Starting /dee2/code/volunteer_pipeline.sh ERR1864476 current disk space = 3090335289344 free memory = 1498413656 ERR1864476 SRAfilesize ec0262f153690ef434bb24df1d4e749d ERR1864476.sra ERR1864476.sra file validated ERR1864476 is paired end ERR1864476 is conventional basespace ERR1864476 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864476_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.1085 34.0 31.0 34.0 30.0 34.0 2 32.23375 34.0 31.0 34.0 30.0 34.0 3 32.42825 34.0 31.0 34.0 30.0 34.0 4 35.85475 37.0 37.0 37.0 35.0 37.0 5 35.6465 37.0 35.0 37.0 35.0 37.0 6 35.63125 37.0 35.0 37.0 35.0 37.0 7 35.52175 37.0 35.0 37.0 35.0 37.0 8 35.55075 37.0 35.0 37.0 33.0 37.0 9 37.216 39.0 38.0 39.0 35.0 39.0 10-11 37.168125 39.0 38.0 39.0 34.0 39.0 12-13 37.120374999999996 39.0 37.5 39.0 34.0 39.0 14-15 38.5045 41.0 38.5 41.0 34.0 41.0 16-17 38.502375 41.0 38.5 41.0 34.5 41.0 18-19 38.405 41.0 38.5 41.0 34.0 41.0 20-21 38.386375 40.5 38.5 41.0 34.0 41.0 22-23 38.229625 40.0 38.0 41.0 33.5 41.0 24-25 38.204375 40.0 38.0 41.0 33.5 41.0 26-27 38.079125000000005 40.0 38.0 41.0 33.5 41.0 28-29 37.9645 40.0 38.0 41.0 33.0 41.0 30-31 37.878249999999994 40.0 38.0 41.0 33.5 41.0 32-33 37.718625 40.0 38.0 41.0 33.0 41.0 34-35 37.64875 40.0 38.0 41.0 32.5 41.0 36-37 37.41775 40.0 38.0 41.0 32.0 41.0 38-39 37.18325 40.0 37.5 41.0 31.0 41.0 40-41 37.189 40.0 37.0 41.0 31.5 41.0 42-43 36.8995 40.0 37.0 41.0 30.5 41.0 44-45 37.018625 40.0 37.0 41.0 31.0 41.0 46-47 37.1545 40.0 37.5 41.0 32.0 41.0 48-49 37.08175 40.0 37.0 41.0 31.0 41.0 50-51 36.73625 40.0 37.0 41.0 30.0 41.0 52-53 36.49025 40.0 36.0 41.0 30.0 41.0 54-55 36.5145 40.0 36.0 41.0 30.0 41.0 56-57 36.192625 39.0 35.0 41.0 29.0 41.0 58-59 35.970875 39.0 35.0 41.0 28.5 41.0 60-61 35.73625 39.0 35.0 40.5 28.5 41.0 62-63 35.331625 38.0 35.0 40.0 28.0 41.0 64-65 34.963 38.0 34.0 40.0 27.5 41.0 66-67 34.660125 37.0 34.0 40.0 26.5 41.0 68-69 34.194 37.0 34.0 39.0 26.0 41.0 70-71 33.788375 36.0 34.0 39.0 26.0 40.5 72-73 33.325 36.0 33.0 38.5 25.5 40.0 74-75 33.099000000000004 35.0 33.0 37.5 26.0 39.5 76-77 32.137125 34.5 31.5 36.5 25.0 39.0 78-79 32.257875 35.0 32.0 36.5 25.5 39.0 80-81 31.96025 35.0 32.0 36.0 25.0 37.0 82-83 31.680500000000002 35.0 32.0 36.0 24.5 37.0 84-85 31.397 35.0 32.0 35.0 24.0 36.5 86-87 31.177875 34.0 32.0 35.0 24.0 36.0 88-89 30.825875 34.0 31.5 35.0 21.0 36.0 90-91 30.460749999999997 34.0 31.0 35.0 19.5 35.0 92-93 30.1255 34.0 31.0 35.0 17.5 35.0 94-95 29.917 34.0 31.0 35.0 14.5 35.0 96-97 29.654874999999997 34.0 31.0 35.0 4.5 35.0 98-99 29.506 34.0 31.0 35.0 2.0 35.0 100-101 28.67375 33.5 29.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 27.0 3 19.0 4 6.0 5 8.0 6 3.0 7 11.0 8 9.0 9 6.0 10 9.0 11 7.0 12 8.0 13 6.0 14 8.0 15 10.0 16 16.0 17 10.0 18 11.0 19 12.0 20 11.0 21 18.0 22 17.0 23 24.0 24 21.0 25 20.0 26 28.0 27 33.0 28 30.0 29 56.0 30 68.0 31 77.0 32 102.0 33 126.0 34 182.0 35 281.0 36 471.0 37 920.0 38 1201.0 39 128.