Starting /dee2/code/volunteer_pipeline.sh ERR1864479 current disk space = 3090089529344 free memory = 1472238940 ERR1864479 SRAfilesize 024ab51448cb443274147be107d6126f ERR1864479.sra ERR1864479.sra file validated ERR1864479 is paired end ERR1864479 is conventional basespace ERR1864479 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864479_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.457 33.0 31.0 34.0 30.0 34.0 2 31.69175 34.0 31.0 34.0 29.0 34.0 3 31.89025 34.0 31.0 34.0 30.0 34.0 4 35.311 37.0 35.0 37.0 33.0 37.0 5 34.91625 37.0 35.0 37.0 32.0 37.0 6 34.99725 37.0 35.0 37.0 32.0 37.0 7 35.019 37.0 35.0 37.0 32.0 37.0 8 34.9445 37.0 35.0 37.0 32.0 37.0 9 36.546 39.0 37.0 39.0 32.0 39.0 10-11 36.394375 39.0 37.0 39.0 32.0 39.0 12-13 36.299625 39.0 37.0 39.0 32.0 39.0 14-15 37.596125 40.0 38.0 41.0 32.5 41.0 16-17 37.269 40.0 38.0 41.0 31.5 41.0 18-19 37.407624999999996 40.0 38.0 41.0 32.0 41.0 20-21 37.27675 40.0 37.5 41.0 31.5 41.0 22-23 37.417500000000004 40.0 38.0 41.0 32.0 41.0 24-25 37.226375000000004 40.0 38.0 41.0 31.5 41.0 26-27 37.099999999999994 40.0 38.0 41.0 31.0 41.0 28-29 36.678875000000005 40.0 36.5 41.0 29.5 41.0 30-31 36.67425 40.0 37.0 41.0 30.0 41.0 32-33 36.486 40.0 36.5 41.0 30.0 41.0 34-35 36.359375 40.0 36.5 41.0 30.0 41.0 36-37 36.464875 40.0 37.0 41.0 30.0 41.0 38-39 36.5065 40.0 37.0 41.0 30.0 41.0 40-41 36.28975 40.0 36.5 41.0 29.0 41.0 42-43 36.012625 39.0 36.0 41.0 28.5 41.0 44-45 35.935875 39.5 36.0 41.0 28.5 41.0 46-47 35.780625 39.0 35.5 41.0 27.5 41.0 48-49 35.94775 40.0 36.0 41.0 28.0 41.0 50-51 35.748374999999996 39.0 35.5 41.0 27.5 41.0 52-53 35.72175 39.0 35.0 41.0 27.5 41.0 54-55 35.536 39.0 35.0 41.0 27.0 41.0 56-57 35.261625 39.0 34.5 41.0 26.5 41.0 58-59 35.0475 39.0 34.5 41.0 26.0 41.0 60-61 34.90375 38.0 34.0 40.0 26.0 41.0 62-63 34.54425 38.0 34.0 40.0 26.0 41.0 64-65 34.24325 38.0 34.0 40.0 25.5 41.0 66-67 34.02275 37.0 34.0 40.0 24.0 41.0 68-69 33.608000000000004 36.5 33.5 39.0 23.5 41.0 70-71 33.075625 36.0 32.5 39.0 22.0 40.5 72-73 32.5 35.5 32.0 38.5 21.0 40.0 74-75 32.1945 35.0 32.0 37.0 20.5 39.0 76-77 30.952375 34.0 30.5 36.0 18.5 39.0 78-79 31.347125 35.0 31.5 36.0 19.5 38.5 80-81 31.167375 35.0 32.0 36.0 18.0 37.0 82-83 30.84975 35.0 31.0 36.0 17.0 37.0 84-85 30.545875000000002 35.0 31.0 35.0 12.0 36.5 86-87 30.098 34.5 31.0 35.0 7.0 36.0 88-89 29.815875 34.0 30.5 35.0 6.0 36.0 90-91 29.67975 34.0 30.0 35.0 2.0 35.5 92-93 29.286875000000002 34.0 29.5 35.0 2.0 35.0 94-95 29.045499999999997 34.0 30.0 35.0 2.0 35.0 96-97 28.6995 34.0 29.5 35.0 2.0 35.0 98-99 28.444625000000002 34.0 29.0 35.0 2.0 35.0 100-101 26.855874999999997 33.0 26.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 63.0 3 21.0 4 19.0 5 7.0 6 6.0 7 12.0 8 8.0 9 6.0 10 9.0 11 10.0 12 11.0 13 16.0 14 18.0 15 15.0 16 11.0 17 5.0 18 14.0 19 17.0 20 18.0 21 20.0 22 19.0 23 18.0 24 20.0 25 28.0 26 35.0 27 46.0 28 57.0 29 63.0 30 56.0 31 89.0 32 126.0 33 153.0 34 219.0 35 289.0 36 480.0 37 834.0 38 1030.0 39 132.