36.5 41.0 30.5 41.0 56-57 36.186375 39.5 36.0 41.0 29.0 41.0 58-59 35.955 39.0 35.5 41.0 29.0 41.0 60-61 35.782875000000004 39.0 35.0 41.0 28.5 41.0 62-63 35.611875 38.5 35.0 40.0 29.0 41.0 64-65 35.042500000000004 38.0 34.5 40.0 27.5 41.0 66-67 34.689750000000004 37.5 34.0 40.0 27.0 41.0 68-69 34.319125 37.0 34.0 39.5 26.0 41.0 70-71 33.940124999999995 36.0 34.0 39.0 26.0 40.5 72-73 33.454499999999996 36.0 33.5 39.0 26.0 40.0 74-75 33.1265 35.5 33.0 37.5 26.0 39.5 76-77 32.050875000000005 34.5 31.5 36.5 24.0 39.0 78-79 32.204625 35.0 32.5 36.5 25.0 39.0 80-81 32.04025 35.0 32.5 36.0 24.5 37.5 82-83 31.696625 35.0 32.5 36.0 24.5 37.0 84-85 31.353 35.0 32.0 35.0 22.5 37.0 86-87 31.0905 34.5 32.0 35.0 22.0 36.0 88-89 30.823999999999998 34.0 32.0 35.0 21.5 36.0 90-91 30.537 34.0 31.0 35.0 19.0 35.5 92-93 30.20325 34.0 31.0 35.0 15.5 35.0 94-95 29.900375 34.0 31.0 35.0 7.0 35.0 96-97 29.7725 34.0 31.0 35.0 4.5 35.0 98-99 29.5955 34.0 31.0 35.0 2.0 35.0 100-101 28.783250000000002 33.5 30.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 24.0 3 20.0 4 8.0 5 5.0 6 7.0 7 4.0 8 7.0 9 6.0 10 10.0 11 21.0 12 13.0 13 8.0 14 10.0 15 9.0 16 11.0 17 13.0 18 16.0 19 9.0 20 14.0 21 16.0 22 13.0 23 12.0 24 20.0 25 27.0 26 31.0 27 32.0 28 37.0 29 51.0 30 50.0 31 69.0 32 103.0 33 114.0 34 168.0 35 284.0 36 447.0 37 919.0 38 1244.0 39 148.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.914111983785155 5.953889029642767 8.006080567519636 49.12591841905245 2 23.925 8.425 34.0 33.650000000000006 3 23.45 11.3 23.7 41.55 4 28.175 18.65 20.474999999999998 32.7 5 27.6 23.599999999999998 25.35 23.45 6 21.825 29.15 25.650000000000002 23.375 7 16.025 23.674999999999997 43.45 16.85 8 18.475 23.825 35.075 22.625 9 17.599999999999998 21.975 38.85 21.575 10-11 18.9375 34.0625 27.437499999999996 19.5625 12-13 21.4875 26.687499999999996 29.6625 22.162499999999998 14-15 19.05 28.0875 30.099999999999998 22.7625 16-17 19.5125 28.4125 29.2875 22.787499999999998 18-19 20.05 28.4 27.9125 23.6375 20-21 19.875 28.575 28.4375 23.1125 22-23 20.525 27.237499999999997 29.0875 23.150000000000002 24-25 19.9125 28.349999999999998 28.575 23.1625 26-27 20.6625 28.499999999999996 28.1 22.7375 28-29 19.7375 28.499999999999996 28.125 23.6375 30-31 19.925 28.1375 27.950000000000003 23.9875 32-33 20.7125 27.05 28.775000000000002 23.4625 34-35 20.4875 27.8375 28.5625 23.1125 36-37 20.674999999999997 28.425 27.85 23.05 38-39 21.3625 27.5625 28.5875 22.4875 40-41 20.974999999999998 28.125 27.525 23.375 42-43 20.4125 28.1 28.237499999999997 23.25 44-45 20.175 27.975 28.449999999999996 23.400000000000002 46-47 20.7 28.075 27.9375 23.2875 48-49 20.175 28.1625 28.075 23.5875 50-51 20.1 28.65 27.987499999999997 23.2625 52-53 20.7875 28.9125 28.012500000000003 22.287499999999998 54-55 20.9375 27.6375 28.6875 22.7375 56-57 20.3 27.175 28.8375 23.6875 58-59 21.275 27.8375 28.025 22.8625 60-61 20.8625 27.925 28.237499999999997 22.975 62-63 20.849999999999998 28.000000000000004 28.5875 22.5625 64-65 20.667666916729182 27.44436109027257 28.75718929732433 