Starting /dee2/code/volunteer_pipeline.sh ERR1864481 current disk space = 3090100756480 free memory = 1485945368 ERR1864481 SRAfilesize 527dff496fef909474bea48a60d27e0b ERR1864481.sra ERR1864481.sra file validated ERR1864481 is paired end ERR1864481 is conventional basespace ERR1864481 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864481_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.0305 33.0 31.0 34.0 28.0 34.0 2 31.65725 34.0 31.0 34.0 28.0 34.0 3 32.05325 34.0 31.0 34.0 29.0 34.0 4 35.4265 37.0 35.0 37.0 33.0 37.0 5 35.20175 37.0 35.0 37.0 32.0 37.0 6 35.10025 37.0 35.0 37.0 32.0 37.0 7 35.04925 37.0 35.0 37.0 32.0 37.0 8 35.0355 37.0 35.0 37.0 32.0 37.0 9 36.7525 39.0 37.0 39.0 33.0 39.0 10-11 36.803625 39.0 37.0 39.0 33.0 39.0 12-13 36.67725 39.0 37.0 39.0 33.0 39.0 14-15 37.938 40.0 38.0 41.0 32.5 41.0 16-17 37.815124999999995 40.0 38.0 41.0 32.0 41.0 18-19 37.806625 40.0 38.0 41.0 33.0 41.0 20-21 37.720124999999996 40.0 38.0 41.0 32.0 41.0 22-23 37.532375 40.0 38.0 41.0 32.0 41.0 24-25 37.501875 40.0 38.0 41.0 32.0 41.0 26-27 37.5025 40.0 38.0 41.0 31.5 41.0 28-29 37.285624999999996 40.0 38.0 41.0 31.0 41.0 30-31 37.22025 40.0 37.5 41.0 31.5 41.0 32-33 37.1535 40.0 37.0 41.0 31.0 41.0 34-35 37.045625 40.0 37.0 41.0 31.0 41.0 36-37 36.90025 40.0 37.0 41.0 30.0 41.0 38-39 36.75 40.0 37.0 41.0 30.0 41.0 40-41 36.646125 40.0 37.0 41.0 30.0 41.0 42-43 36.488875 40.0 36.0 41.0 30.0 41.0 44-45 36.392125 40.0 36.0 41.0 29.5 41.0 46-47 36.4 40.0 36.5 41.0 29.5 41.0 48-49 36.339625 40.0 36.0 41.0 29.5 41.0 50-51 36.170375 40.0 36.0 41.0 29.0 41.0 52-53 36.013999999999996 39.5 35.0 41.0 28.5 41.0 54-55 35.745125 39.0 35.0 41.0 28.0 41.0 56-57 35.520624999999995 39.0 35.0 41.0 27.5 41.0 58-59 35.36 39.0 35.0 41.0 27.5 41.0 60-61 35.034625000000005 38.5 34.0 40.5 26.0 41.0 62-63 34.731 38.0 34.0 40.0 26.0 41.0 64-65 34.290875 37.5 34.0 40.0 25.0 41.0 66-67 33.899375 37.0 33.5 40.0 24.0 41.0 68-69 33.553625 36.5 33.0 39.0 23.5 41.0 70-71 33.141875 36.0 33.0 39.0 22.5 40.5 72-73 32.688125 35.5 32.5 38.5 21.5 40.0 74-75 32.157250000000005 35.0 32.0 37.0 21.0 39.0 76-77 31.160874999999997 34.0 30.5 36.0 20.0 39.0 78-79 31.488999999999997 35.0 32.0 36.0 20.5 39.0 80-81 31.234 35.0 31.5 36.0 19.5 37.5 82-83 30.887124999999997 35.0 31.5 35.5 17.5 37.0 84-85 30.388875 34.5 31.0 35.0 10.5 37.0 86-87 29.770249999999997 34.0 30.0 35.0 7.0 36.0 88-89 29.62175 34.0 30.0 35.0 2.0 36.0 90-91 29.42825 34.0 30.0 35.0 2.0 35.5 92-93 29.227125 34.0 30.0 35.0 2.0 35.0 94-95 28.9615 34.0 30.0 35.0 2.0 35.0 96-97 28.686374999999998 34.0 29.5 35.0 2.0 35.0 98-99 28.166249999999998 34.0 29.0 35.0 2.0 35.0 100-101 27.073875 33.0 27.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 49.0 3 16.0 4 8.0 5 18.0 6 4.0 7 8.0 8 6.0 9 11.0 10 7.0 11 13.0 12 11.0 13 16.0 14 8.0 15 11.0 16 9.0 17 19.0 18 24.0 19 12.0 20 14.0 21 15.0 22 23.0 23 26.0 24 30.0 25 27.0 26 43.0 27 41.0 28 41.0 29 57.0 30 77.0 31 94.0 32 98.0 33 163.0 34 192.0 35 296.0 36 484.0 37 840.0 38 1034.0 39 155.