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.693548387096776 6.37600806451613 7.68649193548387 49.243951612903224 2 23.95 8.975 34.225 32.85 3 23.536768384192097 11.705852926463232 21.935967983991997 42.821410705352676 4 27.3 19.075 21.5 32.125 5 26.325 26.474999999999998 24.125 23.075000000000003 6 21.925 29.349999999999998 25.724999999999998 23.0 7 15.725 23.175 42.699999999999996 18.4 8 18.75 23.95 34.775 22.525000000000002 9 18.224999999999998 22.7 36.3 22.775000000000002 10-11 18.9375 33.1125 28.000000000000004 19.950000000000003 12-13 20.775 26.087500000000002 30.4625 22.675 14-15 21.0625 27.925 29.0875 21.925 16-17 20.4375 28.962500000000002 27.187499999999996 23.4125 18-19 19.6875 29.375 27.8125 23.125 20-21 20.575 27.900000000000002 28.037499999999998 23.4875 22-23 19.3875 28.775000000000002 28.1625 23.674999999999997 24-25 20.549999999999997 27.500000000000004 28.15 23.799999999999997 26-27 21.175 27.6625 28.1125 23.05 28-29 20.7625 28.1875 28.249999999999996 22.8 30-31 20.1375 27.975 28.812500000000004 23.075000000000003 32-33 20.849999999999998 27.6625 27.787499999999998 23.7 34-35 20.8 27.462500000000002 27.737499999999997 24.0 36-37 20.3625 28.037499999999998 27.787499999999998 23.8125 38-39 20.8875 28.262500000000003 27.0875 23.7625 40-41 20.125 28.9 27.787499999999998 23.1875 42-43 20.025000000000002 27.450000000000003 28.675 23.849999999999998 44-45 21.5375 26.237500000000004 28.962500000000002 23.2625 46-47 21.0625 28.0625 27.537499999999998 23.3375 48-49 21.1375 28.1375 27.425 23.3 50-51 20.724999999999998 26.75 28.425 24.099999999999998 52-53 21.3625 27.5625 27.6375 23.4375 54-55 20.0 28.462500000000002 27.400000000000002 24.1375 56-57 20.6375 27.987499999999997 27.3 24.075 58-59 21.224999999999998 28.1125 27.6125 23.05 60-61 20.5125 27.1125 28.787499999999998 23.5875 62-63 21.325 28.287499999999998 26.937499999999996 23.45 64-65 21.087500000000002 28.462500000000002 27.6375 22.8125 66-67 20.775 27.725 27.150000000000002 24.349999999999998 68-69 19.975 27.5125 29.125 23.3875 70-71 20.7125 28.1625 27.675 23.45 72-73 21.075 28.0625 27.85 23.0125 74-75 21.6625 27.8375 27.675 22.825 76-77 21.224999999999998 27.625 26.900000000000002 24.25 78-79 21.5625 27.750000000000004 27.150000000000002 23.5375 80-81 21.3 27.35 27.537499999999998 23.8125 82-83 22.1 26.4625 28.175 23.2625 84-85 21.4 28.0625 26.787499999999998 23.75 86-87 20.7375 27.975 27.775 23.5125 88-89 20.95 27.537499999999998 27.925 23.5875 90-91 21.55 27.787499999999998 27.537499999999998 23.125 92-93 21.425 27.975 27.6 23.0 94-95 21.2 28.7375 27.3875 22.675 96-97 21.4875 27.8125 27.6375 23.0625 98-99 21.5625 28.025 27.474999999999998 22.9375 100-101 22.1875 27.700000000000003 27.224999999999998 22.8875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.0 24 1.5 25 3.5 26 4.0 27 3.5 28 4.5 29 7.0 30 16.0 31 29.0 32 33.0 