Starting /dee2/code/volunteer_pipeline.sh ERR1864477 current disk space = 3090244538368 free memory = 1498055624 ERR1864477 SRAfilesize 02ec179b7349ad75ea24b77487985ac0 ERR1864477.sra ERR1864477.sra file validated ERR1864477 is paired end ERR1864477 is conventional basespace ERR1864477 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864477_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6175 33.0 31.0 34.0 30.0 34.0 2 31.84425 34.0 31.0 34.0 30.0 34.0 3 32.15075 34.0 31.0 34.0 30.0 34.0 4 35.58875 37.0 35.0 37.0 33.0 37.0 5 35.3655 37.0 35.0 37.0 33.0 37.0 6 35.29075 37.0 35.0 37.0 33.0 37.0 7 35.2215 37.0 35.0 37.0 33.0 37.0 8 35.2455 37.0 35.0 37.0 33.0 37.0 9 36.856 39.0 37.0 39.0 33.0 39.0 10-11 36.71625 39.0 37.0 39.0 32.5 39.0 12-13 36.692875 39.0 37.0 39.0 33.0 39.0 14-15 38.010125 40.0 38.0 41.0 33.0 41.0 16-17 37.685375 40.0 38.0 41.0 32.0 41.0 18-19 37.788375 40.0 38.0 41.0 32.0 41.0 20-21 37.670500000000004 40.0 38.0 41.0 32.0 41.0 22-23 37.63575 40.0 38.0 41.0 32.0 41.0 24-25 37.618375 40.0 38.0 41.0 32.0 41.0 26-27 37.551 40.0 38.0 41.0 32.0 41.0 28-29 37.11775 40.0 37.5 41.0 31.0 41.0 30-31 37.041 40.0 37.0 41.0 30.5 41.0 32-33 36.93475 40.0 37.0 41.0 30.5 41.0 34-35 36.795375 40.0 37.0 41.0 30.0 41.0 36-37 36.8335 40.0 37.0 41.0 30.0 41.0 38-39 36.868125 40.0 37.0 41.0 30.0 41.0 40-41 36.703625 40.0 37.0 41.0 30.0 41.0 42-43 36.393875 39.5 36.0 41.0 30.0 41.0 44-45 36.34075 39.0 36.0 41.0 29.5 41.0 46-47 36.21025 39.0 36.0 41.0 29.5 41.0 48-49 36.38775 40.0 36.0 41.0 29.5 41.0 50-51 36.12875 39.5 36.0 41.0 28.5 41.0 52-53 36.177875 39.0 36.0 41.0 29.0 41.0 54-55 36.025625000000005 39.0 35.0 41.0 28.5 41.0 56-57 35.70075 39.0 35.0 41.0 27.5 41.0 58-59 35.548625 39.0 35.0 41.0 27.5 41.0 60-61 35.427 39.0 35.0 40.0 28.0 41.0 62-63 35.0215 38.0 34.0 40.0 26.5 41.0 64-65 34.625125 38.0 34.0 40.0 26.0 41.0 66-67 34.2235 37.0 34.0 40.0 26.0 41.0 68-69 33.813874999999996 36.5 34.0 39.0 25.0 41.0 70-71 33.464 36.0 33.5 39.0 25.0 40.5 72-73 32.916625 36.0 33.0 38.5 22.0 40.0 74-75 32.50575 35.0 32.5 37.5 21.5 39.0 76-77 31.391624999999998 34.0 30.5 36.0 21.0 39.0 78-79 31.892125 35.0 32.0 36.0 23.0 39.0 80-81 31.737875000000003 35.0 32.0 36.0 23.5 37.5 82-83 31.3405 35.0 32.0 36.0 20.5 37.0 84-85 30.908125 35.0 31.0 35.0 20.0 36.5 86-87 30.482 34.5 31.0 35.0 18.0 36.0 88-89 30.179375 34.0 31.0 35.0 14.5 36.0 90-91 30.083750000000002 34.0 31.0 35.0 14.5 35.5 92-93 29.5895 34.0 30.0 35.0 4.5 35.0 94-95 29.39025 34.0 30.0 35.0 2.0 35.0 96-97 29.176875000000003 34.0 30.0 35.0 2.0 35.0 98-99 28.756999999999998 34.0 30.0 35.0 2.0 35.0 100-101 27.110125 33.0 27.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 44.0 3 14.0 4 12.0 5 6.0 6 3.0 7 6.0 8 5.0 9 9.0 10 7.0 11 15.0 12 13.0 13 13.0 14 9.0 15 12.0 16 11.0 17 14.0 18 21.0 19 14.0 20 13.0 21 15.0 22 19.0 23 20.0 24 24.0 25 24.0 26 40.0 27 54.0 28 46.0 29 66.0 30 62.0 31 84.0 32 105.0 33 149.0 34 210.0 35 315.0 36 526.0 37 843.0 38 1015.0 39 142.