Starting /dee2/code/volunteer_pipeline.sh ERR1864478 current disk space = 3090726002688 free memory = 1400173264 ERR1864478 SRAfilesize f1deb0bb3afea11097a0db913587a05b ERR1864478.sra ERR1864478.sra file validated ERR1864478 is paired end ERR1864478 is conventional basespace ERR1864478 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864478_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.496 33.0 31.0 34.0 30.0 34.0 2 31.728 34.0 31.0 34.0 29.0 34.0 3 32.01 34.0 31.0 34.0 30.0 34.0 4 35.347 37.0 35.0 37.0 33.0 37.0 5 35.17675 37.0 35.0 37.0 32.0 37.0 6 35.17725 37.0 35.0 37.0 32.0 37.0 7 35.04 37.0 35.0 37.0 32.0 37.0 8 35.078 37.0 35.0 37.0 32.0 37.0 9 36.6575 39.0 37.0 39.0 33.0 39.0 10-11 36.458 39.0 37.0 39.0 32.0 39.0 12-13 36.554249999999996 39.0 37.0 39.0 32.0 39.0 14-15 37.698375 40.0 38.0 41.0 32.0 41.0 16-17 37.4385 40.0 38.0 41.0 32.0 41.0 18-19 37.55275 40.0 38.0 41.0 32.0 41.0 20-21 37.421375 40.0 38.0 41.0 31.5 41.0 22-23 37.505375 40.0 38.0 41.0 32.0 41.0 24-25 37.286625 40.0 38.0 41.0 31.0 41.0 26-27 37.3125 40.0 38.0 41.0 32.0 41.0 28-29 36.832125 40.0 36.5 41.0 30.5 41.0 30-31 36.71325 40.0 37.0 41.0 30.0 41.0 32-33 36.603125 40.0 37.0 41.0 30.0 41.0 34-35 36.556875000000005 40.0 36.5 41.0 30.0 41.0 36-37 36.548 40.0 37.0 41.0 30.0 41.0 38-39 36.538125 40.0 37.0 41.0 30.0 41.0 40-41 36.413 40.0 36.0 41.0 30.0 41.0 42-43 36.151624999999996 40.0 36.0 41.0 28.5 41.0 44-45 35.981875 39.0 36.0 41.0 27.5 41.0 46-47 35.924875 39.0 35.5 41.0 28.0 41.0 48-49 36.026375 40.0 36.0 41.0 28.0 41.0 50-51 35.922375 39.5 35.5 41.0 28.0 41.0 52-53 35.845875 39.0 35.5 41.0 27.5 41.0 54-55 35.569874999999996 39.0 35.0 41.0 26.5 41.0 56-57 35.306875 39.0 34.5 41.0 26.5 41.0 58-59 35.069625 39.0 34.0 40.5 26.0 41.0 60-61 34.958875 39.0 34.0 40.5 26.0 41.0 62-63 34.636625 38.0 34.0 40.0 26.0 41.0 64-65 34.162625 37.5 34.0 40.0 23.5 41.0 66-67 33.966750000000005 37.0 34.0 40.0 24.0 41.0 68-69 33.547375 36.5 33.0 39.0 22.0 41.0 70-71 33.01475000000001 36.0 32.5 39.0 22.0 40.5 72-73 32.462875 35.5 32.0 38.5 20.5 40.0 74-75 32.170249999999996 35.0 32.0 37.0 20.0 39.0 76-77 31.06725 34.0 30.5 36.0 20.0 39.0 78-79 31.490125 35.0 31.5 36.0 20.0 39.0 80-81 31.2725 35.0 32.0 36.0 19.0 37.5 82-83 30.93425 35.0 31.5 36.0 17.5 37.0 84-85 30.613 35.0 31.0 35.0 16.5 37.0 86-87 30.120874999999998 34.0 31.0 35.0 9.0 36.0 88-89 29.856 34.0 30.0 35.0 6.0 36.0 90-91 29.67375 34.0 30.0 35.0 2.0 36.0 92-93 29.243000000000002 34.0 30.0 35.0 2.0 35.0 94-95 28.988750000000003 34.0 30.0 35.0 2.0 35.0 96-97 28.76175 34.0 30.0 35.0 2.0 35.0 98-99 28.30725 34.0 29.0 35.0 2.0 35.0 100-101 26.679375 33.0 26.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 46.0 3 29.0 4 9.0 5 8.0 6 7.0 7 10.0 8 11.0 9 9.0 10 10.0 11 10.0 12 9.0 13 10.0 14 14.0 15 15.0 16 19.0 17 20.0 18 12.0 19 18.0 20 9.0 21 20.0 22 18.0 23 23.0 24 18.0 25 37.0 26 40.0 27 44.0 28 56.0 29 60.0 30 75.0 31 99.0 32 126.0 33 149.0 34 188.0 35 291.0 36 457.0 37 861.0 38 1006.0 39 157.