33 35.5 34 43.5 35 58.5 36 81.5 37 96.5 38 116.0 39 151.0 40 183.0 41 219.5 42 241.0 43 248.0 44 267.0 45 262.0 46 246.0 47 259.0 48 244.0 49 194.5 50 158.5 51 137.0 52 119.0 53 95.5 54 76.5 55 59.0 56 49.5 57 42.0 58 32.0 59 30.0 60 32.5 61 29.0 62 18.0 63 10.0 64 7.5 65 10.5 66 11.5 67 8.5 68 4.5 69 1.0 70 2.0 71 2.5 72 2.0 73 2.0 74 2.0 75 2.5 76 1.5 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8 2 0.0 3 0.05 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.575 #Duplication Level Percentage of deduplicated Percentage of total 1 98.96018260207964 97.55 2 0.8622875982754248 1.7000000000000002 3 0.10144559979710879 0.3 4 0.025361399949277198 0.1 5 0.025361399949277198 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025361399949277198 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGA 9 0.22499999999999998 No Hit CGGCAATCGGACGGCGGGCGCACGCGTCGCATCTAGCCCGGATTCTGACT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.2125 0.0 0.0 0.0 0.0 76-77 0.42500000000000004 0.0 0.0 0.0 0.0 78-79 0.575 0.0 0.0 0.0 0.0 80-81 0.7250000000000001 0.0 0.0 0.0 0.0 82-83 0.85 0.0 0.0 0.0 0.0 84-85 1.0375 0.0 0.0 0.0 0.0 86-87 1.2374999999999998 0.0 0.0 0.0 0.0 88-89 1.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864476 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864476_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2175 34.0 31.0 34.0 30.0 34.0 2 32.3985 34.0 31.0 34.0 31.0 34.0 3 32.31975 34.0 31.0 34.0 30.0 34.0 4 35.708 37.0 37.0 37.0 35.0 37.0 5 35.69075 37.0 37.0 37.0 35.0 37.0 6 35.6315 37.0 37.0 37.0 35.0 37.0 7 35.591 37.0 36.0 37.0 33.0 37.0 8 35.6245 37.0 36.0 37.0 33.0 37.0 9 37.2315 39.0 38.0 39.0 34.0 39.0 10-11 37.231375 39.0 38.0 39.0 34.0 39.0 12-13 37.110625 39.0 37.0 39.0 33.5 39.0 14-15 38.580875000000006 41.0 38.0 41.0 34.0 41.0 16-17 38.5135 41.0 38.5 41.0 34.0 41.0 18-19 38.391875 40.5 38.0 41.0 33.5 41.0 20-21 38.397125 40.0 38.5 41.0 34.0 41.0 22-23 38.295 40.0 38.0 41.0 33.5 41.0 24-25 38.236000000000004 40.0 38.0 41.0 34.0 41.0 26-27 37.9975 40.0 38.0 41.0 32.5 41.0 28-29 37.908500000000004 40.0 38.0 41.0 33.0 41.0 30-31 37.820875 40.0 38.0 41.0 32.5 41.0 32-33 37.650999999999996 40.0 38.0 41.0 31.5 41.0 34-35 37.639875 40.0 38.0 41.0 32.5 41.0 36-37 37.53975 40.0 38.0 41.0 32.0 41.0 38-39 37.444625 40.0 38.0 41.0 31.5 41.0 40-41 37.2505 40.0 37.5 41.0 31.0 41.0 42-43 37.074124999999995 40.0 37.0 41.0 30.0 41.0 44-45 36.95825 40.0 37.0 41.0 30.5 41.0 46-47 36.744125 40.0 36.5 41.0 30.0 41.0 48-49 36.57275 40.0 36.0 41.0 30.0 41.0 50-51 36.325874999999996 39.5 36.0 40.5 30.0 41.0 52-53 36.495875 39.0 36.0 40.5 30.0 41.0 54-55 36.714124999999996 40.0 36.0 41.0 30.0 41.0 56-57 36.647875 40.0 36.0 41.0 30.0 41.0 58-59 36.17725 39.0 35.0 41.0 28.5 41.0 60-61 35.923249999999996 39.0 35.0 41.0 28.0 41.0 62-63 35.683125000000004 39.0 35.0 41.0 28.0 41.0 64-65 35.381 38.0 35.0 40.0 28.0 41.0 66-67 35.011875 