Starting /dee2/code/volunteer_pipeline.sh ERR1864480 current disk space = 3090092597248 free memory = 1482571376 ERR1864480 SRAfilesize 62eca1685cd5f68f44bfd8715c3532e0 ERR1864480.sra ERR1864480.sra file validated ERR1864480 is paired end ERR1864480 is conventional basespace ERR1864480 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864480_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.03375 33.0 31.0 34.0 28.0 34.0 2 31.65475 34.0 31.0 34.0 28.0 34.0 3 32.12125 34.0 31.0 34.0 30.0 34.0 4 35.49775 37.0 35.0 37.0 33.0 37.0 5 35.42525 37.0 35.0 37.0 33.0 37.0 6 35.2165 37.0 35.0 37.0 33.0 37.0 7 35.2065 37.0 35.0 37.0 32.0 37.0 8 35.20075 37.0 35.0 37.0 32.0 37.0 9 36.80625 39.0 37.0 39.0 33.0 39.0 10-11 36.902 39.0 37.0 39.0 33.0 39.0 12-13 36.86125 39.0 37.0 39.0 33.0 39.0 14-15 38.221875 40.0 38.0 41.0 33.0 41.0 16-17 38.114375 40.0 38.0 41.0 33.0 41.0 18-19 38.107 40.0 38.0 41.0 33.0 41.0 20-21 38.005125 40.0 38.0 41.0 33.0 41.0 22-23 37.8495 40.0 38.0 41.0 33.0 41.0 24-25 37.76475 40.0 38.0 41.0 32.5 41.0 26-27 37.7115 40.0 38.0 41.0 32.0 41.0 28-29 37.62225 40.0 38.0 41.0 32.5 41.0 30-31 37.436875 40.0 38.0 41.0 31.5 41.0 32-33 37.444874999999996 40.0 38.0 41.0 31.5 41.0 34-35 37.268125 40.0 37.5 41.0 31.0 41.0 36-37 37.085625 40.0 37.0 41.0 30.5 41.0 38-39 37.038624999999996 40.0 37.0 41.0 31.0 41.0 40-41 36.913124999999994 40.0 37.0 41.0 30.5 41.0 42-43 36.59225 40.0 36.5 41.0 30.0 41.0 44-45 36.630375 40.0 36.5 41.0 30.0 41.0 46-47 36.681625 40.0 37.0 41.0 30.0 41.0 48-49 36.69225 40.0 37.0 41.0 30.0 41.0 50-51 36.59775 40.0 36.0 41.0 30.0 41.0 52-53 36.206125 40.0 35.5 41.0 29.0 41.0 54-55 35.998875 39.5 35.0 41.0 28.0 41.0 56-57 35.855374999999995 39.0 35.0 41.0 28.0 41.0 58-59 35.627625 39.0 35.0 41.0 28.0 41.0 60-61 35.399 39.0 35.0 41.0 27.5 41.0 62-63 35.097625 38.0 34.0 40.0 26.5 41.0 64-65 34.637125 38.0 34.0 40.0 26.0 41.0 66-67 34.21825 37.0 34.0 40.0 26.0 41.0 68-69 33.887625 37.0 34.0 39.5 25.5 41.0 70-71 33.387249999999995 36.0 33.0 39.0 24.0 40.5 72-73 32.933625 35.5 33.0 38.5 23.0 40.0 74-75 32.459875 35.0 32.0 37.5 22.5 39.5 76-77 31.45475 34.5 31.0 36.0 22.0 39.0 78-79 31.67575 35.0 32.0 36.0 20.5 39.0 80-81 31.415125 35.0 32.0 36.0 19.5 37.5 82-83 31.1325 35.0 32.0 36.0 19.5 37.0 84-85 30.735374999999998 34.5 31.0 35.0 18.5 36.5 86-87 30.164875 34.0 31.0 35.0 11.5 36.0 88-89 29.921 34.0 31.0 35.0 7.0 36.0 90-91 29.755625000000002 34.0 30.5 35.0 7.0 35.0 92-93 29.49875 34.0 30.0 35.0 2.0 35.0 94-95 29.29825 34.0 30.0 35.0 2.0 35.0 96-97 29.055500000000002 34.0 30.0 35.0 2.0 35.0 98-99 28.7125 34.0 30.0 35.0 2.0 35.0 100-101 27.639 33.0 27.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 36.0 3 16.0 4 10.0 5 5.0 6 7.0 7 10.0 8 6.0 9 8.0 10 7.0 11 7.0 12 11.0 13 18.0 14 13.0 15 16.0 16 13.0 17 18.0 18 15.0 19 23.0 20 14.0 21 22.0 22 21.0 23 14.0 24 22.0 25 26.0 26 30.0 27 36.0 28 45.0 29 52.0 30 77.0 31 88.0 32 100.0 33 147.0 34 205.0 35 269.0 36 476.0 37 877.0 38 1099.0 39 141.