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.51012145748988 5.921052631578947 4.832995951417004 46.73582995951417 2 24.25 7.625 37.075 31.05 3 23.425 10.299999999999999 22.55 43.725 4 28.849999999999998 17.75 20.95 32.45 5 29.049999999999997 22.7 25.374999999999996 22.875 6 22.775000000000002 27.0 27.175 23.05 7 16.5 22.425 42.025 19.05 8 16.8 23.775 38.0 21.425 9 17.525 21.875 38.975 21.625 10-11 20.1 32.1625 29.225 18.512500000000003 12-13 20.325 26.2125 31.574999999999996 21.8875 14-15 20.849999999999998 27.075 29.862499999999997 22.2125 16-17 20.9125 27.650000000000002 29.062500000000004 22.375 18-19 22.237499999999997 27.025 28.5875 22.15 20-21 20.1125 28.5625 28.4125 22.912499999999998 22-23 21.125 27.175 29.1625 22.537499999999998 24-25 20.724999999999998 28.025 27.500000000000004 23.75 26-27 20.4375 26.737499999999997 28.999999999999996 23.825 28-29 21.224999999999998 27.4125 28.499999999999996 22.8625 30-31 20.474999999999998 27.750000000000004 28.575 23.200000000000003 32-33 20.4625 27.1 28.037499999999998 24.4 34-35 20.4875 27.700000000000003 28.249999999999996 23.5625 36-37 20.9875 27.6875 28.1875 23.1375 38-39 20.7625 27.875 28.1875 23.175 40-41 21.275 28.375 27.6 22.75 42-43 21.087500000000002 27.55 27.5125 23.849999999999998 44-45 20.674999999999997 27.5625 28.462500000000002 23.3 46-47 20.9125 28.012500000000003 28.349999999999998 22.725 48-49 21.575 28.125 27.037499999999998 23.2625 50-51 20.5 27.6875 28.475 23.3375 52-53 21.3625 27.375 28.7 22.5625 54-55 21.2 26.8375 28.299999999999997 23.6625 56-57 20.9875 27.250000000000004 27.8625 23.9 58-59 22.025 27.3375 27.575 23.0625 60-61 21.525 27.500000000000004 27.400000000000002 23.575 62-63 21.0 26.75 28.5625 23.6875 64-65 20.6625 27.6125 28.6625 23.0625 66-67 20.95 26.937499999999996 29.0875 23.025000000000002 68-69 20.2875 27.200000000000003 28.287499999999998 24.224999999999998 70-71 20.849999999999998 27.175 28.3625 23.6125 72-73 20.625 27.875 27.9125 23.5875 74-75 20.4625 27.250000000000004 28.212500000000002 24.075 76-77 20.2125 27.575 28.875 23.3375 78-79 21.6125 26.924999999999997 28.262500000000003 23.200000000000003 80-81 22.0625 26.325 28.537499999999998 23.075000000000003 82-83 20.8 27.474999999999998 28.199999999999996 23.525 84-85 21.0 27.3 28.725 22.975 86-87 21.0375 27.287499999999998 28.5625 23.1125 88-89 21.0 27.85 28.6375 22.5125 90-91 21.5375 28.0625 26.887499999999996 23.5125 92-93 21.125 27.6625 27.750000000000004 23.4625 94-95 21.375 27.525 28.075 23.025000000000002 96-97 21.025 27.325 27.9125 23.7375 98-99 21.512500000000003 28.0625 27.037499999999998 23.3875 100-101 21.275 28.025 27.8125 22.8875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 3.0 25 2.5 26 1.5 27 4.0 28 7.5 29 9.0 30 13.0 31 20.5 32 24.5 33 29.5 34 41.5 35 49.5 36 63.0 37 95.5 38 120.5 39 145.5 40 181.0 41 217.0 42 240.5 43 264.5 44 275.5 45 271.0 46 273.5 47 256.0 48 246.0 49 224.5 50 173.5 51 139.5 52 112.5 53 93.5 54 87.5 55 71.5 56 51.0 57 36.5 58 31.0 59 24.5 60 15.0 61 13.0 62 11.5 63 11.0 64 10.0 65 7.5 66 6.5 67 3.5 68 3.5 69 4.5 70 4.0 71 2.5 72 1.0 73 0.5 74 0.5 75 0.5 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1670873296315 98.225 2 0.7067137809187279 1.4000000000000001 3 0.12619888944977284 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0125 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.425 0.0 0.0 0.0 0.0 82-83 0.4375 0.0 0.0 0.0 0.0 84-85 0.55 0.0 0.0 0.0 0.0 86-87 0.6625 0.0 0.0 0.0 0.0 88-89 0.