37.5 34.5 40.0 27.5 41.0 68-69 34.52675 37.0 34.0 39.5 26.5 41.0 70-71 34.176625 36.5 34.0 39.0 26.0 41.0 72-73 33.68075 36.0 34.0 39.0 26.0 40.0 74-75 33.286249999999995 35.5 33.5 37.5 26.0 39.5 76-77 32.861374999999995 35.0 33.0 37.0 26.0 39.0 78-79 32.402625 35.0 33.0 36.5 24.5 39.0 80-81 31.94625 35.0 32.0 36.0 24.0 37.0 82-83 31.638624999999998 35.0 32.0 36.0 24.0 37.0 84-85 31.222625 35.0 32.0 35.0 21.5 36.5 86-87 30.884625 35.0 31.5 35.0 20.0 36.0 88-89 30.584625 34.5 31.0 35.0 18.5 36.0 90-91 30.35575 34.0 31.0 35.0 18.0 36.0 92-93 30.17425 34.0 31.0 35.0 13.5 35.0 94-95 29.81675 34.0 31.0 35.0 7.0 35.0 96-97 29.4345 34.0 30.0 35.0 2.0 35.0 98-99 29.081249999999997 34.0 30.0 35.0 2.0 35.0 100-101 28.169125 33.5 28.5 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 4.0 4 4.0 5 4.0 6 4.0 7 7.0 8 7.0 9 7.0 10 12.0 11 8.0 12 7.0 13 11.0 14 14.0 15 17.0 16 9.0 17 15.0 18 12.0 19 16.0 20 15.0 21 13.0 22 24.0 23 20.0 24 27.0 25 20.0 26 42.0 27 33.0 28 57.0 29 61.0 30 63.0 31 83.0 32 94.0 33 131.0 34 166.0 35 284.0 36 460.0 37 891.0 38 1162.0 39 175.0 40 1.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.599999999999998 17.299999999999997 15.6 38.5 2 24.775 23.150000000000002 35.375 16.7 3 19.2 26.0 31.474999999999998 23.325000000000003 4 23.200000000000003 32.525 24.525 19.75 5 26.474999999999998 33.650000000000006 23.025000000000002 16.85 6 19.275000000000002 37.974999999999994 24.5 18.25 7 20.1 20.95 38.074999999999996 20.875 8 20.474999999999998 26.0 30.375000000000004 23.150000000000002 9 22.25 23.200000000000003 32.025 22.525000000000002 10-11 22.5 31.674999999999997 24.5375 21.2875 12-13 23.4375 25.7375 26.974999999999998 23.849999999999998 14-15 22.075 28.375 28.199999999999996 21.349999999999998 16-17 23.75 28.3625 27.474999999999998 20.4125 18-19 23.150000000000002 27.9375 27.8125 21.099999999999998 20-21 23.175 28.65 26.875 21.3 22-23 23.7875 28.599999999999998 27.650000000000002 19.9625 24-25 22.975 28.95 26.7125 21.3625 26-27 23.599999999999998 29.1375 26.424999999999997 20.837500000000002 28-29 24.275 28.1375 27.5125 20.075000000000003 30-31 23.150000000000002 28.512500000000003 26.900000000000002 21.4375 32-33 23.025000000000002 28.499999999999996 27.1125 21.3625 34-35 22.662499999999998 28.1125 27.825 21.4 36-37 23.2625 28.65 27.650000000000002 20.4375 38-39 23.175 28.275 27.150000000000002 21.4 40-41 23.974999999999998 27.5125 27.0875 21.425 42-43 23.75 27.725 26.887499999999996 21.637500000000003 44-45 23.3875 28.475 26.937499999999996 21.2 46-47 23.549999999999997 27.287499999999998 28.6625 20.5 48-49 23.6125 28.075 27.4125 20.9 50-51 23.200000000000003 27.5875 27.975 21.2375 52-53 23.25 27.375 27.537499999999998 21.837500000000002 54-55 23.0 28.4 27.5125 21.087500000000002 56-57 22.325 28.525 27.9375 21.212500000000002 58-59 23.7875 28.3125 27.275 20.625 60-61 24.3125 27.6 27.0125 21.075 62-63 22.8 28.050000000000004 28.125 