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.53004622496148 5.110426296866975 7.344632768361582 43.014894709809965 2 28.050000000000004 6.9750000000000005 31.95 33.025 3 29.099999999999998 9.975000000000001 20.05 40.875 4 31.900000000000002 16.725 20.025000000000002 31.35 5 30.08252063015754 22.005501375343837 25.85646411602901 22.05551387846962 6 24.18104526131533 25.881470367591895 26.081520380095025 23.85596399099775 7 19.604901225306325 20.38009502375594 43.135783945986496 16.879219804951237 8 20.230057514378593 22.680670167541887 34.98374593648413 22.1055263815954 9 18.854713678419603 22.705676419104776 37.30932733183296 21.13028257064266 10-11 21.50537634408602 31.757939484871216 28.93223305826457 17.804451112778192 12-13 22.18054513628407 26.581645411352838 32.29557389347337 18.942235558889724 14-15 21.530382595648913 27.44436109027257 31.220305076269067 19.80495123780945 16-17 21.54288572143036 28.369592398099524 29.83245811452863 20.255063765941486 18-19 21.73043260815204 28.157039259814955 28.81970492623156 21.29282320580145 20-21 22.2430607651913 27.7569392348087 29.369842460615153 20.630157539384847 22-23 22.50562640660165 28.232058014503625 28.89472368092023 20.367591897974492 24-25 21.192798199549888 28.93223305826457 28.26956739184796 21.605401350337583 26-27 21.655413853463365 27.46936734183546 29.794948737184296 21.080270067516878 28-29 21.517879469867466 28.019504876219052 28.094523630907727 22.36809202300575 30-31 21.030257564391096 28.207051762940733 28.219554888722183 22.543135783945985 32-33 21.8304576144036 27.11927981995499 29.069767441860467 21.980495123780948 34-35 21.13028257064266 27.394348587146787 28.657164291072768 22.818204551137786 36-37 21.930482620655166 27.46936734183546 28.132033008252062 22.468117029257314 38-39 21.355338834708675 28.107026756689173 28.232058014503625 22.305576394098527 40-41 21.45536384096024 28.08202050512628 28.482120530132534 21.980495123780948 42-43 21.442860715178792 27.806951737934483 28.657164291072768 22.093023255813954 44-45 21.50537634408602 27.84446111527882 28.14453613403351 22.50562640660165 46-47 21.705426356589147 28.019504876219052 28.14453613403351 22.13053263315829 48-49 21.005251312828207 27.806951737934483 28.632158039509875 22.55563890972743 50-51 20.6176544136034 28.069517379344838 28.569642410602654 22.74318579644911 52-53 21.534219102531964 28.290298320381048 28.252694911005268 21.922787666081724 54-55 21.267816954238562 27.406851712928233 28.657164291072768 22.66816704176044 56-57 21.36784196049012 27.85696424106027 27.731932983245812 23.0432608152038 58-59 21.580395098774694 27.04426106526632 29.632408102025504 21.742935733933482 60-61 22.380595148787197 26.71917979494874 28.532133033258315 22.36809202300575 62-63 21.4 27.9375 28.799999999999997 21.8625 64-65 22.5125 26.937499999999996 