Starting /dee2/code/volunteer_pipeline.sh ERR1864482 current disk space = 3090313363456 free memory = 1581547716 ERR1864482 SRAfilesize bb8b7f1fceae5ab16bb23347f1350c9f ERR1864482.sra ERR1864482.sra file validated ERR1864482 is paired end ERR1864482 is conventional basespace ERR1864482 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864482_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.77475 33.0 31.0 34.0 28.0 34.0 2 31.43425 34.0 31.0 34.0 27.0 34.0 3 31.92925 34.0 31.0 34.0 28.0 34.0 4 35.34375 37.0 35.0 37.0 33.0 37.0 5 35.2025 37.0 35.0 37.0 33.0 37.0 6 35.08575 37.0 35.0 37.0 32.0 37.0 7 34.9695 37.0 35.0 37.0 32.0 37.0 8 34.99725 37.0 35.0 37.0 32.0 37.0 9 36.70275 39.0 37.0 39.0 32.0 39.0 10-11 36.686125 39.0 37.0 39.0 32.5 39.0 12-13 36.621 39.0 37.0 39.0 32.5 39.0 14-15 37.9055 40.5 38.0 41.0 32.5 41.0 16-17 37.743625 40.0 38.0 41.0 32.0 41.0 18-19 37.754125 40.0 38.0 41.0 32.0 41.0 20-21 37.654375 40.0 38.0 41.0 32.0 41.0 22-23 37.57925 40.0 38.0 41.0 32.0 41.0 24-25 37.542625 40.0 38.0 41.0 32.0 41.0 26-27 37.42775 40.0 38.0 41.0 31.5 41.0 28-29 37.318 40.0 38.0 41.0 31.0 41.0 30-31 37.120625 40.0 37.0 41.0 30.0 41.0 32-33 37.134125 40.0 37.0 41.0 31.0 41.0 34-35 36.96275 40.0 37.0 41.0 30.0 41.0 36-37 36.86275 40.0 37.0 41.0 30.0 41.0 38-39 36.690875 40.0 37.0 41.0 30.0 41.0 40-41 36.5075 40.0 36.5 41.0 30.0 41.0 42-43 36.22225 40.0 36.0 41.0 28.5 41.0 44-45 36.229875 40.0 36.0 41.0 29.0 41.0 46-47 36.345 40.0 36.5 41.0 29.5 41.0 48-49 36.260125 40.0 36.0 41.0 28.5 41.0 50-51 36.101375000000004 40.0 35.5 41.0 28.0 41.0 52-53 35.885625000000005 40.0 35.5 41.0 27.5 41.0 54-55 35.610375000000005 39.5 35.0 41.0 26.5 41.0 56-57 35.394375 39.0 35.0 41.0 26.0 41.0 58-59 35.159 39.0 35.0 41.0 26.0 41.0 60-61 34.9305 38.5 34.0 40.5 26.0 41.0 62-63 34.627250000000004 38.0 34.0 40.0 26.0 41.0 64-65 34.37575 38.0 34.0 40.0 25.5 41.0 66-67 33.979625 37.0 34.0 40.0 24.0 41.0 68-69 33.6605 36.5 33.0 39.0 24.0 41.0 70-71 33.224999999999994 36.0 33.0 39.0 24.0 40.5 72-73 32.64725 35.5 32.0 38.5 22.0 40.0 74-75 32.15175 35.0 32.0 37.5 20.5 39.0 76-77 31.119500000000002 34.0 30.5 36.0 19.0 39.0 78-79 31.30175 35.0 31.0 36.0 18.0 39.0 80-81 31.127499999999998 35.0 32.0 36.0 18.5 37.0 82-83 30.821875 35.0 31.0 36.0 14.5 37.0 84-85 30.354374999999997 34.0 31.0 35.0 7.0 36.5 86-87 29.788249999999998 34.0 30.5 35.0 4.5 36.0 88-89 29.59925 34.0 30.0 35.0 2.0 36.0 90-91 29.417749999999998 34.0 30.0 35.0 2.0 35.5 92-93 29.009625 34.0 29.5 35.0 2.0 35.0 94-95 28.6265 34.0 29.0 35.0 2.0 35.0 96-97 28.453125 34.0 29.0 35.0 2.0 35.0 98-99 28.0385 34.0 29.0 35.0 2.0 35.0 100-101 26.943125000000002 33.0 27.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 49.0 3 16.0 4 14.0 5 8.0 6 8.0 7 9.0 8 8.0 9 13.0 10 9.0 11 11.0 12 14.0 13 13.0 14 9.0 15 14.0 16 9.0 17 8.0 18 24.0 19 17.0 20 20.0 21 27.0 22 27.0 23 22.0 24 28.0 25 45.0 26 29.0 27 29.0 28 58.0 29 55.0 30 80.0 31 77.0 32 116.0 33 137.0 34 202.0 35 294.0 36 413.0 37 856.0 38 1090.0 39 142.