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.42460217226572 6.112654710785552 6.036877999494822 46.4258651174539 2 24.725 7.249999999999999 36.7 31.324999999999996 3 24.575 10.7 21.925 42.8 4 28.475 18.65 20.349999999999998 32.525 5 28.475 23.075000000000003 24.975 23.474999999999998 6 21.675 27.675 27.675 22.975 7 17.0 23.474999999999998 42.3 17.224999999999998 8 17.474999999999998 23.5 35.449999999999996 23.575 9 17.0 22.3 39.025 21.675 10-11 19.925 31.95 28.537499999999998 19.5875 12-13 20.0125 27.0875 30.875000000000004 22.025 14-15 20.9375 27.825 28.9 22.3375 16-17 20.95 28.15 28.537499999999998 22.3625 18-19 20.5375 27.55 28.725 23.1875 20-21 21.15 27.474999999999998 27.900000000000002 23.474999999999998 22-23 20.8 28.6875 28.075 22.4375 24-25 19.7375 28.0875 28.962500000000002 23.2125 26-27 20.1125 28.000000000000004 28.537499999999998 23.35 28-29 20.7375 27.5625 28.65 23.05 30-31 21.1625 27.9125 27.8625 23.0625 32-33 20.875 27.3625 29.025000000000002 22.7375 34-35 20.8875 27.3 28.1375 23.674999999999997 36-37 21.4 27.900000000000002 27.6625 23.0375 38-39 20.6625 28.249999999999996 27.925 23.1625 40-41 21.6625 27.0 28.299999999999997 23.0375 42-43 20.9 27.950000000000003 28.287499999999998 22.8625 44-45 20.9125 27.762500000000003 28.237499999999997 23.0875 46-47 20.75 27.6625 28.15 23.4375 48-49 21.3625 27.375 27.800000000000004 23.4625 50-51 20.349999999999998 27.9125 28.675 23.0625 52-53 21.0375 28.1125 27.8125 23.0375 54-55 21.3625 27.462500000000002 28.212500000000002 22.9625 56-57 20.5625 27.975 27.725 23.7375 58-59 20.8125 28.487499999999997 28.349999999999998 22.35 60-61 21.125 27.125 27.6875 24.0625 62-63 19.85 27.700000000000003 28.762500000000003 23.6875 64-65 21.05 27.4125 28.725 22.8125 66-67 20.0875 27.474999999999998 28.0875 24.349999999999998 68-69 20.599999999999998 28.3375 27.950000000000003 23.1125 70-71 21.6125 28.4 27.725 22.2625 72-73 20.95 26.6625 28.075 24.3125 74-75 20.4875 27.8375 28.8375 22.8375 76-77 20.6625 27.3625 28.8875 23.0875 78-79 20.7625 27.675 28.299999999999997 23.2625 80-81 20.6375 27.8875 29.0875 22.3875 82-83 21.2875 27.675 28.712500000000002 22.325 84-85 21.625 27.737499999999997 27.487499999999997 23.150000000000002 86-87 22.1375 26.8 28.3875 22.675 88-89 21.1625 28.487499999999997 27.575 22.775000000000002 90-91 21.8 28.025 26.937499999999996 23.2375 92-93 21.5 27.750000000000004 28.3625 22.3875 94-95 22.112499999999997 28.599999999999998 27.525 21.762500000000003 96-97 21.1375 28.275 27.525 23.0625 98-99 22.400000000000002 27.712500000000002 27.1625 22.725 100-101 21.3875 28.812500000000004 27.487499999999997 22.3125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 2.0 24 3.0 25 2.5 26 1.5 27 2.5 28 5.5 29 8.5 30 10.0 31 13.0 32 22.0 33 30.5 34 42.0 35 52.5 36 69.0 37 99.5 38 124.0 39 149.0 40 195.0 41 229.5 42 242.5 43 249.5 44 267.5 45 286.5 46 281.0 47 256.5 48 240.0 49 218.0 50 175.5 51 149.0 52 122.0 53 97.0 54 82.0 55 65.0 56 51.5 57 38.0 58 26.0 59 20.5 60 14.0 61 9.5 62 9.0 63 8.5 64 4.5 65 4.5 66 5.5 67 3.0 68 2.0 69 2.0 70 1.0 71 0.0 72 1.5 73 1.5 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29506545820746 98.6 2 0.7049345417925479 1.4000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.23750000000000002 0.0 0.0 0.0 0.0 76-77 0.3125 0.0 0.0 0.0 0.0 78-79 0.48750000000000004 0.0 0.0 0.0 0.0 80-81 0.6 0.0 0.0 0.0 0.0 82-83 0.7250000000000001 0.0 0.0 0.0 0.0 84-85 0.925 0.0 0.0 0.0 0.0 86-87 1.1375000000000002 0.0 0.0 0.0 0.0 88-89 1.