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 54.20560747663551 6.339984844657742 3.308916393028542 36.1454912856782 2 27.425 6.25 31.874999999999996 34.449999999999996 3 25.525 9.525 23.775 41.175 4 29.95 15.950000000000001 21.224999999999998 32.875 5 30.599999999999998 19.725 25.5 24.175 6 23.3 25.124999999999996 25.75 25.825 7 17.2 23.575 41.949999999999996 17.275 8 18.05 25.124999999999996 35.725 21.099999999999998 9 18.575 22.625 37.75 21.05 10-11 20.5125 32.525 28.5875 18.375 12-13 21.1625 26.3625 31.7625 20.7125 14-15 21.1375 26.525 31.275 21.0625 16-17 21.4875 27.675 29.2875 21.55 18-19 20.974999999999998 28.525 27.3625 23.1375 20-21 20.2375 28.275 28.7 22.787499999999998 22-23 21.512500000000003 27.762500000000003 28.1 22.625 24-25 20.6375 27.750000000000004 28.199999999999996 23.4125 26-27 20.3 27.975 29.037499999999998 22.6875 28-29 20.349999999999998 27.987499999999997 28.4375 23.225 30-31 21.4125 27.500000000000004 27.9375 23.150000000000002 32-33 21.2625 28.349999999999998 28.462500000000002 21.925 34-35 20.9125 28.725 28.675 21.6875 36-37 21.65 27.6375 26.8 23.9125 38-39 19.9375 28.262500000000003 27.487499999999997 24.3125 40-41 21.462500000000002 28.3625 27.950000000000003 22.225 42-43 21.525 28.012500000000003 27.675 22.787499999999998 44-45 21.2875 27.6875 27.650000000000002 23.375 46-47 20.875 28.249999999999996 27.575 23.3 48-49 21.275 27.6125 27.987499999999997 23.125 50-51 20.875 27.200000000000003 28.6875 23.2375 52-53 21.725 27.675 27.762500000000003 22.8375 54-55 20.575 28.4375 27.6375 23.35 56-57 21.2375 27.212500000000002 28.175 23.375 58-59 21.2375 27.625 28.349999999999998 22.787499999999998 60-61 20.6125 27.8125 28.0625 23.5125 62-63 21.349999999999998 28.000000000000004 27.962500000000002 22.6875 64-65 21.3 26.85 28.199999999999996 23.65 66-67 20.225 27.8375 28.487499999999997 23.45 68-69 21.3 27.900000000000002 27.700000000000003 23.1 70-71 21.6875 28.675 27.425 22.2125 72-73 20.9 27.5125 28.237499999999997 23.35 74-75 21.65 27.462500000000002 28.462500000000002 22.425 76-77 21.6125 27.175 28.212500000000002 23.0 78-79 21.0 27.900000000000002 27.675 23.425 80-81 21.625 27.6125 27.712500000000002 23.05 82-83 21.55 27.900000000000002 27.625 22.925 84-85 20.575 28.275 28.15 23.0 86-87 22.3625 27.150000000000002 27.962500000000002 22.525000000000002 88-89 21.0125 28.7375 27.6875 22.5625 90-91 21.275 27.650000000000002 28.1125 22.9625 92-93 22.25 27.675 27.35 22.725 94-95 21.5 27.962500000000002 27.425 23.1125 96-97 21.087500000000002 27.3625 27.3875 24.1625 98-99 22.1375 28.1125 27.35 22.400000000000002 100-101 21.8875 28.3375 27.187499999999996 22.5875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.5 18 1.0 19 1.0 20 1.0 21 0.5 22 0.5 23 1.0 24 1.5 25 2.0 26 3.0 27 4.5 28 7.0 29 12.0 30 13.0 31 15.5 32 22.5 33 28.0 34 34.0 35 49.0 36 75.5 37 93.5 38 101.5 39 135.0 40 178.0 41 207.5 42 234.0 43 254.5 44 289.5 45 291.0 46 284.5 47 272.0 48 238.0 49 206.5 50 180.0 51 163.0 52 122.0 53 99.5 54 82.5 55 59.0 56 51.0 57 42.0 58 29.0 59 20.0 60 17.5 61 17.5 62 12.5 63 8.5 64 7.0 65 5.5 66 5.0 67 3.5 68 4.0 69 2.5 70 2.0 71 2.