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.50348567002324 4.90575781048283 6.687322489026594 37.90343403046734 2 29.175 6.825 31.1 32.9 3 28.375 9.925 22.875 38.824999999999996 4 32.35 16.35 20.325 30.975 5 31.39854891168376 20.61546159619715 25.093820365273956 22.892169126845133 6 23.5 26.275 26.450000000000003 23.775 7 19.125 21.375 43.65 15.85 8 18.575 24.075 34.125 23.225 9 19.900000000000002 20.8 39.800000000000004 19.5 10-11 21.735867933966986 32.35367683841921 28.47673836918459 17.433716858429214 12-13 22.0360180090045 26.613306653326664 31.378189094547277 19.97248624312156 14-15 20.36018009004502 27.351175587793897 31.51575787893947 20.772886443221612 16-17 22.386193096548272 27.901450725362682 28.88944472236118 20.822911455727862 18-19 21.5607803901951 29.014507253626814 28.80190095047524 20.62281140570285 20-21 21.57328664332166 28.289144572286144 28.901950975487743 21.235617808904454 22-23 21.075672295184493 28.943089430894307 29.155722326454033 20.825515947467167 24-25 21.273136568284144 27.251125562781393 29.00200100050025 22.473736868434216 26-27 20.74787393696848 28.55177588794397 27.938969484742373 22.761380690345174 28-29 22.373686843421712 28.05152576288144 28.301650825412704 21.273136568284144 30-31 21.010505252626313 28.189094547273637 28.68934467233617 22.11105552776388 32-33 20.587867417135712 26.991869918699184 29.51844903064415 22.901813633520952 34-35 21.273136568284144 27.60130065032516 28.70185092546273 22.423711855927962 36-37 20.99799899949975 26.80090045022511 28.864432216108053 23.336668334167083 38-39 21.1855927963982 27.026013006503252 28.939469734867433 22.848924462231114 40-41 21.14807403701851 27.788894447223612 28.564282141070535 22.498749374687343 42-43 20.947973986993496 28.226613306653327 28.489244622311155 22.336168084042022 44-45 21.341005754315738 27.370527895921942 28.8591443582687 22.42932199149362 46-47 21.891418563922944 27.858393795346508 28.29622216662497 21.95396547410558 48-49 20.54777388694347 28.08904452226113 28.76438219109555 22.59879939969985 50-51 21.53576788394197 27.126063031515756 28.73936968484242 22.59879939969985 52-53 21.797442968162446 27.851591877663573 28.979694158937075 21.3712709952369 54-55 21.813633520950596 28.005003126954346 27.74233896185116 22.439024390243905 56-57 21.392848212053014 27.7569392348087 28.219554888722183 22.630657664416105 58-59 22.28614307153577 28.039019509754876 28.61430715357679 21.060530265132567 60-61 21.435717858929465 27.5887943971986 28.289144572286144 22.686343171585793 62-63 21.987499999999997 27.05 29.262500000000003 21.7 64-65 21.2375 27.675 28.449999999999996 22.6375 66-67 21.1625 29.175 27.712500000000002 21.95 68-69 21.725 28.050000000000004 28.0625 22.162499999999998 70-71 22.3125 27.325 28.0875 22.275 72-73 22.0 28.6625 27.762500000000003 21.575 74-75 21.675 27.900000000000002 27.987499999999997 22.4375 76-77 21.9375 28.299999999999997 27.962500000000002 21.8 78-79 22.500312851958455 28.807408334376174 26.930296583656617 21.761982230008762 80-81 21.9777472184023 28.62857857232154 27.00337542192774 22.39029878734842 82-83 22.758534450418907 29.235963486307366 26.7725397023884 21.23296236088533 84-85 21.587500000000002 28.449999999999996 28.15 21.8125 86-87 22.125 28.0625 26.325 23.4875 88-89 21.675 28.9 27.525 21.9 90-91 22.975 28.762500000000003 25.9625 22.3 92-93 22.675 28.775000000000002 26.474999999999998 22.075 94-95 23.200000000000003 28.325 26.450000000000003 22.025 96-97 23.400000000000002 29.1375 25.2125 22.25 98-99 23.799999999999997 29.0875 25.412499999999998 21.7 