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.104049205535624 4.766786263454638 8.021527421834957 40.10763710917478 2 28.40710177544386 6.326581645411353 31.007751937984494 34.25856464116029 3 27.425 9.225 22.45 40.9 4 33.175 14.2 20.525 32.1 5 30.890445222611305 20.485242621310658 24.387193596798397 24.23711855927964 6 23.992994746059544 24.668501376032022 27.570678008506377 23.767825869402053 7 18.689016762571928 20.490367775831874 43.83287465599199 16.987740805604204 8 20.540405303977984 21.56617463097323 36.5774330748061 21.31598699024268 9 18.58894170627971 20.665499124343256 39.554665999499626 21.19089316987741 10-11 21.218566245464782 30.701864131114725 29.9386963593144 18.14087326410609 12-13 22.00950950950951 25.462962962962965 31.844344344344343 20.683183183183182 14-15 20.40790790790791 28.215715715715717 31.756756756756754 19.61961961961962 16-17 22.09986234513828 27.593542735577525 29.858590914779125 20.44800400450507 18-19 21.634134134134133 28.02802802802803 28.57857857857858 21.75925925925926 20-21 22.07207207207207 27.102102102102105 29.754754754754753 21.07107107107107 22-23 21.88986232790989 27.55944931163955 30.125156445556943 20.425531914893615 24-25 21.151439299123904 27.434292866082604 28.936170212765955 22.478097622027533 26-27 21.72443999499437 27.230634463771743 29.04517582280065 21.999749718433236 28-29 21.04867976473533 28.61969715930422 28.93254911775748 21.399073958202976 30-31 21.501877346683354 27.146433041301627 28.973717146433042 22.377972465581976 32-33 21.1639549436796 27.2090112640801 28.961201501877348 22.665832290362953 34-35 20.993369198048292 28.08707619166771 29.112973852120604 21.806580758163392 36-37 21.12376423476411 26.629958703541483 28.694781629333 23.551495432361406 38-39 20.67584480600751 28.04755944931164 29.036295369211512 22.24030037546934 40-41 21.483983983983983 26.126126126126124 29.39189189189189 22.997997997998 42-43 21.407110665999 26.790185277916873 29.231347020530794 22.57135703555333 44-45 20.655983975963945 27.81672508763145 29.619429143715575 21.907861792689033 46-47 21.732598898347522 27.41612418627942 28.86830245368052 21.98297446169254 48-49 21.246246246246248 26.126126126126124 29.44194194194194 23.185685685685687 50-51 21.176470588235293 27.55944931163955 28.973717146433042 22.290362953692114 52-53 21.22995991983968 28.0811623246493 28.80761523046092 21.8812625250501 54-55 20.913642052565706 27.972465581977474 29.274092615769714 21.83979974968711 56-57 21.831602652320782 26.773426748404855 29.238083322907542 22.15688727636682 58-59 22.22222222222222 26.63913913913914 28.766266266266268 22.372372372372375 60-61 20.695695695695697 26.964464464464466 29.97997997997998 22.35985985985986 62-63 20.742685671417853 28.507126781695426 28.432108027006752 22.31807951987997 64-65 20.902612826603324 26.92836604575572 29.641205150643827 22.527815976997125 66-67 21.325 28.075 27.825 22.775000000000002 