28.462500000000002 22.0875 66-67 21.8125 28.9 27.025 22.2625 68-69 21.2375 27.487499999999997 28.999999999999996 22.275 70-71 21.5625 28.287499999999998 28.037499999999998 22.112499999999997 72-73 22.3875 27.0875 27.275 23.25 74-75 21.8625 27.675 28.375 22.0875 76-77 22.3625 28.675 26.8625 22.1 78-79 21.54557959234713 27.98549456046017 27.222708515693384 23.24621733149931 80-81 22.027753469183647 27.50343792974122 28.27853481685211 22.190273784223027 82-83 22.615326915864483 29.453681710213775 26.303287910988875 21.627703462932867 84-85 21.712500000000002 28.625 26.8625 22.8 86-87 21.9625 28.349999999999998 27.3375 22.35 88-89 22.6875 28.4375 26.650000000000002 22.225 90-91 23.775 28.237499999999997 26.5625 21.425 92-93 22.5625 28.9125 27.3375 21.1875 94-95 23.4625 27.55 26.887499999999996 22.1 96-97 23.4625 28.6625 26.025 21.85 98-99 23.3875 28.9875 25.074999999999996 22.55 100-101 23.7 28.225 24.9125 23.1625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.0 21 1.5 22 2.0 23 1.0 24 2.5 25 3.0 26 5.0 27 8.0 28 8.0 29 11.5 30 12.0 31 17.0 32 28.0 33 37.0 34 51.5 35 63.5 36 74.0 37 93.5 38 124.5 39 150.0 40 162.0 41 193.0 42 232.5 43 263.5 44 280.5 45 275.0 46 274.0 47 261.0 48 226.0 49 203.0 50 177.5 51 145.0 52 116.5 53 95.5 54 78.0 55 59.5 56 51.5 57 42.5 58 33.0 59 26.5 60 21.0 61 20.0 62 16.0 63 10.0 64 10.0 65 8.0 66 5.5 67 4.0 68 2.5 69 4.0 70 2.5 71 0.5 72 0.5 73 0.5 74 1.0 75 0.5 76 0.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.65 2 0.0 3 0.0 4 0.0 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.025 38-39 0.025 40-41 0.025 42-43 0.025 44-45 0.025 46-47 0.025 48-49 0.025 50-51 0.025 52-53 0.27499999999999997 54-55 0.025 56-57 0.025 58-59 0.025 60-61 0.025 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0375 80-81 0.0125 82-83 0.0125 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14032869785082 98.02499999999999 2 0.7079646017699115 1.4000000000000001 3 0.12642225031605564 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025284450063211124 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCCCCTCTTGAGATCCAGGTTGATGGTCATCATTCCAGGCCTAAAGTCA 8 0.2 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0125 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.0625 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.15 0.0 0.0 0.0 0.0 56-57 0.225 0.0 0.0 0.0 0.0 58-59 0.30000000000000004 0.0 0.0 0.0 0.0 60-61 0.4375 0.0 0.0 0.0 0.0 62-63 0.4875 0.0 0.0 0.0 0.0 64-65 0.5625 0.0 0.0 0.0 0.0 66-67 0.725 0.0 0.0 0.0 0.0 68-69 0.9 0.0 0.0 0.0 0.0 70-71 1.2000000000000002 0.0 0.0 0.0 0.0 72-73 1.4625 0.0 0.0 0.0 0.0 74-75 1.7 0.0 0.0 0.0 0.0 76-77 2.1875 0.0 0.0 0.0 0.0 78-79 2.7625 0.0 0.0 0.0 0.0 80-81 3.3499999999999996 0.0 0.0 0.0 0.0 82-83 4.1125 0.0 0.0 0.0 0.0 84-85 5.1375 0.0 0.0 0.0 0.0 86-87 6.275 0.0 0.0 0.0 0.0 88-89 7.