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864477 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864477_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.68925 33.0 31.0 34.0 30.0 34.0 2 31.75375 34.0 31.0 34.0 30.0 34.0 3 31.8415 34.0 31.0 34.0 30.0 34.0 4 35.341 37.0 35.0 37.0 33.0 37.0 5 35.2715 37.0 35.0 37.0 33.0 37.0 6 35.2975 37.0 35.0 37.0 33.0 37.0 7 35.2155 37.0 35.0 37.0 33.0 37.0 8 35.20125 37.0 35.0 37.0 32.0 37.0 9 36.97575 39.0 37.0 39.0 33.0 39.0 10-11 36.83175 39.0 37.0 39.0 32.5 39.0 12-13 36.560625 39.0 37.0 39.0 32.5 39.0 14-15 37.8195 40.0 38.0 41.0 32.5 41.0 16-17 37.891999999999996 40.0 38.0 41.0 32.5 41.0 18-19 37.89675 40.0 38.0 41.0 32.5 41.0 20-21 37.708749999999995 40.0 38.0 41.0 32.0 41.0 22-23 37.8635 40.0 38.0 41.0 33.0 41.0 24-25 37.7935 40.0 38.0 41.0 32.5 41.0 26-27 37.538875000000004 40.0 37.5 41.0 31.5 41.0 28-29 37.37225 40.0 37.5 41.0 31.0 41.0 30-31 37.417249999999996 40.0 37.5 41.0 31.5 41.0 32-33 37.26675 40.0 37.5 41.0 30.5 41.0 34-35 37.02075 40.0 37.0 41.0 30.0 41.0 36-37 36.56575 39.5 36.0 41.0 30.0 41.0 38-39 36.238125 39.0 35.5 41.0 29.0 41.0 40-41 36.322874999999996 39.0 36.0 41.0 29.5 41.0 42-43 36.294 39.0 36.0 41.0 29.5 41.0 44-45 35.9965 39.0 35.5 40.0 28.0 41.0 46-47 36.039125 39.0 35.5 41.0 28.5 41.0 48-49 35.707750000000004 39.0 35.5 40.5 27.0 41.0 50-51 35.207875 38.5 34.5 39.5 27.0 40.5 52-53 35.082375 38.0 34.0 40.0 26.5 40.5 54-55 36.13375 39.0 36.0 40.5 29.0 41.0 56-57 36.144999999999996 39.0 36.0 41.0 28.0 41.0 58-59 35.573499999999996 39.0 35.0 41.0 26.5 41.0 60-61 35.696875000000006 39.0 35.0 41.0 27.5 41.0 62-63 35.37025 39.0 35.0 40.5 27.5 41.0 64-65 34.8995 38.0 34.5 40.0 27.0 41.0 66-67 34.426 37.5 34.0 40.0 26.0 41.0 68-69 34.134625 37.0 34.0 39.0 25.5 41.0 70-71 33.796625 36.5 34.0 39.0 26.0 41.0 72-73 33.209875 36.0 33.0 38.5 25.0 40.0 74-75 32.741625 35.0 32.5 37.0 24.5 39.0 76-77 32.116 35.0 32.0 37.0 22.0 39.0 78-79 31.687875 35.0 32.0 36.5 21.5 38.5 80-81 31.278875 35.0 31.0 36.0 20.0 37.0 82-83 31.054875000000003 35.0 31.0 35.5 20.0 37.0 84-85 30.787 35.0 31.0 35.0 20.0 36.0 86-87 30.553875 34.0 31.0 35.0 18.0 36.0 88-89 30.219749999999998 34.0 31.0 35.0 16.5 36.0 90-91 29.9495 34.0 31.0 35.0 10.5 35.0 92-93 29.0905 34.0 29.0 35.0 2.0 35.0 94-95 28.78 34.0 29.0 35.0 2.0 35.0 96-97 28.663 34.0 29.0 35.0 2.0 35.0 98-99 28.482 34.0 29.0 35.0 2.0 35.0 100-101 27.490875 33.5 27.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 22.0 3 9.0 4 9.0 5 6.0 6 3.0 7 8.0 8 9.0 9 7.0 10 12.0 11 10.0 12 17.0 13 13.0 14 14.0 15 22.0 16 23.0 17 8.0 18 22.0 19 16.0 20 17.0 21 15.0 22 24.0 23 24.0 24 21.0 25 32.0 26 39.0 27 36.0 28 62.0 29 59.0 30 85.0 31 86.0 32 116.0 33 155.0 34 194.0 35 328.0 36 512.0 37 887.0 38 952.0 39 126.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.225 19.225 12.3 37.25 2 24.0 26.025 34.699999999999996 15.275 3 20.075000000000003 29.025000000000002 28.625 22.275 4 22.325 34.575 23.45 19.650000000000002 5 24.025 37.05 22.05 16.875 6 19.275000000000002 39.675 23.225 17.825 7 20.275000000000002 21.65 37.85 20.225 8 20.349999999999998 25.25 29.549999999999997 24.85 9 22.425 23.525 30.075000000000003 23.974999999999998 10-11 23.724999999999998 31.900000000000002 23.5125 20.8625 12-13 23.2125 25.7625 28.262500000000003 22.7625 14-15 22.412499999999998 28.487499999999997 27.0875 22.0125 16-17 23.275000000000002 28.65 27.125 20.95 18-19 