23.13078269567392 66-67 21.025 28.349999999999998 28.275 22.35 68-69 20.31757939484871 28.119529882470616 29.394848712178046 22.168042010502624 70-71 20.577572196524567 28.116014501812725 28.091011376422053 23.215401925240656 72-73 21.315164395549445 27.628453556694588 27.87848481060132 23.177897237154642 74-75 20.142535633908476 27.806951737934483 28.28207051762941 23.768442110527634 76-77 20.527565945743216 27.82847855981998 27.50343792974122 24.14051756469559 78-79 21.3 27.0625 28.1625 23.474999999999998 80-81 20.3375 28.749999999999996 28.325 22.5875 82-83 21.337500000000002 27.975 28.199999999999996 22.4875 84-85 21.55 28.449999999999996 27.3125 22.6875 86-87 21.8 27.9375 27.3 22.9625 88-89 20.7375 28.575 27.775 22.912499999999998 90-91 21.05 28.212500000000002 27.2625 23.474999999999998 92-93 21.1625 28.799999999999997 27.3625 22.675 94-95 21.912499999999998 27.875 27.437499999999996 22.775000000000002 96-97 20.962500000000002 28.0875 27.975 22.975 98-99 21.349999999999998 28.0875 27.875 22.6875 100-101 21.7875 28.212500000000002 27.0875 22.912499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 1.5 24 4.0 25 4.0 26 3.5 27 5.0 28 10.0 29 14.5 30 16.5 31 25.0 32 30.5 33 36.5 34 53.0 35 70.5 36 86.5 37 113.5 38 136.0 39 160.0 40 188.5 41 226.5 42 260.0 43 250.0 44 244.5 45 253.5 46 262.0 47 242.0 48 205.5 49 186.5 50 160.0 51 131.5 52 112.5 53 105.0 54 82.5 55 57.0 56 50.0 57 42.0 58 38.0 59 31.5 60 23.0 61 16.5 62 9.5 63 8.0 64 8.0 65 8.5 66 7.5 67 4.0 68 1.5 69 2.0 70 1.5 71 1.0 72 1.0 73 0.5 74 0.5 75 0.0 76 1.0 77 1.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.025 66-67 0.0 68-69 0.025 70-71 0.0125 72-73 0.0125 74-75 0.025 76-77 0.0125 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34541792547836 98.65 2 0.6042296072507553 1.2 3 0.050352467270896276 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.32499999999999996 0.0 0.0 0.0 0.0 82-83 0.475 0.0 0.0 0.0 0.0 84-85 0.6375 0.0 0.0 0.0 0.0 86-87 0.7875 0.0 0.0 0.0 0.0 88-89 0.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864475 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864475_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.1285 34.0 31.0 34.0 30.0 34.0 2 32.27825 34.0 31.0 34.0 30.0 34.0 3 32.262 34.0 31.0 34.0 30.0 34.0 4 35.57325 37.0 37.0 37.0 33.0 37.0 5 35.54525 37.0 35.0 37.0 33.0 37.0 6 35.54975 37.0 36.0 37.0 33.0 37.0 7 35.54925 37.0 36.0 37.0 33.0 37.0 8 35.53575 37.0 36.0 37.0 33.0 37.0 9 37.1445 39.0 38.0 39.0 34.0 39.0 10-11 37.153125 39.0 38.0 39.0 34.0 39.0 12-13 37.004999999999995 39.0 38.0 39.0 33.5 39.0 14-15 38.427125000000004 41.0 38.5 41.0 34.0 41.0 16-17 38.3335 41.0 38.5 41.0 34.0 41.0 18-19 38.305375 41.0 38.5 41.0 33.0 41.0 20-21 38.331 40.0 38.0 41.0 34.0 41.0 22-23 38.241375000000005 40.0 38.0 41.0 34.0 41.0 24-25 38.15325 40.0 38.0 41.0 33.0 41.0 26-27 37.922375 40.0 38.0 41.0 33.0 41.0 28-29 37.911125 40.0 38.0 41.0 33.0 41.0 30-31 37.75975 40.0 38.0 41.0 32.5 41.0 32-33 37.581500000000005 40.0 38.0 41.0 32.0 41.0 34-35 37.58 40.0 38.0 41.0 32.0 41.0 36-37 37.491125 