68-69 20.655163790947736 28.107026756689173 28.619654913728432 22.61815453863466 70-71 21.115139392424055 28.753594199274907 28.328541067633456 21.802725340667585 72-73 21.375 27.6 28.1625 22.8625 74-75 21.280320080020005 28.232058014503625 27.53188297074269 22.95573893473368 76-77 21.477684710588825 28.028503562945367 28.178522315289413 22.315289411176398 78-79 21.773386693346673 27.613806903451728 27.52626313156578 23.08654327163582 80-81 21.75543885971493 28.35708927231808 27.86946736684171 22.018004501125283 82-83 22.73068267066767 27.831957989497376 27.206801700425103 22.230557639409852 84-85 22.025 27.975 27.6 22.400000000000002 86-87 21.925 28.025 27.5625 22.4875 88-89 22.6875 29.062500000000004 26.125 22.125 90-91 22.5 29.125 26.200000000000003 22.175 92-93 22.775000000000002 28.9125 26.075 22.237499999999997 94-95 23.3 28.962500000000002 25.474999999999998 22.2625 96-97 23.0375 29.3375 25.637500000000003 21.987499999999997 98-99 23.474999999999998 29.125 24.625 22.775000000000002 100-101 23.375 29.2 24.837500000000002 22.5875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 2.0 22 3.0 23 2.0 24 1.5 25 4.0 26 8.5 27 10.5 28 10.0 29 12.0 30 17.0 31 21.0 32 30.0 33 42.0 34 53.5 35 60.0 36 73.0 37 102.5 38 129.0 39 143.5 40 165.5 41 187.0 42 205.5 43 251.0 44 267.5 45 257.5 46 266.5 47 259.0 48 231.0 49 211.5 50 190.0 51 156.5 52 126.5 53 112.0 54 91.5 55 62.5 56 48.5 57 35.0 58 23.5 59 22.0 60 22.5 61 16.0 62 13.0 63 13.5 64 12.5 65 9.0 66 4.0 67 4.5 68 2.5 69 0.5 70 1.5 71 2.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.45 2 0.025 3 0.0 4 0.0 5 0.05 6 0.075 7 0.075 8 0.075 9 0.075 10-11 0.08750000000000001 12-13 0.1 14-15 0.1 16-17 0.11249999999999999 18-19 0.1 20-21 0.1 22-23 0.125 24-25 0.125 26-27 0.11249999999999999 28-29 0.11249999999999999 30-31 0.125 32-33 0.125 34-35 0.08750000000000001 36-37 0.11249999999999999 38-39 0.125 40-41 0.1 42-43 0.15 44-45 0.15 46-47 0.15 48-49 0.1 50-51 0.125 52-53 0.2 54-55 0.125 56-57 0.08750000000000001 58-59 0.1 60-61 0.1 62-63 0.025 64-65 0.0125 66-67 0.0 68-69 0.025 70-71 0.0125 72-73 0.0 74-75 0.025 76-77 0.0125 78-79 0.05 80-81 0.025 82-83 0.025 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.45 #Duplication Level Percentage of deduplicated Percentage of total 1 98.75571356018284 97.225 2 1.015744032503809 2.0 3 0.17775520568816658 0.525 4 0.025393600812595223 0.1 5 0.0 0.0 6 0.025393600812595223 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCCCCTCTTGAGATCCAGGTTGATGGTCATCATTCCAGGCCTAAAGTCA 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.0625 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1625 0.0 0.0 0.0 0.0 56-57 0.2875 0.0 0.0 0.0 0.0 58-59 0.3625 0.0 0.0 0.0 0.0 60-61 0.5125 0.0 0.0 0.0 0.0 62-63 0.65 0.0 0.0 0.0 0.0 64-65 0.825 0.0 0.0 0.0 0.0 66-67 1.175 0.0 0.0 0.0 0.0 68-69 1.475 0.0 0.0 0.0 0.0 70-71 1.7875 0.0 0.0 0.0 0.0 72-73 2.3125 0.0 0.0 0.0 0.0 74-75 2.925 0.0 0.0 0.0 0.0 76-77 3.6624999999999996 0.0 0.0 0.0 0.0 78-79 4.525 0.0 0.0 0.0 0.0 80-81 5.3625 0.0 0.0 0.0 0.0 82-83 6.4 0.0 0.0 0.0 0.0 84-85 7.5375 0.0 0.0 0.0 0.0 86-87 9.0125 0.0 0.0 0.0 0.0 88-89 10.