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCCTCT 20 0.0018312115 72.14241 1 >>END_MODULE ERR1864478 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864478_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.4885 33.0 31.0 34.0 28.0 34.0 2 31.58675 34.0 31.0 34.0 28.0 34.0 3 31.6235 34.0 31.0 34.0 28.0 34.0 4 35.0735 37.0 35.0 37.0 32.0 37.0 5 34.99225 37.0 35.0 37.0 32.0 37.0 6 35.049 37.0 35.0 37.0 32.0 37.0 7 35.01275 37.0 35.0 37.0 32.0 37.0 8 35.0105 37.0 35.0 37.0 32.0 37.0 9 36.62675 39.0 37.0 39.0 32.0 39.0 10-11 36.420249999999996 39.0 37.0 39.0 32.0 39.0 12-13 36.262 39.0 37.0 39.0 31.0 39.0 14-15 37.521375 40.0 38.0 41.0 32.0 41.0 16-17 37.543375 40.0 38.0 41.0 32.0 41.0 18-19 37.616125 40.0 38.0 41.0 32.0 41.0 20-21 37.45399999999999 40.0 37.5 41.0 31.5 41.0 22-23 37.476625 40.0 38.0 41.0 31.5 41.0 24-25 37.42 40.0 38.0 41.0 31.5 41.0 26-27 37.263625 40.0 37.5 41.0 31.0 41.0 28-29 37.05925 40.0 37.0 41.0 30.0 41.0 30-31 37.048375 40.0 37.0 41.0 30.0 41.0 32-33 36.769625000000005 40.0 37.0 41.0 30.0 41.0 34-35 36.582499999999996 40.0 36.5 41.0 30.0 41.0 36-37 36.0715 39.5 35.5 41.0 27.0 41.0 38-39 35.772499999999994 39.0 35.0 41.0 26.5 41.0 40-41 35.845625 39.0 35.0 41.0 26.5 41.0 42-43 35.696749999999994 39.0 35.0 40.5 26.5 41.0 44-45 35.3985 39.0 35.0 40.0 26.0 41.0 46-47 35.562 39.0 35.0 40.5 26.0 41.0 48-49 35.14 38.5 34.5 40.5 24.5 41.0 50-51 34.532125 38.0 33.5 39.5 24.0 40.5 52-53 34.4705 38.0 33.5 40.0 24.0 40.5 54-55 35.460625 39.0 35.0 40.5 25.5 41.0 56-57 35.59 39.0 35.0 41.0 26.5 41.0 58-59 35.05925 39.0 34.5 41.0 24.5 41.0 60-61 35.06825 39.0 34.5 41.0 26.0 41.0 62-63 34.924499999999995 38.0 34.5 40.0 25.5 41.0 64-65 34.278625 37.5 34.0 40.0 23.5 41.0 66-67 33.901625 37.0 34.0 40.0 23.0 41.0 68-69 33.5575 36.5 33.0 39.0 22.5 41.0 70-71 33.244749999999996 36.0 33.0 39.0 22.0 41.0 72-73 32.601124999999996 35.5 32.5 38.5 21.0 40.0 74-75 32.135625000000005 35.0 32.0 37.0 20.5 39.0 76-77 31.62725 35.0 32.0 37.0 19.5 39.0 78-79 31.1015 35.0 31.0 36.0 17.0 38.5 80-81 30.68975 35.0 31.0 36.0 13.0 37.0 82-83 30.47325 35.0 31.0 35.5 10.5 37.0 84-85 30.154874999999997 34.5 31.0 35.0 7.0 36.5 86-87 29.99125 34.0 31.0 35.0 7.0 36.0 88-89 29.605125 34.0 30.0 35.0 2.0 36.0 90-91 29.3205 34.0 30.0 35.0 2.0 35.0 92-93 28.56025 34.0 29.0 35.0 2.0 35.0 94-95 28.258125 34.0 29.0 35.0 2.0 35.0 96-97 28.118125 34.0 29.0 35.0 2.0 35.0 98-99 27.757125000000002 34.0 29.0 35.0 2.0 35.0 100-101 26.782 33.0 26.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 37.0 3 5.0 4 6.0 5 8.0 6 6.0 7 7.0 8 10.0 9 19.0 10 16.0 11 14.0 12 22.0 13 20.0 14 14.0 15 19.0 16 12.0 17 13.0 18 20.0 19 21.0 20 20.0 21 26.0 22 20.0 23 39.0 24 31.0 25 36.0 26 49.0 27 62.0 28 58.0 29 64.0 30 73.0 31 107.0 32 106.0 33 129.0 34 202.0 35 291.0 36 498.0 37 874.0 38 937.0 39 109.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.275000000000002 20.45 11.075 38.2 2 22.95 25.174999999999997 36.375 15.5 3 19.125 28.9 30.75 21.224999999999998 4 22.425 32.15 24.0 21.425 5 23.549999999999997 37.8 21.375 17.275 6 19.475 39.825 22.525000000000002 18.175 7 20.424999999999997 21.224999999999998 37.875 20.474999999999998 8 19.85 26.474999999999998 31.374999999999996 22.3 9 22.15 24.349999999999998 31.075000000000003 22.425 10-11 22.7125 32.550000000000004 24.4125 20.325 12-13 23.925 25.6125 27.35 23.1125 14-15 22.125 