21.6875 28.6625 27.8625 21.7875 20-21 22.8875 28.0625 27.375 21.675 22-23 22.912499999999998 29.037499999999998 27.150000000000002 20.9 24-25 22.162499999999998 29.025000000000002 27.425 21.3875 26-27 22.037499999999998 28.349999999999998 27.8125 21.8 28-29 22.525000000000002 28.487499999999997 27.425 21.5625 30-31 22.775000000000002 28.599999999999998 27.675 20.95 32-33 23.75 28.9 27.425 19.925 34-35 24.0125 29.225 26.637499999999996 20.125 36-37 22.875 28.5625 27.425 21.1375 38-39 22.4625 28.025 28.1375 21.375 40-41 22.0 28.6625 28.475 20.8625 42-43 22.3 29.5375 27.224999999999998 20.9375 44-45 22.3625 28.725 27.750000000000004 21.1625 46-47 22.4625 28.037499999999998 27.725 21.775 48-49 23.225 28.775000000000002 27.462500000000002 20.5375 50-51 23.5 28.525 27.3625 20.6125 52-53 23.1625 28.8875 27.025 20.925 54-55 22.5 27.987499999999997 27.900000000000002 21.6125 56-57 23.35 27.5625 28.287499999999998 20.8 58-59 23.0875 28.3375 27.6125 20.962500000000002 60-61 22.4375 27.6375 28.537499999999998 21.3875 62-63 22.5 29.2 27.725 20.575 64-65 22.6875 27.975 28.1125 21.224999999999998 66-67 22.35 28.7375 27.525 21.3875 68-69 23.150000000000002 27.8125 27.6875 21.349999999999998 70-71 23.1 28.125 27.025 21.75 72-73 22.9625 28.1875 27.4125 21.4375 74-75 22.2625 28.175 27.712500000000002 21.85 76-77 23.849999999999998 28.4375 27.3625 20.349999999999998 78-79 23.275000000000002 28.512500000000003 27.224999999999998 20.9875 80-81 23.2875 28.9875 27.0875 20.6375 82-83 22.45 29.349999999999998 27.150000000000002 21.05 84-85 23.9375 28.6625 26.4125 20.9875 86-87 23.45 28.599999999999998 27.1625 20.7875 88-89 23.724999999999998 29.45 26.525 20.3 90-91 22.85 28.799999999999997 26.6 21.75 92-93 23.400000000000002 28.9375 26.5875 21.075 94-95 23.724999999999998 28.275 27.237499999999997 20.7625 96-97 24.675 26.950000000000003 27.525 20.849999999999998 98-99 23.9375 28.999999999999996 26.3 20.7625 100-101 24.525 30.362499999999997 25.174999999999997 19.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 2.5 26 2.5 27 5.5 28 6.5 29 8.5 30 12.0 31 15.0 32 23.5 33 36.5 34 43.0 35 59.0 36 88.0 37 107.0 38 138.0 39 188.5 40 216.0 41 234.5 42 257.0 43 271.5 44 280.0 45 278.5 46 282.0 47 267.5 48 231.5 49 186.0 50 151.0 51 129.5 52 103.0 53 83.5 54 70.0 55 55.0 56 40.5 57 32.5 58 24.5 59 14.5 60 13.0 61 10.0 62 6.0 63 6.0 64 4.5 65 2.5 66 2.0 67 1.5 68 1.5 69 2.0 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79954898521673 99.575 2 0.17539463793535454 0.35000000000000003 3 0.025056376847907794 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.23750000000000002 0.0 0.0 0.0 0.0 76-77 0.3125 0.0 0.0 0.0 0.0 78-79 0.48750000000000004 0.0 0.0 0.0 0.0 80-81 0.6 0.0 0.0 0.0 0.0 82-83 0.7125 0.0 0.0 0.0 0.0 84-85 0.925 0.0 0.0 0.0 0.0 86-87 1.1124999999999998 0.0 0.0 0.0 0.0 88-89 1.