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.075 #Duplication Level Percentage of deduplicated Percentage of total 1 98.62350242161611 96.72500000000001 2 1.0706092276319144 2.1 3 0.15294417537598778 0.44999999999999996 4 0.07647208768799389 0.3 5 0.025490695895997964 0.125 6 0.05098139179199593 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGCGCTTCACTTGGAGAGAACATGTTAATTTTCTCATACTGTACAGTCC 6 0.15 No Hit GTCGCTAGCTATGGTCTTCAATTCTGATGTGTTATCCCATCATGGAAGTG 6 0.15 No Hit GTCCCGCTATGGAACCTTCTGCCCGCAATGTCAACAGAAGAGTCTTCACT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.44999999999999996 0.0 0.0 0.0 0.0 86-87 0.575 0.0 0.0 0.0 0.0 88-89 0.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864479 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864479_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.05075 33.0 31.0 34.0 28.0 34.0 2 31.22825 34.0 31.0 34.0 27.0 34.0 3 31.2855 34.0 31.0 34.0 28.0 34.0 4 34.68125 37.0 35.0 37.0 32.0 37.0 5 34.598 37.0 35.0 37.0 32.0 37.0 6 34.527 37.0 35.0 37.0 32.0 37.0 7 34.4365 37.0 35.0 37.0 30.0 37.0 8 34.502 37.0 35.0 37.0 32.0 37.0 9 36.145 39.0 37.0 39.0 32.0 39.0 10-11 35.9205 39.0 37.0 39.0 31.0 39.0 12-13 35.682500000000005 39.0 37.0 39.0 30.0 39.0 14-15 36.82525 40.0 37.5 41.0 30.0 41.0 16-17 36.964375000000004 40.0 38.0 41.0 31.0 41.0 18-19 37.003625 40.0 38.0 41.0 30.5 41.0 20-21 36.806375 40.0 37.5 41.0 29.0 41.0 22-23 36.843375 40.0 38.0 41.0 30.5 41.0 24-25 36.732124999999996 40.0 37.5 41.0 30.0 41.0 26-27 36.54475 40.0 37.0 41.0 29.5 41.0 28-29 36.346000000000004 40.0 37.0 41.0 28.0 41.0 30-31 36.38425 40.0 37.0 41.0 29.5 41.0 32-33 36.20975 40.0 37.0 41.0 28.0 41.0 34-35 36.070875 40.0 36.5 41.0 28.0 41.0 36-37 35.524125 39.5 36.0 41.0 25.0 41.0 38-39 35.222125000000005 39.0 35.0 41.0 24.0 41.0 40-41 35.208625 39.0 35.0 40.5 25.0 41.0 42-43 35.128125 39.0 35.0 40.0 24.0 41.0 44-45 34.751375 38.0 34.5 40.0 24.0 41.0 46-47 34.87125 39.0 35.0 40.5 23.5 41.0 48-49 34.411375 38.5 34.0 40.0 21.0 41.0 50-51 33.907875000000004 38.0 33.5 39.5 22.5 40.5 52-53 33.917375 38.0 33.5 39.5 22.0 40.5 54-55 34.777875 39.0 35.0 40.5 23.0 41.0 56-57 34.824375 39.0 35.0 41.0 23.0 41.0 58-59 34.391875 39.0 34.0 41.0 21.5 41.0 60-61 34.362125000000006 38.5 34.0 41.0 22.0 41.0 62-63 34.215875 38.0 34.0 40.0 22.0 41.0 64-65 33.660250000000005 37.5 33.5 40.0 19.0 41.0 66-67 33.179 37.0 33.0 40.0 16.0 41.0 68-69 32.908625 36.5 33.0 39.0 14.5 41.0 70-71 32.580625 36.0 33.0 39.0 13.5 41.0 72-73 