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864481 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864481_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.915 34.0 31.0 34.0 30.0 34.0 2 32.1015 34.0 31.0 34.0 30.0 34.0 3 32.13 34.0 31.0 34.0 30.0 34.0 4 35.28625 37.0 35.0 37.0 33.0 37.0 5 35.369 37.0 35.0 37.0 33.0 37.0 6 35.384 37.0 36.0 37.0 33.0 37.0 7 35.39975 37.0 36.0 37.0 33.0 37.0 8 35.383 37.0 36.0 37.0 33.0 37.0 9 36.99975 39.0 38.0 39.0 34.0 39.0 10-11 36.95225 39.0 38.0 39.0 33.0 39.0 12-13 36.887125 39.0 37.0 39.0 33.0 39.0 14-15 38.249125 41.0 38.0 41.0 33.5 41.0 16-17 38.200375 40.5 38.0 41.0 33.5 41.0 18-19 38.182375 40.5 38.0 41.0 33.0 41.0 20-21 38.165375 41.0 38.5 41.0 33.0 41.0 22-23 37.8595 40.0 38.0 41.0 32.0 41.0 24-25 37.907250000000005 40.0 38.0 41.0 32.0 41.0 26-27 37.817499999999995 40.0 38.0 41.0 32.5 41.0 28-29 37.631249999999994 40.0 38.0 41.0 32.0 41.0 30-31 37.485749999999996 40.0 38.0 41.0 31.0 41.0 32-33 37.306875000000005 40.0 38.0 41.0 31.0 41.0 34-35 37.18475 40.0 37.5 41.0 30.0 41.0 36-37 37.052125000000004 40.0 38.0 41.0 30.0 41.0 38-39 36.976875 40.0 37.0 41.0 30.0 41.0 40-41 36.70225 40.0 37.0 41.0 30.0 41.0 42-43 36.641000000000005 40.0 37.0 41.0 30.0 41.0 44-45 36.453875 40.0 37.0 41.0 29.0 41.0 46-47 36.295 40.0 36.0 41.0 29.0 41.0 48-49 36.15975 39.0 36.0 41.0 29.0 41.0 50-51 35.718 39.0 36.0 40.5 28.0 40.5 52-53 35.98725 39.5 36.0 40.5 28.0 41.0 54-55 36.26975 40.0 36.0 41.0 28.0 41.0 56-57 36.049625000000006 40.0 36.0 41.0 27.5 41.0 58-59 35.866375000000005 39.0 35.5 41.0 27.5 41.0 60-61 35.661249999999995 39.0 35.0 41.0 28.0 41.0 62-63 35.407624999999996 39.0 35.0 41.0 27.5 41.0 64-65 35.081125 38.0 35.0 40.0 26.5 41.0 66-67 34.667 37.5 34.5 40.0 26.0 41.0 68-69 34.268125 37.0 34.0 39.5 26.0 41.0 70-71 33.7025 36.5 34.0 39.0 24.5 41.0 72-73 33.224000000000004 36.0 33.0 39.0 24.0 40.0 74-75 32.722625 35.0 33.0 37.5 22.5 39.5 76-77 31.945875 35.0 32.0 37.0 20.5 39.0 78-79 31.61525 35.0 32.0 36.5 20.0 39.0 80-81 31.30425 35.0 32.0 36.0 19.5 37.0 82-83 30.906875 35.0 31.5 36.0 14.5 37.0 84-85 30.339625 35.0 31.0 35.0 7.0 36.5 86-87 29.787125 34.0 30.5 35.0 4.0 36.0 88-89 29.4925 34.0 30.0 35.0 2.0 36.0 90-91 29.30725 34.0 30.0 35.0 2.0 35.5 92-93 28.927125 34.0 30.0 35.0 2.0 35.0 94-95 28.6385 34.0 29.5 35.0 2.0 35.0 96-97 27.73925 34.0 27.5 35.0 2.0 35.0 98-99 27.1025 33.5 27.0 35.0 2.0 35.0 100-101 25.768875 32.0 23.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 38.0 3 4.0 4 5.0 5 8.0 6 4.0 7 10.0 8 9.0 9 9.0 10 11.0 11 15.0 12 13.0 13 21.0 14 13.0 15 9.0 16 11.0 17 17.0 18 16.0 19 18.0 20 18.0 21 23.0 22 25.0 23 28.0 24 30.0 25 41.0 26 43.0 27 42.0 28 55.0 29 58.0 30 71.0 31 78.0 32 87.0 33 135.0 34 193.0 35 253.0 36 430.0 37 935.0 38 1058.0 39 166.