100-101 23.549999999999997 30.312499999999996 24.1125 22.025 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.5 19 1.0 20 0.0 21 1.5 22 3.0 23 2.5 24 5.5 25 9.0 26 5.5 27 4.0 28 7.0 29 13.0 30 18.5 31 22.5 32 27.0 33 32.5 34 48.5 35 68.0 36 78.5 37 103.5 38 126.0 39 151.5 40 183.0 41 198.5 42 219.5 43 246.5 44 268.5 45 275.5 46 266.0 47 250.0 48 222.0 49 198.0 50 169.5 51 142.5 52 120.0 53 98.5 54 88.5 55 65.5 56 47.0 57 38.0 58 31.0 59 23.5 60 21.0 61 19.0 62 17.5 63 18.0 64 13.5 65 10.0 66 7.5 67 4.0 68 1.5 69 2.0 70 2.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.175 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.05 12-13 0.05 14-15 0.05 16-17 0.05 18-19 0.05 20-21 0.05 22-23 0.0625 24-25 0.05 26-27 0.05 28-29 0.05 30-31 0.05 32-33 0.0625 34-35 0.05 36-37 0.05 38-39 0.05 40-41 0.05 42-43 0.05 44-45 0.075 46-47 0.075 48-49 0.05 50-51 0.05 52-53 0.27499999999999997 54-55 0.0625 56-57 0.025 58-59 0.05 60-61 0.05 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.11249999999999999 80-81 0.0125 82-83 0.0375 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.08952959028832 97.95 2 0.7334344967121902 1.4500000000000002 3 0.15174506828528073 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.025290844714213456 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTACGTAATCTCGTAT 6 0.15 TruSeq Adapter, Index 22 (97% over 40bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.1125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.225 0.0 0.0 0.0 0.0 62-63 0.325 0.0 0.0 0.0 0.0 64-65 0.4625 0.0 0.0 0.0 0.0 66-67 0.5625 0.0 0.0 0.0 0.0 68-69 0.7375 0.0 0.0 0.0 0.0 70-71 0.9625 0.0 0.0 0.0 0.0 72-73 1.2125 0.0 0.0 0.0 0.0 74-75 1.6625 0.0 0.0 0.0 0.0 76-77 2.1875 0.0 0.0 0.0 0.0 78-79 2.6625 0.0 0.0 0.0 0.0 80-81 3.325 0.0 0.0 0.0 0.0 82-83 4.1125 0.0 0.0 0.0 0.0 84-85 5.025 0.0 0.0 0.0 0.0 86-87 5.9125 0.0 0.0 0.0 0.0 88-89 7.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864482 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864482_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.62225 34.0 31.0 34.0 30.0 34.0 2 31.683 34.0 31.0 34.0 30.0 34.0 3 31.657 34.0 31.0 34.0 30.0 34.0 4 34.97875 37.0 35.0 37.0 33.0 37.0 5 34.96225 37.0 35.0 37.0 32.0 37.0 6 35.04475 37.0 35.0 37.0 32.0 37.0 7 35.052 37.0 35.0 37.0 33.0 37.0 8 35.05075 37.0 35.0 37.0 33.0 37.0 9 36.51 39.0 37.0 39.0 32.0 39.0 10-11 36.46325 39.0 37.0 39.0 32.5 39.0 12-13 36.32725000000001 39.0 37.0 39.0 32.0 39.0 14-15 37.64125 41.0 38.0 41.0 32.0 41.0 16-17 37.517375 40.5 38.0 41.0 32.0 41.0 18-19 37.562 40.0 38.0 41.0 32.0 41.0 20-21 37.4805 40.0 38.0 41.0 32.0 41.0 22-23 37.278 40.0 38.0 41.0 31.0 41.0 24-25 37.336625 40.0 38.0 41.0 31.0 41.0 26-27 37.257625000000004 40.0 38.0 41.0 31.0 41.0 28-29 37.02725 40.0 38.0 41.0 30.0 41.0 30-31 36.973875 40.0 37.5 41.0 30.5 41.0 32-33 36.786125 40.0 38.0 41.0 30.0 41.0 34-35 36.669125 40.0 37.0 41.0 30.0 41.0 36-37 36.538375 40.0 37.0 41.0 29.5 41.0 38-39 36.513374999999996 40.0 37.0 41.0 29.5 41.0 40-41 36.347875 40.0 37.0 41.0 29.5 41.0 42-43 36.29075 40.0 37.0 41.0 29.0 41.0 44-45 36.204 40.0 37.0 41.0 29.5 41.0 46-47 35.824 39.5 36.0 41.0 28.0 41.0 48-49 35.697874999999996 39.0 36.0 41.0 26.5 41.0 50-51 35.37475 38.5 35.5 40.5 26.5 41.0 52-53 35.536375 39.0 36.0 40.5 27.5 