29.312500000000004 27.8125 20.75 16-17 23.1 28.237499999999997 26.775 21.8875 18-19 23.375 28.825 26.5 21.3 20-21 22.5 28.6625 28.1625 20.674999999999997 22-23 22.4625 28.6375 27.675 21.224999999999998 24-25 23.225 28.3375 26.625 21.8125 26-27 22.625 29.812499999999996 26.8125 20.75 28-29 22.7125 28.3125 27.237499999999997 21.7375 30-31 22.9375 29.562500000000004 27.400000000000002 20.1 32-33 23.3 29.25 27.250000000000004 20.200000000000003 34-35 23.1125 28.625 27.1625 21.099999999999998 36-37 22.8375 28.7375 27.625 20.8 38-39 23.8875 28.975 26.625 20.5125 40-41 24.425 28.9875 26.1 20.4875 42-43 22.95 28.95 27.437499999999996 20.6625 44-45 22.8875 27.474999999999998 28.4375 21.2 46-47 23.625 28.287499999999998 26.674999999999997 21.4125 48-49 23.0625 27.725 28.287499999999998 20.925 50-51 23.5625 28.3625 26.875 21.2 52-53 22.475 27.9375 27.962500000000002 21.625 54-55 22.662499999999998 28.225 27.537499999999998 21.575 56-57 22.400000000000002 28.175 28.225 21.2 58-59 23.8125 27.1625 27.825 21.2 60-61 22.8125 28.237499999999997 27.5125 21.4375 62-63 23.0 29.1875 26.5125 21.3 64-65 23.175 28.3625 27.250000000000004 21.212500000000002 66-67 23.825 28.499999999999996 26.724999999999998 20.95 68-69 23.0125 28.1875 26.8125 21.987499999999997 70-71 23.125 28.199999999999996 27.1625 21.512500000000003 72-73 23.1125 27.712500000000002 27.200000000000003 21.975 74-75 23.4625 28.012500000000003 27.3125 21.212500000000002 76-77 23.2625 28.9125 26.2875 21.5375 78-79 22.400000000000002 29.0875 26.775 21.7375 80-81 22.4875 28.075 28.375 21.0625 82-83 23.325000000000003 28.1 27.287499999999998 21.2875 84-85 23.4625 27.712500000000002 27.1125 21.712500000000002 86-87 23.025000000000002 28.3625 27.1625 21.45 88-89 23.599999999999998 27.6375 27.437499999999996 21.325 90-91 23.6375 28.249999999999996 26.8 21.3125 92-93 23.599999999999998 28.825 26.2125 21.3625 94-95 24.3 28.15 26.924999999999997 20.625 96-97 23.962500000000002 27.6125 27.625 20.8 98-99 23.875 28.5625 26.8 20.7625 100-101 23.549999999999997 28.5625 27.1375 20.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 1.0 25 2.0 26 1.0 27 2.0 28 5.0 29 11.0 30 14.5 31 18.0 32 25.5 33 33.5 34 46.0 35 68.0 36 97.5 37 109.5 38 128.0 39 167.5 40 204.0 41 230.0 42 251.5 43 261.5 44 265.5 45 275.5 46 270.0 47 263.0 48 232.5 49 199.0 50 174.0 51 134.0 52 109.5 53 89.0 54 64.0 55 45.0 56 38.0 57 41.0 58 30.5 59 15.5 60 15.0 61 12.5 62 9.0 63 8.5 64 6.0 65 3.0 66 4.5 67 5.0 68 2.5 69 1.5 70 1.5 71 2.0 72 1.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0125 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.425 0.0 0.0 0.0 0.0 82-83 0.4375 0.0 0.0 0.0 0.0 84-85 0.55 0.0 0.0 0.0 0.0 86-87 0.6625 0.0 0.0 0.0 0.0 88-89 0.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1003367 spots for ERR1864478.sra Written 1003367 spots for ERR1864478.sra Read 1003367 spots for ERR1864478.sra Written 1003367 spots for ERR1864478.sra Read 1003367 spots for ERR1864478.sra Written 1003367 spots for ERR1864478.sra Read 1003367 spots for ERR1864478.sra Written 1003367 spots for ERR1864478.sra Read 1003367 spots for ERR1864478.sra Written 1003367 spots for ERR1864478.sra Read 1003367 spots for ERR1864478.sra Written 1003367 spots for ERR1864478.sra Read 1003367 spots for ERR1864478.sra