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864480 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864480_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.06 34.0 31.0 34.0 30.0 34.0 2 32.20175 34.0 31.0 34.0 30.0 34.0 3 32.267 34.0 31.0 34.0 30.0 34.0 4 35.5745 37.0 35.0 37.0 33.0 37.0 5 35.54275 37.0 35.0 37.0 33.0 37.0 6 35.6105 37.0 36.0 37.0 33.0 37.0 7 35.614 37.0 36.0 37.0 35.0 37.0 8 35.54725 37.0 36.0 37.0 33.0 37.0 9 37.188 39.0 38.0 39.0 34.0 39.0 10-11 37.18175 39.0 38.0 39.0 34.0 39.0 12-13 37.100875 39.0 37.5 39.0 33.0 39.0 14-15 38.4795 41.0 38.0 41.0 33.5 41.0 16-17 38.413375 41.0 38.0 41.0 33.5 41.0 18-19 38.394 41.0 38.5 41.0 34.0 41.0 20-21 38.357625 40.5 38.5 41.0 34.0 41.0 22-23 38.11225 40.0 38.0 41.0 33.0 41.0 24-25 38.123000000000005 40.0 38.0 41.0 33.0 41.0 26-27 38.09525 40.0 38.0 41.0 33.5 41.0 28-29 37.884375 40.0 38.0 41.0 32.5 41.0 30-31 37.75925 40.0 38.0 41.0 32.5 41.0 32-33 37.642375 40.0 38.0 41.0 32.0 41.0 34-35 37.5215 40.0 38.0 41.0 31.5 41.0 36-37 37.303 40.0 37.5 41.0 31.0 41.0 38-39 37.351375000000004 40.0 37.5 41.0 31.0 41.0 40-41 37.136375 40.0 37.0 41.0 31.0 41.0 42-43 37.161500000000004 40.0 37.5 41.0 31.0 41.0 44-45 36.87675 40.0 37.0 41.0 30.5 41.0 46-47 36.640625 40.0 36.5 41.0 30.0 41.0 48-49 36.4585 39.5 36.0 41.0 29.5 41.0 50-51 36.06925 39.0 36.0 40.5 29.5 41.0 52-53 36.377625 39.0 36.0 40.5 30.5 41.0 54-55 36.685500000000005 40.0 37.0 41.0 30.0 41.0 56-57 36.424125000000004 40.0 36.0 41.0 29.0 41.0 58-59 36.218875 39.0 36.0 41.0 28.5 41.0 60-61 35.959375 39.0 35.0 41.0 28.0 41.0 62-63 35.700874999999996 39.0 35.0 41.0 28.0 41.0 64-65 35.395875000000004 38.5 35.0 40.0 28.0 41.0 66-67 35.097875 37.5 35.0 40.0 28.0 41.0 68-69 34.61575 37.0 34.0 39.5 27.5 41.0 70-71 34.048625 36.5 34.0 39.0 26.0 41.0 72-73 33.588 36.0 34.0 39.0 26.0 40.0 74-75 33.114999999999995 35.5 33.0 37.5 26.0 39.5 76-77 32.3315 35.0 32.0 37.0 23.0 39.0 78-79 32.001875 35.0 32.0 36.5 22.5 39.0 80-81 31.706249999999997 35.0 32.0 36.0 23.5 37.0 82-83 31.201875 35.0 31.5 36.0 20.0 37.0 84-85 30.74625 35.0 31.0 35.0 18.0 36.5 86-87 30.266375 34.5 30.5 35.0 14.0 36.0 88-89 29.87275 34.0 30.0 35.0 8.0 36.0 90-91 29.718375 34.0 30.0 35.0 7.0 35.5 92-93 29.459 34.0 30.0 35.0 2.0 35.0 94-95 29.1725 34.0 30.0 35.0 2.0 35.0 96-97 28.168625 34.0 28.0 35.0 2.0 35.0 98-99 27.65 34.0 28.0 35.0 2.0 35.0 100-101 26.354125 33.0 25.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 3.0 4 4.0 5 4.0 6 4.0 7 7.0 8 11.0 9 12.0 10 8.0 11 10.0 12 16.0 13 11.0 14 11.0 15 11.0 16 18.0 17 15.0 18 17.0 19 9.0 20 11.0 21 20.0 22 22.0 23 27.0 24 30.0 25 33.0 26 38.0 27 47.0 28 50.0 29 65.0 30 65.0 31 88.0 32 121.0 33 142.0 34 189.0 35 253.0 36 448.0 37 893.0 38 1090.0 39 178.