40.0 38.0 41.0 32.0 41.0 38-39 37.38775 40.0 38.0 41.0 31.0 41.0 40-41 37.073375 40.0 37.5 41.0 30.5 41.0 42-43 37.057375 40.0 37.0 41.0 30.0 41.0 44-45 36.834999999999994 40.0 37.0 41.0 30.0 41.0 46-47 36.70075 40.0 37.0 41.0 30.0 41.0 48-49 36.61825 40.0 37.0 41.0 30.0 41.0 50-51 36.4465 39.5 36.5 40.5 30.0 41.0 52-53 36.553375 39.5 37.0 40.5 30.5 41.0 54-55 36.728875 40.0 37.0 41.0 31.0 41.0 56-57 36.576125000000005 40.0 36.5 41.0 30.0 41.0 58-59 36.278875 39.0 36.0 41.0 29.0 41.0 60-61 35.948499999999996 39.0 35.0 41.0 28.0 41.0 62-63 35.795625 39.0 35.0 41.0 28.0 41.0 64-65 35.460625 38.5 35.0 40.0 28.0 41.0 66-67 35.118624999999994 37.5 35.0 40.0 28.5 41.0 68-69 34.653 37.0 34.5 39.5 27.5 41.0 70-71 34.274 36.5 34.0 39.0 27.0 41.0 72-73 33.842875 36.0 34.0 39.0 26.0 40.0 74-75 33.464125 35.5 34.0 37.5 26.0 39.5 76-77 32.882374999999996 35.0 33.5 37.0 25.0 39.0 78-79 32.47175 35.0 33.0 37.0 24.5 39.0 80-81 32.082625 35.0 33.0 36.0 25.0 37.5 82-83 31.73625 35.0 32.0 36.0 24.0 37.0 84-85 31.2625 35.0 32.0 35.0 21.5 36.5 86-87 30.938875 35.0 32.0 35.0 20.0 36.0 88-89 30.72925 35.0 32.0 35.0 19.0 36.0 90-91 30.458125000000003 34.5 31.0 35.0 18.5 36.0 92-93 30.191 34.0 31.0 35.0 13.5 35.0 94-95 29.957250000000002 34.0 31.0 35.0 7.0 35.0 96-97 29.51925 34.0 31.0 35.0 2.0 35.0 98-99 29.227625 34.0 30.0 35.0 2.0 35.0 100-101 28.33075 33.5 28.5 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 23.0 3 10.0 4 3.0 5 2.0 6 8.0 7 7.0 8 10.0 9 12.0 10 13.0 11 10.0 12 8.0 13 5.0 14 16.0 15 11.0 16 13.0 17 15.0 18 16.0 19 13.0 20 20.0 21 22.0 22 10.0 23 22.0 24 17.0 25 24.0 26 37.0 27 32.0 28 59.0 29 48.0 30 50.0 31 72.0 32 85.0 33 110.0 34 167.0 35 265.0 36 464.0 37 913.0 38 1184.0 39 204.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 27.625 18.825 15.8 37.75 2 25.624999999999996 23.3 34.150000000000006 16.925 3 19.45 28.225 30.599999999999998 21.725 4 21.85 33.5 24.175 20.474999999999998 5 23.974999999999998 34.925 24.55 16.55 6 19.225 38.45 23.825 18.5 7 18.725 21.85 38.725 20.7 8 21.275 24.75 30.725 23.25 9 21.45 23.849999999999998 30.95 23.75 10-11 23.150000000000002 32.3625 24.4 20.0875 12-13 23.125 25.7 27.800000000000004 23.375 14-15 22.5875 27.987499999999997 28.712500000000002 20.7125 16-17 22.6375 28.1875 27.675 21.5 18-19 22.6125 29.299999999999997 27.224999999999998 20.8625 20-21 23.150000000000002 28.275 27.487499999999997 21.087500000000002 22-23 22.2625 29.725 27.525 20.4875 24-25 21.8625 29.275000000000002 28.000000000000004 20.8625 26-27 23.0 27.725 28.175 21.099999999999998 28-29 23.125 28.3375 27.0125 21.525 30-31 23.0 28.299999999999997 27.950000000000003 20.75 32-33 22.4875 29.037499999999998 27.9125 20.5625 34-35 23.150000000000002 27.6125 28.475 20.7625 36-37 22.5875 28.249999999999996 28.375 20.7875 38-39 23.125 27.537499999999998 28.275 21.0625 40-41 23.4875 27.400000000000002 27.625 21.4875 42-43 22.4375 28.725 27.900000000000002 20.9375 44-45 21.575 28.9875 28.287499999999998 21.15 46-47 23.6875 29.037499999999998 26.7625 20.5125 48-49 22.0625 29.4125 28.000000000000004 