Written 1003367 spots for ERR1864478.sra Read 1003367 spots for ERR1864478.sra Written 1003367 spots for ERR1864478.sra Read 1003367 spots for ERR1864478.sra Written 1003367 spots for ERR1864478.sra Read 1003367 spots for ERR1864478.sra Written 1003367 spots for ERR1864478.sra Read 1003367 spots for ERR1864478.sra Written 1003367 spots for ERR1864478.sra Read 1003367 spots for ERR1864478.sra Written 1003367 spots for ERR1864478.sra Read 1003367 spots for ERR1864478.sra Written 1003367 spots for ERR1864478.sra Read 1003367 spots for ERR1864478.sra Written 1003367 spots for ERR1864478.sra Read 1003367 spots for ERR1864478.sra Written 1003367 spots for ERR1864478.sra Read 1003367 spots for ERR1864478.sra Written 1003367 spots for ERR1864478.sra Read 1003367 spots for ERR1864478.sra Written 1003367 spots for ERR1864478.sra Read 1003380 spots for ERR1864478.sra Written 1003380 spots for ERR1864478.sra Read 1003367 spots for ERR1864478.sra Written 1003367 spots for ERR1864478.sra Read 1003367 spots for ERR1864478.sra Written 1003367 spots for ERR1864478.sra SRR ids: ['ERR1864478.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jm_bgr00 ERR1864478.sra spots: 20067353 blocks: [[1, 1003367], [1003368, 2006734], [2006735, 3010101], [3010102, 4013468], [4013469, 5016835], [5016836, 6020202], [6020203, 7023569], [7023570, 8026936], [8026937, 9030303], [9030304, 10033670], [10033671, 11037037], [11037038, 12040404], [12040405, 13043771], [13043772, 14047138], [14047139, 15050505], [15050506, 16053872], [16053873, 17057239], [17057240, 18060606], [18060607, 19063973], [19063974, 20067353]] ERR1864478 file size 4818764 ERR1864478 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864478 ERR1864478_1.fastq ERR1864478_2.fastq Input file: ERR1864478_1.fastq Paired file: ERR1864478_2.fastq trimmed: ERR1864478-trimmed-pair1.fastq, ERR1864478-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:38:19 2025 >> started Thu Feb 13 13:38:38 2025 >> done (18.418s) 20067353 read pairs processed; of these: 343521 ( 1.71%) short read pairs filtered out after trimming by size control 419102 ( 2.09%) empty read pairs filtered out after trimming by size control 19304730 (96.20%) read pairs available; of these: 4623590 (23.95%) trimmed read pairs available after processing 14681140 (76.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 191 0.00% 19 412 0.00% 20 611 0.00% 21 811 0.00% 22 1047 0.01% 23 1279 0.01% 24 1503 0.01% 25 1858 0.01% 26 2130 0.01% 27 2522 0.01% 28 2871 0.01% 29 3279 0.02% 30 3775 0.02% 31 4087 0.02% 32 4628 0.02% 33 5104 0.03% 34 5711 0.03% 35 6203 0.03% 36 6488 0.03% 37 7112 0.04% 38 7647 0.04% 39 8045 0.04% 40 8534 0.04% 41 9089 0.05% 42 9591 0.05% 43 9819 0.05% 44 10516 0.05% 45 10898 0.06% 46 11539 0.06% 47 11896 0.06% 48 12473 0.06% 49 13137 0.07% 50 13700 0.07% 51 14276 0.07% 52 14834 0.08% 53 15403 0.08% 54 16106 0.08% 55 17184 0.09% 56 17486 0.09% 57 18929 0.10% 58 19724 0.10% 59 24207 0.13% 60 27800 0.14% 61 28578 0.15% 62 29447 0.15% 63 30523 0.16% 64 31461 0.16% 65 32458 0.17% 66 33675 0.17% 67 35260 0.18% 68 36465 0.19% 69 38177 0.20% 70 39782 0.21% 71 41041 0.21% 72 43006 0.22% 73 44537 0.23% 74 46322 0.24% 75 47376 0.25% 76 47335 0.25% 77 49438 0.26% 78 51379 0.27% 79 54380 0.28% 80 56768 0.29% 