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.282570642660666 18.479619904976243 15.328832208052013 35.90897724431108 2 24.381095273818453 24.456114028507127 33.65841460365091 17.504376094023506 3 19.80495123780945 27.38184546136534 29.35733933483371 23.455863965991497 4 21.68584292146073 33.56678339169585 24.462231115557778 20.28514257128564 5 22.73068267066767 35.83395848962241 23.905976494123532 17.5293823455864 6 18.375 38.725 23.724999999999998 19.175 7 18.85 20.349999999999998 39.125 21.675 8 21.155288822205552 24.456114028507127 28.557139284821204 25.831457864466117 9 20.825 24.6 31.4 23.175 10-11 22.502812851606453 31.66645830728841 24.49056132016502 21.340167520940117 12-13 23.214509068167605 25.97873671044403 27.25453408380238 23.55222013758599 14-15 21.827284105131415 28.785982478097623 27.734668335419272 21.65206508135169 16-17 22.586293146573286 27.963981990995496 27.101050525262632 22.348674337168582 18-19 21.540192524065507 29.016127015876986 28.041005125640705 21.402675334416802 20-21 22.152769096137018 28.50356294536817 27.11588948618577 22.22777847230904 22-23 22.275 28.425 27.55 21.75 24-25 21.65 29.5 27.3625 21.4875 26-27 21.975 29.425 27.0875 21.512500000000003 28-29 21.81522690336292 28.528566070758842 27.678459807475935 21.9777472184023 30-31 22.675 28.7 26.8 21.825 32-33 22.3 28.9 26.8125 21.987499999999997 34-35 22.5 29.125 26.650000000000002 21.725 36-37 22.287499999999998 28.6875 27.825 21.2 38-39 22.15 29.037499999999998 27.075 21.7375 40-41 22.540317539692463 28.091011376422053 27.928491061382672 21.440180022502815 42-43 22.4375 27.900000000000002 27.200000000000003 22.4625 44-45 21.85 28.575 27.224999999999998 22.35 46-47 22.3 27.725 27.9125 22.0625 48-49 22.175 28.075 27.474999999999998 22.275 50-51 21.762500000000003 29.1625 27.3625 21.712500000000002 52-53 22.3375 29.7875 26.75 21.125 54-55 21.90273784223028 28.778597324665583 27.19089886235779 22.127765970746342 56-57 21.167791947987 29.40735183795949 28.032008002000502 21.392848212053014 58-59 22.727840980122515 28.01600200025003 28.128516064508062 21.12764095511939 60-61 21.975 28.512500000000003 27.8375 21.675 62-63 21.7375 28.599999999999998 27.212500000000002 22.45 64-65 22.4375 29.4125 27.8125 20.3375 66-67 22.55 28.349999999999998 27.987499999999997 21.1125 68-69 22.4375 28.449999999999996 26.775 22.3375 70-71 22.9375 28.95 27.462500000000002 20.65 72-73 22.55 28.9875 27.575 20.8875 74-75 22.0875 28.287499999999998 27.462500000000002 22.162499999999998 76-77 23.0875 29.075 26.7625 21.075 78-79 21.8875 29.362500000000004 27.025 21.725 80-81 23.4125 28.375 26.5 21.712500000000002 82-83 23.6125 28.749999999999996 25.75 21.8875 84-85 23.4875 28.675 25.55 22.287499999999998 86-87 23.0875 29.5875 26.424999999999997 20.9 88-89 23.575 29.175 25.387500000000003 21.8625 90-91 23.925 29.15 26.1 20.825 92-93 24.2 28.0625 25.937500000000004 21.8 94-95 26.237500000000004 28.325 25.2125 20.225 96-97 25.224999999999998 28.8875 24.875 21.0125 98-99 25.174999999999997 29.325000000000003 25.0375 20.4625 100-101 27.237499999999997 28.7 23.962500000000002 20.1 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 