31.99925 35.5 32.0 38.5 10.5 40.0 74-75 31.430625 35.0 31.0 37.0 7.0 39.0 76-77 31.04375 35.0 31.0 37.0 7.0 39.0 78-79 30.595 35.0 31.0 36.5 4.0 38.5 80-81 30.18525 35.0 30.5 36.0 2.0 37.0 82-83 30.009500000000003 35.0 30.5 35.5 2.0 37.0 84-85 29.767875 34.0 30.0 35.0 2.0 36.5 86-87 29.5785 34.0 30.5 35.0 2.0 36.0 88-89 29.277375 34.0 30.0 35.0 2.0 36.0 90-91 28.8545 34.0 29.5 35.0 2.0 35.5 92-93 28.0345 34.0 28.5 35.0 2.0 35.0 94-95 27.724125 34.0 27.0 35.0 2.0 35.0 96-97 27.6765 34.0 28.0 35.0 2.0 35.0 98-99 27.4625 34.0 28.0 35.0 2.0 35.0 100-101 26.328375 33.0 25.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 90.0 3 17.0 4 24.0 5 11.0 6 16.0 7 14.0 8 14.0 9 6.0 10 24.0 11 21.0 12 13.0 13 11.0 14 16.0 15 14.0 16 7.0 17 14.0 18 21.0 19 15.0 20 17.0 21 17.0 22 20.0 23 28.0 24 27.0 25 40.0 26 31.0 27 53.0 28 58.0 29 67.0 30 73.0 31 99.0 32 105.0 33 145.0 34 196.0 35 275.0 36 494.0 37 857.0 38 925.0 39 124.0 40 1.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.35 25.75 8.649999999999999 30.25 2 24.5 26.924999999999997 32.300000000000004 16.275000000000002 3 18.825 27.450000000000003 32.2 21.525 4 22.175 33.95 23.674999999999997 20.200000000000003 5 23.925 36.675000000000004 22.275 17.125 6 19.675 39.225 22.0 19.1 7 20.925 23.075000000000003 36.325 19.675 8 19.875 25.275 29.9 24.95 9 22.325 24.775 29.799999999999997 23.1 10-11 22.4625 32.7125 24.3875 20.4375 12-13 22.3375 27.275 28.025 22.3625 14-15 21.8875 28.4375 27.987499999999997 21.6875 16-17 23.7375 28.275 26.6 21.3875 18-19 22.45 28.999999999999996 26.6125 21.9375 20-21 23.150000000000002 27.762500000000003 27.825 21.2625 22-23 22.75 28.962500000000002 26.825 21.462500000000002 24-25 22.475 28.499999999999996 27.237499999999997 21.7875 26-27 22.912499999999998 28.749999999999996 27.675 20.6625 28-29 22.0875 28.65 27.3 21.9625 30-31 22.6875 27.6625 28.1875 21.462500000000002 32-33 23.325000000000003 28.512500000000003 26.6 21.5625 34-35 22.525000000000002 27.975 27.8125 21.6875 36-37 22.9375 27.462500000000002 27.437499999999996 22.162499999999998 38-39 22.5 28.999999999999996 26.950000000000003 21.55 40-41 22.8125 28.175 28.299999999999997 20.7125 42-43 22.5875 27.6 28.812500000000004 21.0 44-45 23.0625 27.5125 27.737499999999997 21.6875 46-47 23.200000000000003 28.9375 27.462500000000002 20.4 48-49 22.85 28.375 27.250000000000004 21.525 50-51 22.6375 27.800000000000004 28.225 21.337500000000002 52-53 22.4375 27.5625 27.4125 22.5875 54-55 23.0125 28.299999999999997 27.6375 21.05 56-57 21.8875 28.7375 28.575 20.8 58-59 22.8625 27.3625 28.5625 21.212500000000002 60-61 23.5625 28.425 27.125 20.8875 62-63 22.7 28.3625 27.950000000000003 20.9875 64-65 23.25 28.5625 27.2625 20.925 66-67 23.4625 27.400000000000002 28.6125 20.525 68-69 22.875 27.712500000000002 28.462500000000002 20.95 70-71 22.55 28.449999999999996 27.5875 21.4125 72-73 23.825 27.5875 