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 910425 spots for ERR1864477.sra Written 910425 spots for ERR1864477.sra Read 910425 spots for ERR1864477.sra Written 910425 spots for ERR1864477.sra Read 910425 spots for ERR1864477.sra Written 910425 spots for ERR1864477.sra Read 910425 spots for ERR1864477.sra Written 910425 spots for ERR1864477.sra Read 910425 spots for ERR1864477.sra Written 910425 spots for ERR1864477.sra Read 910425 spots for ERR1864477.sra Written 910425 spots for ERR1864477.sra Read 910425 spots for ERR1864477.sra Written 910425 spots for ERR1864477.sra Read 910425 spots for ERR1864477.sra Written 910425 spots for ERR1864477.sra Read 910425 spots for ERR1864477.sra Written 910425 spots for ERR1864477.sra Read 910425 spots for ERR1864477.sra Written 910425 spots for ERR1864477.sra Read 910425 spots for ERR1864477.sra Written 910425 spots for ERR1864477.sra Read 910428 spots for ERR1864477.sra Written 910428 spots for ERR1864477.sra Read 910425 spots for ERR1864477.sra Written 910425 spots for ERR1864477.sra Read 910425 spots for ERR1864477.sra Written 910425 spots for ERR1864477.sra Read 910425 spots for ERR1864477.sra Written 910425 spots for ERR1864477.sra Read 910425 spots for ERR1864477.sra Written 910425 spots for ERR1864477.sra Read 910425 spots for ERR1864477.sra Written 910425 spots for ERR1864477.sra Read 910425 spots for ERR1864477.sra Written 910425 spots for ERR1864477.sra Read 910425 spots for ERR1864477.sra Written 910425 spots for ERR1864477.sra Read 910425 spots for ERR1864477.sra Written 910425 spots for ERR1864477.sra SRR ids: ['ERR1864477.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4f5ieyvj ERR1864477.sra spots: 18208503 blocks: [[1, 910425], [910426, 1820850], [1820851, 2731275], [2731276, 3641700], [3641701, 4552125], [4552126, 5462550], [5462551, 6372975], [6372976, 7283400], [7283401, 8193825], [8193826, 9104250], [9104251, 10014675], [10014676, 10925100], [10925101, 11835525], [11835526, 12745950], [12745951, 13656375], [13656376, 14566800], [14566801, 15477225], [15477226, 16387650], [16387651, 17298075], [17298076, 18208503]] ERR1864477 file size 4370389 ERR1864477 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864477 ERR1864477_1.fastq ERR1864477_2.fastq Input file: ERR1864477_1.fastq Paired file: ERR1864477_2.fastq trimmed: ERR1864477-trimmed-pair1.fastq, ERR1864477-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:00:01 2025 >> started Thu Feb 13 14:00:18 2025 >> done (16.018s) 18208503 read pairs processed; of these: 274828 ( 1.51%) short read pairs filtered out after trimming by size control 306549 ( 1.68%) empty read pairs filtered out after trimming by size control 17627126 (96.81%) read pairs available; of these: 4529717 (25.70%) trimmed read pairs available after processing 13097409 (74.30%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 108 0.00% 19 297 0.00% 20 426 0.00% 21 621 0.00% 22 788 0.00% 23 966 0.01% 24 1202 0.01% 25 1429 0.01% 26 1613 0.01% 27 1933 0.01% 28 2204 0.01% 29 2534 0.01% 30 2893 0.02% 31 3302 0.02% 32 3732 0.02% 33 4219 0.02% 34 4544 0.03% 35 5015 0.03% 36 5283 0.03% 37 5745 0.03% 38 6063 0.03% 39 6620 0.04% 40 6803 0.04% 41 7483 0.04% 42 7822 0.04% 43 8422 0.05% 44 8712 0.05% 45 9247 0.05% 46 9630 0.05% 47 10205 0.06% 48 10654 0.06% 49 11296 0.06% 50 11703 0.07% 51 12378 0.07% 52 12883 0.07% 53 13511 0.08% 54 14340 0.08% 55 15152 0.09% 56 15728 0.09% 57 17036 0.10% 58 18106 0.10% 59 21800 0.12% 60 25252 0.14% 61 26446 0.15% 62 26826 0.15% 63 28492 0.16% 64 28620 0.16% 65 30271 0.17% 66 31581 0.18% 67 33165 0.19% 68 34326 0.19% 69 35780 0.20% 70 37955 0.22% 71 39186 0.22% 72 41536 0.24% 73 43459 0.25% 74 44791 0.25% 75 46801 0.27% 76 47086 0.27% 77 49800 0.28% 78 51884 