81 59446 0.31% 82 62200 0.32% 83 65278 0.34% 84 68762 0.36% 85 73228 0.38% 86 78077 0.40% 87 82839 0.43% 88 84269 0.44% 89 88631 0.46% 90 97993 0.51% 91 108144 0.56% 92 120373 0.62% 93 135250 0.70% 94 153508 0.80% 95 175576 0.91% 96 212595 1.10% 97 265751 1.38% 98 348747 1.81% 99 468845 2.43% 100 672215 3.48% 101 14681140 76.05% 19304730 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=3.18 fanout-score-rank=28 prefix-density=0.19 prefix-fanout=2.7 sequence=ATCATCTCATCACTCACAAGCAAGTCGTGGCGT criterion=fanout-score sequence-density=0.08 sequence-density-rank=17 fanout-score=315.24 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=29.5 sequence=TTCTTCTTCTTTTT criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.37 fanout-score-rank=33 prefix-density=0.18 prefix-fanout=2.1 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.07 sequence-density-rank=12 fanout-score=369.87 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=29.8 sequence=AAGAAGAAGAAG ERR1864478 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:39:09 Started mapping on | Feb 13 13:39:09 Finished on | Feb 13 13:39:55 Mapping speed, Million of reads per hour | 1510.80 Number of input reads | 19304730 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 18647756 Uniquely mapped reads % | 96.60% Average mapped length | 195.23 Number of splices: Total | 10979501 Number of splices: Annotated (sjdb) | 10803754 Number of splices: GT/AG | 10810889 Number of splices: GC/AG | 143435 Number of splices: AT/AC | 10565 Number of splices: Non-canonical | 14612 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 2.37 Insertion rate per base | 0.01% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 469783 % of reads mapped to multiple loci | 2.43% Number of reads mapped to too many loci | 55744 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.65% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 217729 217729 217729 N_multimapping 469783 469783 469783 N_noFeature 501760 18449478 601771 N_ambiguous 174581 814 75832 UnstrandedReadsAssigned:17971415 PositiveStrandReadsAssigned:197464 NegativeStrandReadsAssigned:17970153 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864478 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864478-trimmed-pair1.fastq ERR1864478-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,304,730 reads, 18,201,133 reads pseudoaligned [quant] estimated average fragment length: 164.725 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,161 rounds 52401 ERR1864478.ke.tsv 34699 ERR1864478.se.tsv 87100 total ==> ERR1864478.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1854.27 2223.56 78.0273 Potri.005G024800.1.v4.1 1035 871.275 657 49.0661 Potri.004G059700.1.v4.1 961 797.275 35 2.85648 Potri.007G009000.2.v4.1 1416 1252.27 0 0 Potri.003G141000.2.v4.1 2943 2779.27 782.228 18.3136 Potri.016G087400.1.v4.1 270 114.928 1699.7 962.316 Potri.015G069301.1.v4.1 564 400.404 0 0 Potri.010G195200.1.v4.1 1773 1609.27 133 5.37765 Potri.012G127500.1.v4.1 977 813.275 1554 124.333 ==> ERR1864478.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1148 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 257 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 28 ERR1864478 completed mapping pipeline successfully