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.440220110055026 19.534767383691847 16.05802901450725 33.96698349174587 2 24.787393696848426 24.787393696848426 32.99149574787394 17.433716858429214 3 21.060530265132567 27.363681840920464 29.789894947473737 21.785892946473236 4 23.58679339669835 32.31615807903952 23.66183091545773 20.4352176088044 5 22.536268134067033 36.4432216108054 23.686843421710854 17.333666833416707 6 19.5 38.525 23.474999999999998 18.5 7 19.900000000000002 21.65 37.625 20.825 8 20.31015507753877 25.387693846923458 29.539769884942473 24.7623811905953 9 21.6 25.6 30.3 22.5 10-11 23.168292073018254 33.245811452863215 23.48087021755439 20.10502625656414 12-13 24.080560420315237 27.33299974981236 26.144608456342254 22.441831373530146 14-15 22.284784784784783 29.316816816816814 27.064564564564563 21.333833833833836 16-17 23.051907442151347 28.567854909318324 27.267041901188243 21.11319574734209 18-19 22.643160790197552 29.9074768692173 27.319329832458116 20.130032508127034 20-21 23.068267066766694 29.444861215303824 26.25656414103526 21.230307576894223 22-23 22.625 29.5375 26.150000000000002 21.6875 24-25 22.3375 29.2 27.4125 21.05 26-27 22.35 29.549999999999997 27.1 21.0 28-29 21.880470117529384 29.207301825456366 28.132033008252062 20.78019504876219 30-31 23.1375 29.45 26.775 20.6375 32-33 23.0375 28.95 27.6375 20.375 34-35 22.237499999999997 28.449999999999996 28.4125 20.9 36-37 22.1875 29.1375 27.537499999999998 21.1375 38-39 22.4375 28.5875 27.950000000000003 21.025 40-41 21.91797949487372 28.86971742935734 28.444611152788195 20.767691922980745 42-43 23.0375 28.3125 27.4125 21.2375 44-45 22.3 28.462500000000002 27.8375 21.4 46-47 22.55 28.512500000000003 27.287499999999998 21.65 48-49 23.2875 28.749999999999996 27.375 20.5875 50-51 22.162499999999998 29.1875 26.987499999999997 21.6625 52-53 22.1375 28.287499999999998 27.8875 21.6875 54-55 22.280570142535634 29.044761190297574 28.069517379344838 20.605151287821954 56-57 22.048524262131068 29.227113556778388 27.901450725362682 20.822911455727862 58-59 23.15578894723681 28.432108027006752 27.70692673168292 20.705176294073517 60-61 22.237499999999997 29.3875 27.55 20.825 62-63 22.7 29.0875 26.875 21.337500000000002 64-65 23.150000000000002 29.062500000000004 27.85 19.9375 66-67 22.112499999999997 30.112499999999997 26.6625 21.1125 68-69 22.6375 29.4375 26.6625 21.2625 70-71 23.025000000000002 29.25 26.2125 21.512500000000003 72-73 22.3875 29.625 26.8375 21.15 74-75 22.537499999999998 29.625 26.775 21.0625 76-77 23.125 28.65 26.9125 21.3125 78-79 22.927865983247905 28.84110513814227 25.99074884360545 22.240280035004375 80-81 23.175 30.049999999999997 25.7125 21.0625 82-83 24.125 29.262500000000003 25.5375 21.075 84-85 24.5625 29.037499999999998 25.7125 20.6875 86-87 24.4375 30.662499999999998 24.3625 20.5375 88-89 24.6 29.6375 25.224999999999998 20.5375 90-91 24.3625 31.1 23.95 20.5875 92-93 25.1875 30.075000000000003 24.55 20.1875 94-95 26.35 29.549999999999997 