20.525 50-51 22.7625 28.5625 27.025 21.65 52-53 23.400000000000002 28.125 27.575 20.9 54-55 23.05 28.712500000000002 28.299999999999997 19.9375 56-57 22.900000000000002 28.449999999999996 28.512500000000003 20.1375 58-59 22.7375 27.8125 28.025 21.425 60-61 23.0125 28.849999999999998 27.4125 20.724999999999998 62-63 22.5 28.325 28.7 20.474999999999998 64-65 22.9625 28.9875 27.200000000000003 20.849999999999998 66-67 23.75 27.474999999999998 27.224999999999998 21.55 68-69 23.1 28.487499999999997 27.987499999999997 20.424999999999997 70-71 23.825 27.650000000000002 27.675 20.849999999999998 72-73 22.5875 28.1375 27.975 21.3 74-75 23.0375 27.8625 28.15 20.95 76-77 23.200000000000003 26.924999999999997 28.175 21.7 78-79 22.8 27.650000000000002 28.025 21.525 80-81 24.05 27.962500000000002 27.375 20.6125 82-83 22.975 28.95 27.224999999999998 20.849999999999998 84-85 22.7125 28.525 28.5875 20.175 86-87 22.725 28.125 27.750000000000004 21.4 88-89 23.0375 28.3875 28.1125 20.4625 90-91 24.0375 28.4375 27.400000000000002 20.125 92-93 23.7 27.287499999999998 27.800000000000004 21.212500000000002 94-95 24.3625 27.800000000000004 27.3875 20.45 96-97 22.8375 28.7375 28.8875 19.537499999999998 98-99 24.212500000000002 28.15 26.575 21.0625 100-101 23.8625 28.5875 27.200000000000003 20.349999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 2.0 21 1.5 22 0.5 23 0.5 24 0.0 25 2.5 26 4.5 27 6.5 28 11.5 29 20.0 30 22.5 31 26.5 32 35.0 33 42.5 34 54.5 35 69.0 36 97.5 37 125.5 38 151.5 39 181.0 40 207.5 41 225.0 42 250.0 43 271.5 44 270.0 45 266.0 46 260.5 47 235.0 48 198.0 49 163.5 50 146.0 51 129.0 52 96.5 53 78.5 54 65.0 55 52.0 56 46.5 57 40.5 58 33.0 59 25.5 60 17.5 61 16.0 62 13.0 63 11.0 64 8.5 65 6.0 66 5.0 67 2.5 68 1.5 69 1.5 70 1.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84973703981969 99.675 2 0.12521913348359628 0.25 3 0.025043826696719257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.30000000000000004 0.0 0.0 0.0 0.0 82-83 0.44999999999999996 0.0 0.0 0.0 0.0 84-85 0.5875 0.0 0.0 0.0 0.0 86-87 0.7375 0.0 0.0 0.0 0.0 88-89 0.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 700843 spots for ERR1864475.sra Written 700843 spots for ERR1864475.sra Read 700843 spots for ERR1864475.sra Written 700843 spots for ERR1864475.sra Read 700843 spots for ERR1864475.sra Written 700843 spots for ERR1864475.sra Read 700843 spots for ERR1864475.sra Written 700843 spots for ERR1864475.sra Read 700843 spots for ERR1864475.sra Written 700843 spots for ERR1864475.sra Read 700843 spots for ERR1864475.sra Written 700843 spots for ERR1864475.sra Read 700843 spots for ERR1864475.sra Written 700843 spots for ERR1864475.sra Read 700843 spots for ERR1864475.sra Written 700843 spots for ERR1864475.sra Read 700843 spots for ERR1864475.sra Written 700843 spots for ERR1864475.sra Read 700843 spots for ERR1864475.sra Written 700843 spots for ERR1864475.sra Read 700845 spots for ERR1864475.sra Written 700845 spots for ERR1864475.sra Read 700843 spots for ERR1864475.sra Written 700843 spots for ERR1864475.sra Read 