21.025 64-65 23.1875 27.237499999999997 28.3125 21.2625 66-67 23.0125 27.825 27.8375 21.325 68-69 23.575 28.037499999999998 27.287499999999998 21.099999999999998 70-71 24.3875 28.1375 26.8625 20.6125 72-73 23.575 27.987499999999997 27.9125 20.525 74-75 23.0875 27.6 28.487499999999997 20.825 76-77 23.5875 27.650000000000002 27.5125 21.25 78-79 22.55 27.825 28.799999999999997 20.825 80-81 23.7375 28.3125 27.0875 20.8625 82-83 23.5 27.3375 28.525 20.6375 84-85 23.5125 27.5625 27.0625 21.8625 86-87 23.625 28.512500000000003 26.387500000000003 21.475 88-89 24.3875 27.5125 26.9125 21.1875 90-91 23.8125 28.1625 27.6375 20.3875 92-93 24.2625 28.249999999999996 27.025 20.4625 94-95 23.974999999999998 28.075 27.125 20.825 96-97 23.825 27.925 27.474999999999998 20.775 98-99 24.575 28.262500000000003 26.4125 20.75 100-101 25.0 28.3875 26.0625 20.549999999999997 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 2.5 24 3.5 25 3.0 26 5.5 27 6.5 28 7.5 29 11.5 30 20.5 31 23.0 32 28.0 33 40.0 34 51.5 35 66.5 36 86.0 37 115.0 38 134.5 39 152.5 40 188.0 41 230.0 42 263.0 43 265.0 44 264.5 45 270.5 46 251.5 47 230.5 48 210.0 49 195.0 50 157.5 51 115.5 52 109.0 53 90.5 54 67.5 55 57.0 56 42.5 57 35.5 58 34.5 59 24.0 60 19.5 61 22.0 62 18.0 63 12.0 64 9.5 65 7.5 66 7.0 67 5.0 68 4.5 69 5.5 70 3.0 71 2.5 72 2.5 73 4.5 74 4.0 75 2.0 76 1.5 77 2.0 78 2.5 79 1.0 80 0.5 81 0.5 82 0.5 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.23750000000000002 0.0 0.0 0.0 0.0 76-77 0.45 0.0 0.0 0.0 0.0 78-79 0.5874999999999999 0.0 0.0 0.0 0.0 80-81 0.75 0.0 0.0 0.0 0.0 82-83 0.875 0.0 0.0 0.0 0.0 84-85 1.0625 0.0 0.0 0.0 0.0 86-87 1.2875 0.0 0.0 0.0 0.0 88-89 1.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 684555 spots for ERR1864476.sra Written 684555 spots for ERR1864476.sra Read 684555 spots for ERR1864476.sra Written 684555 spots for ERR1864476.sra Read 684555 spots for ERR1864476.sra Written 684555 spots for ERR1864476.sra Read 684555 spots for ERR1864476.sra Written 684555 spots for ERR1864476.sra Read 684555 spots for ERR1864476.sra Written 684555 spots for ERR1864476.sra Read 684555 spots for ERR1864476.sra Written 684555 spots for ERR1864476.sra Read 684555 spots for ERR1864476.sra Written 684555 spots for ERR1864476.sra Read 684555 spots for ERR1864476.sra Written 684555 spots for ERR1864476.sra Read 684565 spots for ERR1864476.sra Written 684565 spots for ERR1864476.sra Read 684555 spots for ERR1864476.sra Written 684555 spots for ERR1864476.sra Read 684555 spots for ERR1864476.sra Written 684555 spots for ERR1864476.sra Read 684555 spots for ERR1864476.sra Written 684555 spots for ERR1864476.sra Read 684555 spots for ERR1864476.sra Written 684555 spots for ERR1864476.sra Read 684555 spots for ERR1864476.sra Written 684555 spots for ERR1864476.sra Read 684555 spots for ERR1864476.sra Written 684555 spots for ERR1864476.sra Read 684555 spots for ERR1864476.sra Written 684555 spots for ERR1864476.sra Read 684555 spots for ERR1864476.sra Written 684555 spots for ERR1864476.sra Read 684555 spots for ERR1864476.sra Written 684555 spots for ERR1864476.sra Read 684555 spots for ERR1864476.sra Written 684555 spots for ERR1864476.sra Read 684555 spots for ERR1864476.sra Written 684555 spots for ERR1864476.sra SRR ids: ['ERR1864476.