23.674999999999997 20.424999999999997 96-97 27.175 29.1875 22.875 20.7625 98-99 26.987499999999997 30.025000000000002 22.9625 20.025000000000002 100-101 27.6125 30.075000000000003 22.287499999999998 20.025000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 1.0 18 0.5 19 0.0 20 0.5 21 1.0 22 2.0 23 2.0 24 2.0 25 6.0 26 8.5 27 10.5 28 14.0 29 15.0 30 17.5 31 30.0 32 42.5 33 45.0 34 52.0 35 66.5 36 80.0 37 110.5 38 140.5 39 158.5 40 191.5 41 228.0 42 251.5 43 257.0 44 251.0 45 240.5 46 240.5 47 238.5 48 212.0 49 192.0 50 171.5 51 145.5 52 119.5 53 92.0 54 69.5 55 56.0 56 51.0 57 44.0 58 31.5 59 20.0 60 17.5 61 14.0 62 11.5 63 8.5 64 6.5 65 7.5 66 7.5 67 5.0 68 4.0 69 2.5 70 1.0 71 2.0 72 1.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.05 3 0.05 4 0.05 5 0.05 6 0.0 7 0.0 8 0.05 9 0.0 10-11 0.025 12-13 0.075 14-15 0.1 16-17 0.0625 18-19 0.025 20-21 0.025 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.025 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.025 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.025 56-57 0.05 58-59 0.025 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0125 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.0625 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1625 0.0 0.0 0.0 0.0 56-57 0.2875 0.0 0.0 0.0 0.0 58-59 0.3625 0.0 0.0 0.0 0.0 60-61 0.5125 0.0 0.0 0.0 0.0 62-63 0.65 0.0 0.0 0.0 0.0 64-65 0.825 0.0 0.0 0.0 0.0 66-67 1.175 0.0 0.0 0.0 0.0 68-69 1.45 0.0 0.0 0.0 0.0 70-71 1.775 0.0 0.0 0.0 0.0 72-73 2.325 0.0 0.0 0.0 0.0 74-75 2.9875 0.0 0.0 0.0 0.0 76-77 3.75 0.0 0.0 0.0 0.0 78-79 4.637499999999999 0.0 0.0 0.0 0.0 80-81 5.5625 0.0 0.0 0.0 0.0 82-83 6.5375 0.0 0.0 0.0 0.0 84-85 7.65 0.0 0.0 0.0 0.0 86-87 9.087499999999999 0.0 0.0 0.0 0.0 88-89 10.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 414379 spots for ERR1864481.sra Written 414379 spots for ERR1864481.sra Read 414379 spots for ERR1864481.sra Written 414379 spots for ERR1864481.sra Read 414379 spots for ERR1864481.sra Written 414379 spots for ERR1864481.sra Read 414379 spots for ERR1864481.sra Written 414379 spots for ERR1864481.sra Read 414379 spots for ERR1864481.sra Written 414379 spots for ERR1864481.sra Read 414379 spots for ERR1864481.sra Written 414379 spots for ERR1864481.sra Read 414379 spots for ERR1864481.sra Written 414379 spots for ERR1864481.sra Read 414379 spots for ERR1864481.sra Written 414379 spots for ERR1864481.sra Read 414379 spots for ERR1864481.sra Written 414379 spots for ERR1864481.sra Read 414379 spots for ERR1864481.sra Written 414379 spots for ERR1864481.sra Read 414379 spots for ERR1864481.sra Written 414379 spots for ERR1864481.sra Read 414379 spots for ERR1864481.sra Written 414379 spots for ERR1864481.sra Read 414379 spots for ERR1864481.sra Written 414379 spots for ERR1864481.sra Read 414379 spots for ERR1864481.sra Written 414379 spots for ERR1864481.sra Read 414394 spots for ERR1864481.sra Written 414394 spots for ERR1864481.sra Read 414379 spots for ERR1864481.sra Written 414379 spots for ERR1864481.sra Read 414379 spots for ERR1864481.sra Written 414379 spots for ERR1864481.sra Read 414379 spots for ERR1864481.sra Written 414379 spots for ERR1864481.sra Read 414379 spots for ERR1864481.sra Written 414379 spots for ERR1864481.sra Read 414379 spots for ERR1864481.sra Written 414379 spots for ERR1864481.sra SRR ids: ['ERR1864481.