41.0 54-55 35.791624999999996 40.0 36.0 41.0 27.0 41.0 56-57 35.589124999999996 39.5 36.0 41.0 26.5 41.0 58-59 35.311499999999995 39.0 35.0 41.0 25.5 41.0 60-61 35.076375 39.0 35.0 41.0 25.0 41.0 62-63 34.849000000000004 39.0 35.0 41.0 25.5 41.0 64-65 34.449 38.0 34.0 40.0 23.5 41.0 66-67 34.056375 37.5 34.0 40.0 23.0 41.0 68-69 33.632999999999996 37.0 34.0 39.5 22.0 41.0 70-71 33.16475 36.5 33.5 39.0 21.5 41.0 72-73 32.738749999999996 36.0 33.0 39.0 21.0 40.0 74-75 32.2725 35.0 33.0 37.5 19.5 39.5 76-77 31.425625 35.0 31.5 37.0 16.0 39.0 78-79 31.225250000000003 35.0 31.0 36.5 15.0 39.0 80-81 30.856 35.0 31.0 36.0 9.0 37.0 82-83 30.387 35.0 31.0 36.0 4.5 37.0 84-85 30.006124999999997 35.0 31.0 35.0 2.0 36.5 86-87 29.56025 34.0 30.5 35.0 2.0 36.0 88-89 29.177 34.0 29.5 35.0 2.0 36.0 90-91 29.061999999999998 34.0 30.0 35.0 2.0 35.0 92-93 28.69475 34.0 29.0 35.0 2.0 35.0 94-95 28.402875 34.0 29.0 35.0 2.0 35.0 96-97 27.50675 34.0 27.0 35.0 2.0 35.0 98-99 26.943125000000002 33.5 26.5 35.0 2.0 35.0 100-101 25.674875 32.0 22.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 68.0 3 23.0 4 11.0 5 6.0 6 4.0 7 7.0 8 13.0 9 11.0 10 11.0 11 21.0 12 14.0 13 14.0 14 14.0 15 22.0 16 15.0 17 20.0 18 6.0 19 15.0 20 13.0 21 16.0 22 19.0 23 21.0 24 37.0 25 32.0 26 37.0 27 46.0 28 58.0 29 63.0 30 56.0 31 73.0 32 117.0 33 128.0 34 181.0 35 284.0 36 450.0 37 841.0 38 1069.0 39 164.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.80880880880881 21.52152152152152 12.637637637637638 32.032032032032035 2 24.424424424424423 26.75175175175175 31.206206206206204 17.61761761761762 3 19.244244244244243 29.129129129129126 29.87987987987988 21.746746746746748 4 23.053817271589487 33.69211514392991 22.753441802252816 20.500625782227786 5 24.974974974974977 35.93593593593594 21.846846846846844 17.24224224224224 6 18.975 40.275 22.3 18.45 7 18.675 22.225 38.375 20.724999999999998 8 20.130032508127034 24.831207801950487 28.732183045761438 26.30657664416104 9 21.925 24.775 29.7 23.599999999999998 10-11 23.052881610201275 32.666583322915365 23.140392549068633 21.140142517814727 12-13 22.778473091364205 26.270337922403 27.284105131414265 23.667083854818525 14-15 21.545784792684454 28.07215332581736 28.397845421520735 21.98421645997745 16-17 22.82567888874984 28.61969715930422 26.89275434864222 21.661869603303714 18-19 22.213883677298313 28.342714196372732 27.754846779237024 21.68855534709193 20-21 22.545954733024885 28.460672752282107 27.085156933850197 21.908215580842814 22-23 22.6875 27.825 27.625 21.8625 24-25 21.8125 28.449999999999996 28.050000000000004 21.6875 26-27 22.3625 29.4875 27.975 20.175 28-29 22.602825353169145 29.47868483560445 26.665833229153645 21.25265658207276 30-31 21.375 29.1625 27.5125 21.95 32-33 22.5 29.362500000000004 26.650000000000002 21.4875 34-35 22.162499999999998 28.625 27.3375 21.875 36-37 21.712500000000002 29.9 27.224999999999998 21.1625 38-39 21.475 29.037499999999998 27.55 21.9375 40-41 21.783168688258097 29.073402525947227 27.3477554082781 21.795673377516568 42-43 21.85 28.849999999999998 27.762500000000003 21.5375 44-45 22.6125 28.762500000000003 26.8375 21.7875 46-47 21.912499999999998 28.037499999999998 28.050000000000004 22.0 48-49 22.125 28.6875 28.1375 21.05 50-51 22.3625 27.8625 28.212500000000002 