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__2r7kl_y ERR1864476.sra spots: 13691110 blocks: [[1, 684555], [684556, 1369110], [1369111, 2053665], [2053666, 2738220], [2738221, 3422775], [3422776, 4107330], [4107331, 4791885], [4791886, 5476440], [5476441, 6160995], [6160996, 6845550], [6845551, 7530105], [7530106, 8214660], [8214661, 8899215], [8899216, 9583770], [9583771, 10268325], [10268326, 10952880], [10952881, 11637435], [11637436, 12321990], [12321991, 13006545], [13006546, 13691110]] ERR1864476 file size 3280745 ERR1864476 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864476 ERR1864476_1.fastq ERR1864476_2.fastq Input file: ERR1864476_1.fastq Paired file: ERR1864476_2.fastq trimmed: ERR1864476-trimmed-pair1.fastq, ERR1864476-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:52:49 2025 >> started Thu Feb 13 13:53:08 2025 >> done (18.353s) 13691110 read pairs processed; of these: 203663 ( 1.49%) short read pairs filtered out after trimming by size control 191661 ( 1.40%) empty read pairs filtered out after trimming by size control 13295786 (97.11%) read pairs available; of these: 3161810 (23.78%) trimmed read pairs available after processing 10133976 (76.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 107 0.00% 19 254 0.00% 20 354 0.00% 21 479 0.00% 22 632 0.00% 23 810 0.01% 24 957 0.01% 25 1206 0.01% 26 1374 0.01% 27 1576 0.01% 28 1796 0.01% 29 2013 0.02% 30 2384 0.02% 31 2599 0.02% 32 3002 0.02% 33 3374 0.03% 34 3611 0.03% 35 3929 0.03% 36 4233 0.03% 37 4535 0.03% 38 4752 0.04% 39 5225 0.04% 40 5388 0.04% 41 5931 0.04% 42 6188 0.05% 43 6370 0.05% 44 6777 0.05% 45 7174 0.05% 46 7347 0.06% 47 7682 0.06% 48 8076 0.06% 49 8599 0.06% 50 8990 0.07% 51 9401 0.07% 52 9901 0.07% 53 10233 0.08% 54 10677 0.08% 55 11197 0.08% 56 11729 0.09% 57 12257 0.09% 58 13037 0.10% 59 16403 0.12% 60 19862 0.15% 61 20262 0.15% 62 21420 0.16% 63 22361 0.17% 64 22384 0.17% 65 23410 0.18% 66 24541 0.18% 67 25013 0.19% 68 25852 0.19% 69 27087 0.20% 70 27556 0.21% 71 29041 0.22% 72 30274 0.23% 73 30663 0.23% 74 32515 0.24% 75 32923 0.25% 76 33565 0.25% 77 35366 0.27% 78 37091 0.28% 79 39458 0.30% 80 41864 0.31% 81 43337 0.33% 82 46820 0.35% 83 47437 0.36% 84 50232 0.38% 85 53405 0.40% 86 55664 0.42% 87 59022 0.44% 88 60617 0.46% 89 64703 0.49% 90 70823 0.53% 91 78312 0.59% 92 86534 0.65% 93 95592 0.72% 94 108096 0.81% 95 125504 0.94% 96 148150 1.11% 97 180407 1.36% 98 231665 1.74% 99 309373 2.33% 100 411050 3.09% 101 10133976 76.22% 13295786 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=7.41 