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rg2_hffs ERR1864481.sra spots: 8287595 blocks: [[1, 414379], [414380, 828758], [828759, 1243137], [1243138, 1657516], [1657517, 2071895], [2071896, 2486274], [2486275, 2900653], [2900654, 3315032], [3315033, 3729411], [3729412, 4143790], [4143791, 4558169], [4558170, 4972548], [4972549, 5386927], [5386928, 5801306], [5801307, 6215685], [6215686, 6630064], [6630065, 7044443], [7044444, 7458822], [7458823, 7873201], [7873202, 8287595]] ERR1864481 file size 1980702 ERR1864481 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864481 ERR1864481_1.fastq ERR1864481_2.fastq Input file: ERR1864481_1.fastq Paired file: ERR1864481_2.fastq trimmed: ERR1864481-trimmed-pair1.fastq, ERR1864481-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:04:49 2025 >> started Thu Feb 13 14:04:56 2025 >> done (7.072s) 8287595 read pairs processed; of these: 96279 ( 1.16%) short read pairs filtered out after trimming by size control 112595 ( 1.36%) empty read pairs filtered out after trimming by size control 8078721 (97.48%) read pairs available; of these: 3176717 (39.32%) trimmed read pairs available after processing 4902004 (60.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 37 0.00% 19 104 0.00% 20 111 0.00% 21 193 0.00% 22 240 0.00% 23 259 0.00% 24 333 0.00% 25 382 0.00% 26 465 0.01% 27 537 0.01% 28 620 0.01% 29 747 0.01% 30 770 0.01% 31 953 0.01% 32 1180 0.01% 33 1238 0.02% 34 1383 0.02% 35 1441 0.02% 36 1593 0.02% 37 1814 0.02% 38 1912 0.02% 39 2141 0.03% 40 2327 0.03% 41 2650 0.03% 42 2782 0.03% 43 3004 0.04% 44 3135 0.04% 45 3459 0.04% 46 3741 0.05% 47 4095 0.05% 48 4487 0.06% 49 4942 0.06% 50 5423 0.07% 51 5989 0.07% 52 6499 0.08% 53 6942 0.09% 54 7630 0.09% 55 8350 0.10% 56 8982 0.11% 57 9907 0.12% 58 11123 0.14% 59 14102 0.17% 60 16315 0.20% 61 17483 0.22% 62 18411 0.23% 63 19752 0.24% 64 21145 0.26% 65 22591 0.28% 66 23965 0.30% 67 25585 0.32% 68 27130 0.34% 69 29124 0.36% 70 31550 0.39% 71 33684 0.42% 72 36986 0.46% 73 39265 0.49% 74 42483 0.53% 75 44802 0.55% 76 47482 0.59% 77 50903 0.63% 78 53344 0.66% 79 56644 0.70% 80 60146 0.74% 81 63440 0.79% 82 67717 0.84% 83 72228 0.89% 84 76534 0.95% 85 81417 1.01% 86 84882 1.05% 87 88324 1.09% 88 90585 1.12% 89 93545 1.16% 90 97547 1.21% 91 102001 1.26% 92 105266 1.30% 93 111306 1.38% 94 118172 1.46% 95 127148 1.57% 96 137182 1.70% 97 151443 1.87% 98 172264 2.13% 99 200752 2.48% 100 278152 3.44% 101 4902004 60.68% 8078721 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=1.74 fanout-score-rank=35 prefix-density=0.24 