700843 spots for ERR1864475.sra Written 700843 spots for ERR1864475.sra Read 700843 spots for ERR1864475.sra Written 700843 spots for ERR1864475.sra Read 700843 spots for ERR1864475.sra Written 700843 spots for ERR1864475.sra Read 700843 spots for ERR1864475.sra Written 700843 spots for ERR1864475.sra Read 700843 spots for ERR1864475.sra Written 700843 spots for ERR1864475.sra Read 700843 spots for ERR1864475.sra Written 700843 spots for ERR1864475.sra Read 700843 spots for ERR1864475.sra Written 700843 spots for ERR1864475.sra Read 700843 spots for ERR1864475.sra Written 700843 spots for ERR1864475.sra SRR ids: ['ERR1864475.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_89iz1v_0 ERR1864475.sra spots: 14016862 blocks: [[1, 700843], [700844, 1401686], [1401687, 2102529], [2102530, 2803372], [2803373, 3504215], [3504216, 4205058], [4205059, 4905901], [4905902, 5606744], [5606745, 6307587], [6307588, 7008430], [7008431, 7709273], [7709274, 8410116], [8410117, 9110959], [9110960, 9811802], [9811803, 10512645], [10512646, 11213488], [11213489, 11914331], [11914332, 12615174], [12615175, 13316017], [13316018, 14016862]] ERR1864475 file size 3359320 ERR1864475 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864475 ERR1864475_1.fastq ERR1864475_2.fastq Input file: ERR1864475_1.fastq Paired file: ERR1864475_2.fastq trimmed: ERR1864475-trimmed-pair1.fastq, ERR1864475-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:38:17 2025 >> started Thu Feb 13 13:38:30 2025 >> done (12.564s) 14016862 read pairs processed; of these: 198485 ( 1.42%) short read pairs filtered out after trimming by size control 200456 ( 1.43%) empty read pairs filtered out after trimming by size control 13617921 (97.15%) read pairs available; of these: 3120611 (22.92%) trimmed read pairs available after processing 10497310 (77.08%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 100 0.00% 19 238 0.00% 20 336 0.00% 21 479 0.00% 22 564 0.00% 23 668 0.00% 24 854 0.01% 25 1047 0.01% 26 1167 0.01% 27 1412 0.01% 28 1627 0.01% 29 1847 0.01% 30 2085 0.02% 31 2344 0.02% 32 2685 0.02% 33 3001 0.02% 34 3265 0.02% 35 3489 0.03% 36 3777 0.03% 37 4014 0.03% 38 4325 0.03% 39 4671 0.03% 40 5002 0.04% 41 5363 0.04% 42 5585 0.04% 43 5883 0.04% 44 6274 0.05% 45 6661 0.05% 46 7003 0.05% 47 7209 0.05% 48 7463 0.05% 49 7935 0.06% 50 8218 0.06% 51 8645 0.06% 52 9158 0.07% 53 9598 0.07% 54 9943 0.07% 55 10392 0.08% 56 10994 0.08% 57 11852 0.09% 58 12474 0.09% 59 15867 0.12% 60 19032 0.14% 61 19627 0.14% 62 20222 0.15% 63 21095 0.15% 64 21419 0.16% 65 22411 0.16% 66 23303 0.17% 67 24099 0.18% 68 25199 0.19% 69 25950 0.19% 70 26738 0.20% 71 28266 0.21% 72 29405 0.22% 73 30494 0.22% 74 31376 0.23% 75 32522 0.24% 76 32733 0.24% 77 34688 0.25% 78 36500 0.27% 79 38485 0.28% 80 40618 0.30% 81 42673 0.31% 82 45508 0.33% 83 46615 0.34% 84 49069 0.36% 85 52257 0.38% 86 55328 0.41% 87 58345 0.43% 88 59523 0.44% 89 64199 0.47% 90 70574 0.52% 91 77489 0.57% 92 86286 0.63% 93 95740 0.70% 94 107946 0.79% 95 125080 0.92% 96 147722 1.08% 97 179396 1.32% 98 232123 