2.5 24 3.0 25 3.0 26 6.5 27 8.5 28 7.5 29 11.5 30 14.5 31 24.5 32 35.5 33 41.0 34 50.0 35 61.0 36 81.5 37 103.0 38 129.0 39 170.5 40 206.5 41 227.5 42 243.0 43 250.0 44 261.0 45 274.0 46 264.0 47 240.5 48 217.0 49 196.5 50 171.0 51 140.5 52 109.5 53 79.0 54 58.5 55 63.5 56 61.5 57 36.5 58 29.0 59 28.0 60 19.5 61 15.0 62 13.5 63 10.0 64 7.5 65 7.0 66 4.0 67 0.5 68 1.5 69 2.5 70 1.5 71 1.0 72 0.5 73 0.5 74 0.5 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.05 5 0.025 6 0.0 7 0.0 8 0.025 9 0.0 10-11 0.0125 12-13 0.0625 14-15 0.125 16-17 0.05 18-19 0.0125 20-21 0.0125 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0125 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0125 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0125 56-57 0.025 58-59 0.0125 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0125 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.0625 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.2 0.0 0.0 0.0 0.0 58-59 0.2625 0.0 0.0 0.0 0.0 60-61 0.38749999999999996 0.0 0.0 0.0 0.0 62-63 0.4375 0.0 0.0 0.0 0.0 64-65 0.5375 0.0 0.0 0.0 0.0 66-67 0.7 0.0 0.0 0.0 0.0 68-69 0.875 0.0 0.0 0.0 0.0 70-71 1.1749999999999998 0.0 0.0 0.0 0.0 72-73 1.4625 0.0 0.0 0.0 0.0 74-75 1.725 0.0 0.0 0.0 0.0 76-77 2.1875 0.0 0.0 0.0 0.0 78-79 2.7375 0.0 0.0 0.0 0.0 80-81 3.3625 0.0 0.0 0.0 0.0 82-83 4.1875 0.0 0.0 0.0 0.0 84-85 5.3 0.0 0.0 0.0 0.0 86-87 6.387499999999999 0.0 0.0 0.0 0.0 88-89 7.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 438560 spots for ERR1864480.sra Written 438560 spots for ERR1864480.sra Read 438560 spots for ERR1864480.sra Written 438560 spots for ERR1864480.sra Read 438560 spots for ERR1864480.sra Written 438560 spots for ERR1864480.sra Read 438560 spots for ERR1864480.sra Written 438560 spots for ERR1864480.sra Read 438560 spots for ERR1864480.sra Written 438560 spots for ERR1864480.sra Read 438560 spots for ERR1864480.sra Written 438560 spots for ERR1864480.sra Read 438560 spots for ERR1864480.sra Written 438560 spots for ERR1864480.sra Read 438560 spots for ERR1864480.sra Written 438560 spots for ERR1864480.sra Read 438560 spots for ERR1864480.sra Written 438560 spots for ERR1864480.sra Read 438560 spots for ERR1864480.sra Written 438560 spots for ERR1864480.sra Read 438560 spots for ERR1864480.sra Written 438560 spots for ERR1864480.sra Read 438560 spots for ERR1864480.sra Written 438560 spots for ERR1864480.sra Read 438560 spots for ERR1864480.sra Written 438560 spots for ERR1864480.sra Read 438560 spots for ERR1864480.sra Written 438560 spots for ERR1864480.sra Read 438560 spots for ERR1864480.sra Written 438560 spots for ERR1864480.sra Read 438560 spots for ERR1864480.sra Written 438560 spots for ERR1864480.sra Read 438560 spots for ERR1864480.sra Written 438560 spots for ERR1864480.sra Read 438567 spots for ERR1864480.sra Written 438567 spots for ERR1864480.sra Read 438560 spots for ERR1864480.sra Written 438560 spots for ERR1864480.sra Read 438560 spots for ERR1864480.sra Written 438560 spots for ERR1864480.sra SRR ids: ['ERR1864480.