0.29% 79 55249 0.31% 80 58198 0.33% 81 61533 0.35% 82 64785 0.37% 83 68149 0.39% 84 72324 0.41% 85 77390 0.44% 86 82377 0.47% 87 86905 0.49% 88 88973 0.50% 89 93531 0.53% 90 104141 0.59% 91 114579 0.65% 92 126044 0.72% 93 141812 0.80% 94 159435 0.90% 95 181426 1.03% 96 213877 1.21% 97 262398 1.49% 98 338808 1.92% 99 445327 2.53% 100 624751 3.54% 101 13097409 74.30% 17627126 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=3.61 fanout-score-rank=23 prefix-density=0.17 prefix-fanout=2.6 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.07 sequence-density-rank=14 fanout-score=344.66 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=29.3 sequence=TTCTTCTTCTTTT criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=35 prefix-density=0.11 prefix-fanout=2.0 sequence=AAGCGCTCAAGGATATGAAGTTAAGAAAATGCTATTC criterion=fanout-score sequence-density=0.08 sequence-density-rank=7 fanout-score=324.60 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=30.9 sequence=AAGAAGAAGAAA ERR1864477 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:00:49 Started mapping on | Feb 13 14:00:49 Finished on | Feb 13 14:01:29 Mapping speed, Million of reads per hour | 1586.44 Number of input reads | 17627126 Average input read length | 194 UNIQUE READS: Uniquely mapped reads number | 17044391 Uniquely mapped reads % | 96.69% Average mapped length | 194.93 Number of splices: Total | 10082783 Number of splices: Annotated (sjdb) | 9922446 Number of splices: GT/AG | 9927474 Number of splices: GC/AG | 132134 Number of splices: AT/AC | 9803 Number of splices: Non-canonical | 13372 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 2.37 Insertion rate per base | 0.01% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 435874 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 50780 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.51% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 171148 171148 171148 N_multimapping 435874 435874 435874 N_noFeature 441873 16876815 519818 N_ambiguous 158692 674 68679 UnstrandedReadsAssigned:16443826 PositiveStrandReadsAssigned:166902 NegativeStrandReadsAssigned:16455894 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864477 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864477-trimmed-pair1.fastq ERR1864477-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,627,126 reads, 16,691,453 reads pseudoaligned [quant] estimated average fragment length: 153.773 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,026 rounds 52401 ERR1864477.ke.tsv 34699 ERR1864477.se.tsv 87100 total ==> ERR1864477.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1865.23 2038 79.3385 Potri.005G024800.1.v4.1 1035 882.227 473 38.9307 Potri.004G059700.1.v4.1 961 808.227 63 5.66003 Potri.007G009000.2.v4.1 1416 1263.23 1 0.0574818 Potri.003G141000.2.v4.1 2943 2790.23 634.208 16.5046 Potri.016G087400.1.v4.1 270 123.623 1388.01 815.275 Potri.015G069301.1.v4.1 564 411.367 0 0 Potri.010G195200.1.v4.1 1773 1620.23 87 3.89902 Potri.012G127500.1.v4.1 977 824.227 1218 107.303 ==> ERR1864477.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1241 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 288 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 28 ERR1864477 completed mapping pipeline successfully