1.70% 99 309939 2.28% 100 415103 3.05% 101 10497310 77.08% 13617921 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=7.72 fanout-score-rank=22 prefix-density=0.22 prefix-fanout=3.6 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.06 sequence-density-rank=13 fanout-score=376.51 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=32.1 sequence=TTCTTCTTCTTT criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=5.33 fanout-score-rank=26 prefix-density=0.15 prefix-fanout=3.0 sequence=AAGACCATCACCCTTGAGGTGGAAAGCTC criterion=fanout-score sequence-density=0.05 sequence-density-rank=21 fanout-score=500.56 fanout-score-rank=1 prefix-density=0.70 prefix-fanout=34.7 sequence=AAGAAGAAGAGAA ERR1864475 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:39:03 Started mapping on | Feb 13 13:39:03 Finished on | Feb 13 13:39:38 Mapping speed, Million of reads per hour | 1400.70 Number of input reads | 13617921 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 13143492 Uniquely mapped reads % | 96.52% Average mapped length | 195.58 Number of splices: Total | 7022569 Number of splices: Annotated (sjdb) | 6810953 Number of splices: GT/AG | 6900206 Number of splices: GC/AG | 101055 Number of splices: AT/AC | 9841 Number of splices: Non-canonical | 11467 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 2.33 Insertion rate per base | 0.01% Insertion average length | 2.01 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 298678 % of reads mapped to multiple loci | 2.19% Number of reads mapped to too many loci | 99563 % of reads mapped to too many loci | 0.73% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.50% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 194256 194256 194256 N_multimapping 298678 298678 298678 N_noFeature 691155 12998206 776572 N_ambiguous 112939 632 52701 UnstrandedReadsAssigned:12339398 PositiveStrandReadsAssigned:144654 NegativeStrandReadsAssigned:12314219 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864475 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864475-trimmed-pair1.fastq ERR1864475-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,617,921 reads, 12,484,437 reads pseudoaligned [quant] estimated average fragment length: 156.91 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,307 rounds 52401 ERR1864475.ke.tsv 34699 ERR1864475.se.tsv 87100 total ==> ERR1864475.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1862.09 1205 66.9353 Potri.005G024800.1.v4.1 1035 879.09 384 45.1822 Potri.004G059700.1.v4.1 961 805.09 19 2.44106 Potri.007G009000.2.v4.1 1416 1260.09 0 0 Potri.003G141000.2.v4.1 2943 2787.09 515 19.1128 Potri.016G087400.1.v4.1 270 118.65 1158.05 1009.55 Potri.015G069301.1.v4.1 564 408.163 0 0 Potri.010G195200.1.v4.1 1773 1617.09 53 3.39009 Potri.012G127500.1.v4.1 977 821.09 1273 160.364 ==> ERR1864475.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1040 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 155 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 ERR1864475 completed mapping pipeline successfully