28.075 20.5125 74-75 22.225 28.749999999999996 28.1625 20.8625 76-77 23.9125 28.275 26.075 21.7375 78-79 22.975 28.4375 27.6125 20.974999999999998 80-81 23.775 27.9375 27.4125 20.875 82-83 22.325 29.549999999999997 26.6 21.525 84-85 22.975 28.499999999999996 26.900000000000002 21.625 86-87 22.6375 28.9875 26.900000000000002 21.475 88-89 22.9625 27.900000000000002 28.299999999999997 20.837500000000002 90-91 23.9125 27.800000000000004 26.8375 21.45 92-93 23.175 29.562500000000004 25.8125 21.45 94-95 23.3125 28.325 26.6 21.762500000000003 96-97 22.4875 29.1375 27.3125 21.0625 98-99 23.3 28.65 26.85 21.2 100-101 23.025000000000002 28.749999999999996 26.987499999999997 21.2375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 1.0 16 1.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.0 22 1.5 23 2.0 24 3.5 25 7.5 26 9.5 27 6.5 28 5.5 29 7.5 30 13.5 31 21.0 32 23.5 33 30.0 34 38.5 35 61.5 36 89.5 37 116.5 38 136.0 39 163.0 40 209.5 41 238.5 42 258.5 43 252.5 44 264.0 45 291.5 46 278.0 47 256.5 48 227.0 49 189.0 50 156.0 51 124.0 52 104.5 53 85.5 54 70.0 55 56.0 56 39.5 57 32.0 58 26.0 59 24.5 60 15.0 61 8.5 62 9.0 63 7.0 64 6.5 65 6.5 66 6.5 67 4.5 68 3.0 69 1.5 70 0.0 71 1.5 72 1.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49723479135244 98.95 2 0.4524886877828055 0.8999999999999999 3 0.050276520864756154 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.3125 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.6 0.0 0.0 0.0 0.0 88-89 0.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGAGGC 25 0.001521768 38.0 18-19 >>END_MODULE Read 846473 spots for ERR1864479.sra Written 846473 spots for ERR1864479.sra Read 846473 spots for ERR1864479.sra Written 846473 spots for ERR1864479.sra Read 846473 spots for ERR1864479.sra Written 846473 spots for ERR1864479.sra Read 846473 spots for ERR1864479.sra Written 846473 spots for ERR1864479.sra Read 846473 spots for ERR1864479.sra Written 846473 spots for ERR1864479.sra Read 846473 spots for ERR1864479.sra Written 846473 spots for ERR1864479.sra Read 846473 spots for ERR1864479.sra Written 846473 spots for ERR1864479.sra Read 846473 spots for ERR1864479.sra Written 846473 spots for ERR1864479.sra Read 846473 spots for ERR1864479.sra Written 846473 spots for ERR1864479.sra Read 846473 spots for ERR1864479.sra Written 846473 spots for ERR1864479.sra Read 846480 spots for ERR1864479.sra Written 846480 spots for ERR1864479.sra Read 846473 spots for ERR1864479.sra Written 846473 spots for ERR1864479.sra Read 846473 spots for ERR1864479.sra Written 846473 spots for ERR1864479.sra Read 846473 spots for ERR1864479.sra Written 846473 spots for ERR1864479.sra Read 846473 spots for ERR1864479.sra Written 846473 spots for ERR1864479.sra Read 846473 spots for ERR1864479.sra Written 846473 spots for ERR1864479.sra Read 846473 spots for ERR1864479.sra Written 846473 spots for ERR1864479.sra Read 846473 spots for ERR1864479.sra Written 846473 spots for ERR1864479.sra Read 846473 spots for ERR1864479.sra Written 846473 spots for ERR1864479.sra Read 846473 spots for ERR1864479.sra Written 846473 spots for ERR1864479.sra SRR ids: ['ERR1864479.