fanout-score-rank=22 prefix-density=0.22 prefix-fanout=3.6 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.05 sequence-density-rank=12 fanout-score=371.21 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=30.6 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=5.22 fanout-score-rank=22 prefix-density=0.14 prefix-fanout=3.2 sequence=TCCTCTTCATCC criterion=fanout-score sequence-density=0.07 sequence-density-rank=3 fanout-score=294.00 fanout-score-rank=1 prefix-density=0.63 prefix-fanout=33.7 sequence=AAGAAGAAGAAA ERR1864476 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:53:38 Started mapping on | Feb 13 13:53:38 Finished on | Feb 13 13:54:30 Mapping speed, Million of reads per hour | 920.48 Number of input reads | 13295786 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 12242855 Uniquely mapped reads % | 92.08% Average mapped length | 195.45 Number of splices: Total | 6620848 Number of splices: Annotated (sjdb) | 6413026 Number of splices: GT/AG | 6504611 Number of splices: GC/AG | 96583 Number of splices: AT/AC | 8911 Number of splices: Non-canonical | 10743 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 2.34 Insertion rate per base | 0.01% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 294627 % of reads mapped to multiple loci | 2.22% Number of reads mapped to too many loci | 645302 % of reads mapped to too many loci | 4.85% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.51% % of reads unmapped: other | 0.34% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 775005 775005 775005 N_multimapping 294627 294627 294627 N_noFeature 653775 12100144 741036 N_ambiguous 104221 698 48328 UnstrandedReadsAssigned:11484859 PositiveStrandReadsAssigned:142013 NegativeStrandReadsAssigned:11453491 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864476 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864476-trimmed-pair1.fastq ERR1864476-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,295,786 reads, 11,986,078 reads pseudoaligned [quant] estimated average fragment length: 160.503 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,115 rounds 52401 ERR1864476.ke.tsv 34699 ERR1864476.se.tsv 87100 total ==> ERR1864476.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1858.5 1184.64 67.6919 Potri.005G024800.1.v4.1 1035 875.497 297 36.0259 Potri.004G059700.1.v4.1 961 801.507 18 2.38494 Potri.007G009000.2.v4.1 1416 1256.5 0 0 Potri.003G141000.2.v4.1 2943 2783.5 481.309 18.3631 Potri.016G087400.1.v4.1 270 117.26 987.996 894.783 Potri.015G069301.1.v4.1 564 404.587 0 0 Potri.010G195200.1.v4.1 1773 1613.5 50 3.2909 Potri.012G127500.1.v4.1 977 817.497 564 73.2667 ==> ERR1864476.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1109 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 130 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 ERR1864476 completed mapping pipeline successfully