21.5625 52-53 22.287499999999998 28.775000000000002 27.8875 21.05 54-55 22.311155577788895 28.58929464732366 27.301150575287643 21.7983991995998 56-57 21.283783783783782 29.304304304304303 27.55255255255255 21.85935935935936 58-59 22.00825309491059 28.010503938977116 28.548205577091405 21.433037389020885 60-61 21.9375 29.5875 27.175 21.3 62-63 22.025 29.049999999999997 27.1375 21.7875 64-65 22.662499999999998 28.787499999999998 27.187499999999996 21.3625 66-67 22.237499999999997 29.012500000000003 27.625 21.125 68-69 22.3375 29.599999999999998 26.775 21.2875 70-71 22.7375 28.975 26.787499999999998 21.5 72-73 21.825 28.799999999999997 27.625 21.75 74-75 22.537499999999998 29.099999999999998 27.3875 20.974999999999998 76-77 23.25 28.7 26.8125 21.2375 78-79 22.537499999999998 28.812500000000004 27.6 21.05 80-81 23.27790973871734 28.766095761970245 27.065883235404424 20.890111263907986 82-83 23.974999999999998 28.65 26.200000000000003 21.175 84-85 23.875 27.950000000000003 26.0 22.175 86-87 23.1 28.6625 26.424999999999997 21.8125 88-89 23.9 29.625 25.4 21.075 90-91 24.712500000000002 29.362500000000004 25.887500000000003 20.0375 92-93 24.25 29.2 25.2625 21.2875 94-95 24.65 29.4125 24.9375 21.0 96-97 24.8 29.675 24.9 20.625 98-99 26.0375 29.75 24.1125 20.1 100-101 25.974999999999998 29.5375 23.4125 21.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 1.0 15 1.0 16 0.0 17 0.5 18 0.5 19 1.0 20 1.5 21 1.0 22 1.5 23 2.5 24 3.0 25 5.0 26 6.5 27 8.0 28 11.0 29 16.5 30 22.5 31 29.5 32 40.5 33 48.5 34 57.5 35 74.0 36 94.5 37 108.0 38 126.5 39 161.5 40 188.5 41 209.5 42 225.0 43 248.5 44 268.0 45 264.5 46 249.0 47 235.0 48 217.5 49 195.5 50 169.0 51 132.0 52 110.0 53 95.0 54 72.5 55 56.5 56 45.5 57 35.0 58 27.0 59 24.5 60 24.5 61 19.5 62 15.0 63 11.0 64 8.0 65 5.0 66 3.5 67 1.5 68 3.0 69 4.0 70 3.0 71 2.5 72 1.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.1 3 0.1 4 0.125 5 0.1 6 0.0 7 0.0 8 0.025 9 0.0 10-11 0.0125 12-13 0.125 14-15 0.21250000000000002 16-17 0.11249999999999999 18-19 0.0625 20-21 0.0375 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0125 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0375 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.05 56-57 0.1 58-59 0.0375 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0125 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.1125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.225 0.0 0.0 0.0 0.0 62-63 0.35 0.0 0.0 0.0 0.0 64-65 0.475 0.0 0.0 0.0 0.0 66-67 0.5625 0.0 0.0 0.0 0.0 68-69 0.7875 0.0 0.0 0.0 0.0 70-71 1.0375 0.0 0.0 0.0 0.0 72-73 1.2875 0.0 0.0 0.0 0.0 74-75 1.75 0.0 0.0 0.0 0.0 76-77 2.2375 0.0 0.0 0.0 0.0 78-79 2.7750000000000004 0.0 0.0 0.0 0.0 80-81 3.4625 0.0 0.0 0.0 0.0 82-83 4.25 0.0 0.0 0.0 0.0 84-85 5.1625 0.0 0.0 0.0 0.0 86-87 5.987500000000001 0.0 0.0 0.0 0.0 88-89 7.