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gfyez6ql ERR1864479.sra spots: 16929467 blocks: [[1, 846473], [846474, 1692946], [1692947, 2539419], [2539420, 3385892], [3385893, 4232365], [4232366, 5078838], [5078839, 5925311], [5925312, 6771784], [6771785, 7618257], [7618258, 8464730], [8464731, 9311203], [9311204, 10157676], [10157677, 11004149], [11004150, 11850622], [11850623, 12697095], [12697096, 13543568], [13543569, 14390041], [14390042, 15236514], [15236515, 16082987], [16082988, 16929467]] ERR1864479 file size 4061872 ERR1864479 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864479 ERR1864479_1.fastq ERR1864479_2.fastq Input file: ERR1864479_1.fastq Paired file: ERR1864479_2.fastq trimmed: ERR1864479-trimmed-pair1.fastq, ERR1864479-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:06:19 2025 >> started Thu Feb 13 14:06:35 2025 >> done (15.393s) 16929467 read pairs processed; of these: 387366 ( 2.29%) short read pairs filtered out after trimming by size control 548742 ( 3.24%) empty read pairs filtered out after trimming by size control 15993359 (94.47%) read pairs available; of these: 3892814 (24.34%) trimmed read pairs available after processing 12100545 (75.66%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 117 0.00% 19 283 0.00% 20 436 0.00% 21 614 0.00% 22 790 0.00% 23 920 0.01% 24 1138 0.01% 25 1319 0.01% 26 1519 0.01% 27 1891 0.01% 28 2139 0.01% 29 2297 0.01% 30 2774 0.02% 31 3053 0.02% 32 3452 0.02% 33 3762 0.02% 34 4103 0.03% 35 4509 0.03% 36 4849 0.03% 37 5190 0.03% 38 5656 0.04% 39 5831 0.04% 40 6156 0.04% 41 6594 0.04% 42 6987 0.04% 43 7389 0.05% 44 7651 0.05% 45 8219 0.05% 46 8585 0.05% 47 8816 0.06% 48 9267 0.06% 49 9612 0.06% 50 10279 0.06% 51 10539 0.07% 52 11303 0.07% 53 11773 0.07% 54 12319 0.08% 55 13009 0.08% 56 13929 0.09% 57 14522 0.09% 58 15634 0.10% 59 23348 0.15% 60 29177 0.18% 61 29166 0.18% 62 28720 0.18% 63 29524 0.18% 64 29360 0.18% 65 29995 0.19% 66 30796 0.19% 67 31248 0.20% 68 32126 0.20% 69 33309 0.21% 70 34455 0.22% 71 35532 0.22% 72 37055 0.23% 73 37976 0.24% 74 38544 0.24% 75 39994 0.25% 76 39556 0.25% 77 41211 0.26% 78 43303 0.27% 79 44818 0.28% 80 47423 0.30% 81 49607 0.31% 82 52520 0.33% 83 55699 0.35% 84 58960 0.37% 85 62526 0.39% 86 66089 0.41% 87 70462 0.44% 88 70478 0.44% 89 74027 0.46% 90 82544 0.52% 91 91212 0.57% 92 101510 0.63% 93 115838 0.72% 94 130542 0.82% 95 149927 0.94% 96 179705 1.12% 97 223367 1.40% 98 292255 1.83% 99 390409 2.44% 100 559276 3.50% 101 12100545 75.66% 15993359 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.90 fanout-score-rank=28 prefix-density=0.22 