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qdcvze36 ERR1864480.sra spots: 8771207 blocks: [[1, 438560], [438561, 877120], [877121, 1315680], [1315681, 1754240], [1754241, 2192800], [2192801, 2631360], [2631361, 3069920], [3069921, 3508480], [3508481, 3947040], [3947041, 4385600], [4385601, 4824160], [4824161, 5262720], [5262721, 5701280], [5701281, 6139840], [6139841, 6578400], [6578401, 7016960], [7016961, 7455520], [7455521, 7894080], [7894081, 8332640], [8332641, 8771207]] ERR1864480 file size 2096410 ERR1864480 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864480 ERR1864480_1.fastq ERR1864480_2.fastq Input file: ERR1864480_1.fastq Paired file: ERR1864480_2.fastq trimmed: ERR1864480-trimmed-pair1.fastq, ERR1864480-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:04:35 2025 >> started Thu Feb 13 14:04:43 2025 >> done (8.470s) 8771207 read pairs processed; of these: 91754 ( 1.05%) short read pairs filtered out after trimming by size control 104015 ( 1.19%) empty read pairs filtered out after trimming by size control 8575438 (97.77%) read pairs available; of these: 2810814 (32.78%) trimmed read pairs available after processing 5764624 (67.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 51 0.00% 19 90 0.00% 20 145 0.00% 21 199 0.00% 22 241 0.00% 23 293 0.00% 24 360 0.00% 25 404 0.00% 26 469 0.01% 27 597 0.01% 28 667 0.01% 29 789 0.01% 30 899 0.01% 31 1046 0.01% 32 1203 0.01% 33 1286 0.01% 34 1486 0.02% 35 1576 0.02% 36 1778 0.02% 37 1961 0.02% 38 2067 0.02% 39 2227 0.03% 40 2460 0.03% 41 2625 0.03% 42 2761 0.03% 43 2974 0.03% 44 3185 0.04% 45 3293 0.04% 46 3764 0.04% 47 3955 0.05% 48 4149 0.05% 49 4711 0.05% 50 5102 0.06% 51 5451 0.06% 52 5829 0.07% 53 6270 0.07% 54 6642 0.08% 55 7136 0.08% 56 7893 0.09% 57 8541 0.10% 58 9473 0.11% 59 11863 0.14% 60 14061 0.16% 61 15081 0.18% 62 15903 0.19% 63 16794 0.20% 64 17794 0.21% 65 18823 0.22% 66 19953 0.23% 67 21673 0.25% 68 22537 0.26% 69 23994 0.28% 70 26110 0.30% 71 27543 0.32% 72 29636 0.35% 73 32247 0.38% 74 33810 0.39% 75 35971 0.42% 76 37556 0.44% 77 40041 0.47% 78 42296 0.49% 79 45137 0.53% 80 48089 0.56% 81 50958 0.59% 82 55030 0.64% 83 58106 0.68% 84 61210 0.71% 85 66438 0.77% 86 68967 0.80% 87 72455 0.84% 88 74385 0.87% 89 77653 0.91% 90 81403 0.95% 91 87028 1.01% 92 91071 1.06% 93 96744 1.13% 94 103866 1.21% 95 114550 1.34% 96 126095 1.47% 97 143258 1.67% 98 169431 1.98% 99 204935 2.39% 100 294271 3.43% 101 5764624 67.22% 8575438 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=33 prefix-density=0.16 prefix-fanout=1.9 sequence=GGAAGGTTAAGCTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=21 fanout-score=195.13 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=20.2 