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 451867 spots for ERR1864482.sra Written 451867 spots for ERR1864482.sra Read 451867 spots for ERR1864482.sra Written 451867 spots for ERR1864482.sra Read 451867 spots for ERR1864482.sra Written 451867 spots for ERR1864482.sra Read 451867 spots for ERR1864482.sra Written 451867 spots for ERR1864482.sra Read 451867 spots for ERR1864482.sra Written 451867 spots for ERR1864482.sra Read 451867 spots for ERR1864482.sra Written 451867 spots for ERR1864482.sra Read 451867 spots for ERR1864482.sra Written 451867 spots for ERR1864482.sra Read 451867 spots for ERR1864482.sra Written 451867 spots for ERR1864482.sra Read 451867 spots for ERR1864482.sra Written 451867 spots for ERR1864482.sra Read 451867 spots for ERR1864482.sra Written 451867 spots for ERR1864482.sra Read 451867 spots for ERR1864482.sra Written 451867 spots for ERR1864482.sra Read 451867 spots for ERR1864482.sra Written 451867 spots for ERR1864482.sra Read 451867 spots for ERR1864482.sra Written 451867 spots for ERR1864482.sra Read 451867 spots for ERR1864482.sra Written 451867 spots for ERR1864482.sra Read 451867 spots for ERR1864482.sra Written 451867 spots for ERR1864482.sra Read 451867 spots for ERR1864482.sra Written 451867 spots for ERR1864482.sra Read 451867 spots for ERR1864482.sra Written 451867 spots for ERR1864482.sra Read 451867 spots for ERR1864482.sra Written 451867 spots for ERR1864482.sra Read 451867 spots for ERR1864482.sra Written 451867 spots for ERR1864482.sra Read 451880 spots for ERR1864482.sra Written 451880 spots for ERR1864482.sra SRR ids: ['ERR1864482.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jpxyb2wd ERR1864482.sra spots: 9037353 blocks: [[1, 451867], [451868, 903734], [903735, 1355601], [1355602, 1807468], [1807469, 2259335], [2259336, 2711202], [2711203, 3163069], [3163070, 3614936], [3614937, 4066803], [4066804, 4518670], [4518671, 4970537], [4970538, 5422404], [5422405, 5874271], [5874272, 6326138], [6326139, 6778005], [6778006, 7229872], [7229873, 7681739], [7681740, 8133606], [8133607, 8585473], [8585474, 9037353]] ERR1864482 file size 2160088 ERR1864482 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864482 ERR1864482_1.fastq ERR1864482_2.fastq Input file: ERR1864482_1.fastq Paired file: ERR1864482_2.fastq trimmed: ERR1864482-trimmed-pair1.fastq, ERR1864482-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:53:35 2025 >> started Thu Feb 13 13:53:45 2025 >> done (9.180s) 9037353 read pairs processed; of these: 144920 ( 1.60%) short read pairs filtered out after trimming by size control 197682 ( 2.19%) empty read pairs filtered out after trimming by size control 8694751 (96.21%) read pairs available; of these: 3040180 (34.97%) trimmed read pairs available after processing 5654571 (65.03%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 56 0.00% 19 90 0.00% 20 152 0.00% 21 196 0.00% 22 263 0.00% 23 302 0.00% 24 369 0.00% 25 422 0.00% 26 508 0.01% 27 627 0.01% 28 733 0.01% 29 868 0.01% 30 952 0.01% 31 1023 0.01% 32 1270 0.01% 33 1453 0.02% 34 1583 0.02% 35 1668 0.02% 36 1781 0.02% 37 1976 0.02% 38 2100 0.02% 39 2355 0.03% 40 2463 0.03% 41 2732 0.03% 42 2909 0.03% 43 3172 0.04% 44 3376 0.04% 45 3634 0.04% 46 3776 0.04% 47 4135 0.05% 48 4494 0.05% 49 4922 0.06% 50 5342 0.06% 51 5804 0.07% 52 6302 0.07% 53 6898 0.08% 54 7177 0.08% 55 7738 0.09% 56 8357 0.10% 57 9398 0.11% 58 10210 0.12% 59 14096 0.16% 60 17548 0.20% 61 18446 0.21% 62 19183 0.22% 63 20121 0.23% 64 20859 0.24% 65 21772 0.25% 66 23118 0.27% 67 24555 0.28% 68 25783 0.30% 69 27169 0.31% 70 29376 0.34% 71 31098 0.36% 72 33735 0.39% 73 36145 0.42% 74 38502 0.44% 75 40181 0.46% 76 42580 0.49% 77 45243 0.52% 78 48133 0.55% 79 50618 0.58% 80 54344 