prefix-fanout=1.0 sequence=TACCCACCTTGTGTCTCACCCTTGCGCTCATCTTTCTTGCCTCCAATGTTCAGAGTCTCCTCAATCTTGTGCATGATTCCTGCCATTGTGTATTTCTTTCTTC criterion=fanout-score sequence-density=0.06 sequence-density-rank=26 fanout-score=298.92 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=20.1 sequence=TCTTCTTCTTCCTTTGGAGCTTCGACTGC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=138.27 fanout-score-rank=4 prefix-density=0.90 prefix-fanout=17.3 sequence=AGAAGAAGAAGAG criterion=fanout-score sequence-density=0.10 sequence-density-rank=5 fanout-score=222.03 fanout-score-rank=1 prefix-density=0.90 prefix-fanout=24.0 sequence=AAGAAGAAGAAA ERR1864481 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:05:25 Started mapping on | Feb 13 14:05:25 Finished on | Feb 13 14:05:53 Mapping speed, Million of reads per hour | 1038.69 Number of input reads | 8078721 Average input read length | 190 UNIQUE READS: Uniquely mapped reads number | 7723497 Uniquely mapped reads % | 95.60% Average mapped length | 190.40 Number of splices: Total | 3678260 Number of splices: Annotated (sjdb) | 3597575 Number of splices: GT/AG | 3622346 Number of splices: GC/AG | 46172 Number of splices: AT/AC | 3533 Number of splices: Non-canonical | 6209 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 2.31 Insertion rate per base | 0.01% Insertion average length | 2.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 195716 % of reads mapped to multiple loci | 2.42% Number of reads mapped to too many loci | 11784 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.82% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 171085 171085 171085 N_multimapping 195716 195716 195716 N_noFeature 383994 7581915 463364 N_ambiguous 91903 558 29274 UnstrandedReadsAssigned:7247600 PositiveStrandReadsAssigned:141024 NegativeStrandReadsAssigned:7230859 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=91 echo kmer=87 ERR1864481 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864481-trimmed-pair1.fastq ERR1864481-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,078,721 reads, 7,311,211 reads pseudoaligned [quant] estimated average fragment length: 124.52 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,193 rounds 52401 ERR1864481.ke.tsv 34699 ERR1864481.se.tsv 87100 total ==> ERR1864481.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1894.48 240 24.7746 Potri.005G024800.1.v4.1 1035 911.48 104 22.3137 Potri.004G059700.1.v4.1 961 837.48 1 0.233513 Potri.007G009000.2.v4.1 1416 1292.48 0 0 Potri.003G141000.2.v4.1 2943 2819.48 231 16.0224 Potri.016G087400.1.v4.1 270 148.084 232 306.384 Potri.015G069301.1.v4.1 564 440.511 0 0 Potri.010G195200.1.v4.1 1773 1649.48 27 3.20112 Potri.012G127500.1.v4.1 977 853.48 771 176.664 ==> ERR1864481.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 893 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 161 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 ERR1864481 completed mapping pipeline successfully