sequence=TCTTCTTCTTCTC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=19.46 fanout-score-rank=13 prefix-density=0.34 prefix-fanout=6.2 sequence=GCTGCTGCTGCTTTGAAGGGTTCTGATCACCG criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=281.28 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=15.5 sequence=AACAAGAAAATCTGGTCTTACAATGATGTCTACACTGATGGCAAACCCACCCAAGGAGGCTTTGCTGAATCCATGGTTGTCGATCAAAAGTTTGTGGTGAGAATTCCTGATGGGATGTCACCAGAACAAGCAGCGCCGCTATTGTGCGCTGGATTGACAGTTTACAGCCCTCTTAAACACTTTGGACTGAAACAGAGTGGGCTAAGAGGAGGGATTTTAGGACTTGGAGGAGTAGGGCACATGGGGGTGAAGATAGCAAAGGCAATGGGACACCACGTAACTGTGATTAGTTCTTCTGACAAGAAGCGGGAG ERR1864480 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:05:15 Started mapping on | Feb 13 14:05:16 Finished on | Feb 13 14:05:42 Mapping speed, Million of reads per hour | 1187.37 Number of input reads | 8575438 Average input read length | 192 UNIQUE READS: Uniquely mapped reads number | 8310563 Uniquely mapped reads % | 96.91% Average mapped length | 192.71 Number of splices: Total | 4104372 Number of splices: Annotated (sjdb) | 4018048 Number of splices: GT/AG | 4045190 Number of splices: GC/AG | 48712 Number of splices: AT/AC | 4421 Number of splices: Non-canonical | 6049 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 2.31 Insertion rate per base | 0.01% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 191578 % of reads mapped to multiple loci | 2.23% Number of reads mapped to too many loci | 26671 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.52% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 83873 83873 83873 N_multimapping 191578 191578 191578 N_noFeature 369605 8136329 476559 N_ambiguous 98727 679 30928 UnstrandedReadsAssigned:7842231 PositiveStrandReadsAssigned:173555 NegativeStrandReadsAssigned:7803076 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=96 echo kmer=91 ERR1864480 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864480-trimmed-pair1.fastq ERR1864480-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,575,438 reads, 7,881,959 reads pseudoaligned [quant] estimated average fragment length: 137.252 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,114 rounds 52401 ERR1864480.ke.tsv 34699 ERR1864480.se.tsv 87100 total ==> ERR1864480.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1881.75 295 28.0891 Potri.005G024800.1.v4.1 1035 898.748 87 17.3444 Potri.004G059700.1.v4.1 961 824.748 0 0 Potri.007G009000.2.v4.1 1416 1279.75 0 0 Potri.003G141000.2.v4.1 2943 2806.75 225.133 14.3719 Potri.016G087400.1.v4.1 270 137.935 275 357.221 Potri.015G069301.1.v4.1 564 427.771 0 0 Potri.010G195200.1.v4.1 1773 1636.75 21 2.29887 Potri.012G127500.1.v4.1 977 840.748 390 83.1145 ==> ERR1864480.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1153 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 153 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 ERR1864480 completed mapping pipeline successfully