prefix-fanout=2.5 sequence=ATCATCTCATCACTCACAAGCAAGTCGTGGCGT criterion=fanout-score sequence-density=0.07 sequence-density-rank=20 fanout-score=328.48 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=28.6 sequence=TTCTTCTTCTTTTT criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=31 prefix-density=0.18 prefix-fanout=2.0 sequence=ACGCCACGACTTGCTTGTGAGTGATGAGATGAT criterion=fanout-score sequence-density=0.08 sequence-density-rank=16 fanout-score=313.09 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=30.2 sequence=AAGAAGAAGAAA ERR1864479 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:07:07 Started mapping on | Feb 13 14:07:07 Finished on | Feb 13 14:07:45 Mapping speed, Million of reads per hour | 1515.16 Number of input reads | 15993359 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 15326718 Uniquely mapped reads % | 95.83% Average mapped length | 195.05 Number of splices: Total | 9133751 Number of splices: Annotated (sjdb) | 8990148 Number of splices: GT/AG | 8992951 Number of splices: GC/AG | 120296 Number of splices: AT/AC | 8470 Number of splices: Non-canonical | 12034 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 2.41 Insertion rate per base | 0.01% Insertion average length | 2.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 401986 % of reads mapped to multiple loci | 2.51% Number of reads mapped to too many loci | 49595 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.31% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 333061 333061 333061 N_multimapping 401986 401986 401986 N_noFeature 394337 15141288 498698 N_ambiguous 143398 849 61767 UnstrandedReadsAssigned:14788983 PositiveStrandReadsAssigned:184581 NegativeStrandReadsAssigned:14766253 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864479 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864479-trimmed-pair1.fastq ERR1864479-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,993,359 reads, 14,986,549 reads pseudoaligned [quant] estimated average fragment length: 158.934 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,022 rounds 52401 ERR1864479.ke.tsv 34699 ERR1864479.se.tsv 87100 total ==> ERR1864479.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1860.07 1224 51.0391 Potri.005G024800.1.v4.1 1035 877.066 381 33.6932 Potri.004G059700.1.v4.1 961 803.066 20 1.93165 Potri.007G009000.2.v4.1 1416 1258.07 0 0 Potri.003G141000.2.v4.1 2943 2785.07 576 16.0412 Potri.016G087400.1.v4.1 270 118.519 1039.61 680.351 Potri.015G069301.1.v4.1 564 406.159 0 0 Potri.010G195200.1.v4.1 1773 1615.07 106 5.09056 Potri.012G127500.1.v4.1 977 819.066 1747 165.434 ==> ERR1864479.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1113 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 250 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 51 ERR1864479 completed mapping pipeline successfully