0.63% 81 56777 0.65% 82 61432 0.71% 83 64889 0.75% 84 69427 0.80% 85 73536 0.85% 86 76643 0.88% 87 79713 0.92% 88 82301 0.95% 89 84873 0.98% 90 89686 1.03% 91 94473 1.09% 92 98447 1.13% 93 105540 1.21% 94 110727 1.27% 95 121472 1.40% 96 132546 1.52% 97 149480 1.72% 98 174341 2.01% 99 209539 2.41% 100 298147 3.43% 101 5654571 65.03% 8694751 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=32 prefix-density=0.16 prefix-fanout=2.0 sequence=CACCTCTTTAGT criterion=fanout-score sequence-density=0.08 sequence-density-rank=23 fanout-score=240.00 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=22.8 sequence=TTCTTCTTCTTT criterion=sequence-density sequence-density=0.12 sequence-density-rank=2 fanout-score=3.03 fanout-score-rank=37 prefix-density=0.14 prefix-fanout=2.6 sequence=TGCAGCATCTGA criterion=fanout-score sequence-density=0.08 sequence-density-rank=11 fanout-score=227.80 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=21.4 sequence=AAGAAGAAGAAG ERR1864482 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:54:16 Started mapping on | Feb 13 13:54:16 Finished on | Feb 13 13:54:37 Mapping speed, Million of reads per hour | 1490.53 Number of input reads | 8694751 Average input read length | 191 UNIQUE READS: Uniquely mapped reads number | 8379385 Uniquely mapped reads % | 96.37% Average mapped length | 191.71 Number of splices: Total | 4103887 Number of splices: Annotated (sjdb) | 4015108 Number of splices: GT/AG | 4043169 Number of splices: GC/AG | 49976 Number of splices: AT/AC | 4123 Number of splices: Non-canonical | 6619 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 2.35 Insertion rate per base | 0.01% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 205907 % of reads mapped to multiple loci | 2.37% Number of reads mapped to too many loci | 21921 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.99% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 136355 136355 136355 N_multimapping 205907 205907 205907 N_noFeature 386521 8226530 477571 N_ambiguous 98554 723 36238 UnstrandedReadsAssigned:7894310 PositiveStrandReadsAssigned:152132 NegativeStrandReadsAssigned:7865576 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=94 echo kmer=89 ERR1864482 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864482-trimmed-pair1.fastq ERR1864482-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,694,751 reads, 7,960,409 reads pseudoaligned [quant] estimated average fragment length: 133.569 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,119 rounds 52401 ERR1864482.ke.tsv 34699 ERR1864482.se.tsv 87100 total ==> ERR1864482.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1885.43 331 30.3983 Potri.005G024800.1.v4.1 1035 902.431 93 17.8444 Potri.004G059700.1.v4.1 961 828.431 1 0.209014 Potri.007G009000.2.v4.1 1416 1283.43 0 0 Potri.003G141000.2.v4.1 2943 2810.43 244 15.0331 Potri.016G087400.1.v4.1 270 140.803 250 307.44 Potri.015G069301.1.v4.1 564 431.487 0 0 Potri.010G195200.1.v4.1 1773 1640.43 22 2.32218 Potri.012G127500.1.v4.1 977 844.431 1265 259.393 ==> ERR1864482.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1420 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 204 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 ERR1864482 completed mapping pipeline successfully