Starting /dee2/code/volunteer_pipeline.sh ERR1864483 current disk space = 3090092597248 free memory = 1436241008 ERR1864483 SRAfilesize 4321f29a97f46e6cdea621f1b03a6a62 ERR1864483.sra ERR1864483.sra file validated ERR1864483 is paired end ERR1864483 is conventional basespace ERR1864483 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864483_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.8165 34.0 31.0 34.0 30.0 34.0 2 31.92275 34.0 31.0 34.0 30.0 34.0 3 32.2195 34.0 31.0 34.0 30.0 34.0 4 35.687 37.0 35.0 37.0 35.0 37.0 5 35.438 37.0 35.0 37.0 33.0 37.0 6 35.43025 37.0 35.0 37.0 33.0 37.0 7 35.3755 37.0 35.0 37.0 33.0 37.0 8 35.34025 37.0 35.0 37.0 33.0 37.0 9 37.0725 39.0 38.0 39.0 34.0 39.0 10-11 36.96675 39.0 37.5 39.0 33.0 39.0 12-13 36.887 39.0 37.0 39.0 33.0 39.0 14-15 38.2825 41.0 38.5 41.0 33.5 41.0 16-17 38.257125 41.0 38.0 41.0 33.5 41.0 18-19 38.21825 41.0 38.5 41.0 34.0 41.0 20-21 38.115375 40.5 38.5 41.0 33.0 41.0 22-23 37.947 40.0 38.0 41.0 33.0 41.0 24-25 37.891625000000005 40.0 38.0 41.0 33.0 41.0 26-27 37.797 40.0 38.0 41.0 32.5 41.0 28-29 37.675 40.0 38.0 41.0 32.0 41.0 30-31 37.662625 40.0 38.0 41.0 32.0 41.0 32-33 37.5565 40.0 38.0 41.0 32.5 41.0 34-35 37.399 40.0 38.0 41.0 32.0 41.0 36-37 37.24125 40.0 38.0 41.0 31.0 41.0 38-39 37.12025 40.0 37.0 41.0 31.0 41.0 40-41 37.000375000000005 40.0 37.0 41.0 31.0 41.0 42-43 36.820125 40.0 37.0 41.0 30.0 41.0 44-45 36.89 40.0 37.0 41.0 30.5 41.0 46-47 37.158375 40.0 37.0 41.0 31.5 41.0 48-49 37.0205 40.0 37.0 41.0 31.0 41.0 50-51 36.837625 40.0 37.0 41.0 30.5 41.0 52-53 36.538875000000004 40.0 36.0 41.0 30.0 41.0 54-55 36.402125 40.0 36.0 41.0 30.0 41.0 56-57 36.08325 39.0 35.5 41.0 28.5 41.0 58-59 35.927499999999995 39.0 35.0 41.0 29.0 41.0 60-61 35.800125 39.0 35.0 40.0 28.5 41.0 62-63 35.444625 38.5 35.0 40.0 28.0 41.0 64-65 35.028125 38.0 34.5 40.0 27.5 41.0 66-67 34.703125 37.0 34.0 40.0 27.5 41.0 68-69 34.226875 37.0 34.0 39.5 26.0 41.0 70-71 33.9255 36.0 34.0 39.0 26.0 40.5 72-73 33.453625 36.0 33.0 38.5 26.0 40.0 74-75 33.094125 35.0 33.0 37.5 26.0 39.0 76-77 32.048874999999995 34.5 31.5 36.5 24.5 39.0 78-79 32.30175 35.0 32.5 36.5 25.5 38.5 80-81 32.020125 35.0 32.5 36.0 25.0 37.0 82-83 31.76325 35.0 32.0 36.0 25.0 37.0 84-85 31.51075 35.0 32.0 35.0 24.5 36.5 86-87 31.15425 34.0 32.0 35.0 23.0 36.0 88-89 30.824125 34.0 31.0 35.0 20.5 36.0 90-91 30.61375 34.0 31.0 35.0 21.0 35.5 92-93 30.374125 34.0 31.0 35.0 19.5 35.0 94-95 30.06725 34.0 31.0 35.0 18.0 35.0 96-97 29.882125000000002 34.0 31.0 35.0 13.5 35.0 98-99 29.549500000000002 34.0 31.0 35.0 2.0 35.0 100-101 28.822000000000003 33.5 29.5 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 36.0 3 20.0 4 16.0 5 5.0 6 5.0 7 10.0 8 8.0 9 4.0 10 5.0 11 11.0 12 5.0 13 5.0 14 20.0 15 10.0 16 8.0 17 11.0 18 13.0 19 6.0 20 10.0 21 8.0 22 15.0 23 12.0 24 14.0 25 21.0 26 28.0 27 34.0 28 53.0 29 65.0 30 64.0 31 64.0 32 111.0 33 135.0 34 188.0 35 278.0 36 442.0 37 901.0 38 1228.0 39 131.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.41310397166709 5.894257525929674 8.069820389577536 46.622818112825705 2 25.825 8.674999999999999 31.874999999999996 33.625 3 24.324324324324326 11.936936936936938 21.346346346346344 42.392392392392395 4 28.925 19.35 20.549999999999997 31.175000000000004 5 27.775 24.85 25.775 21.6 6 22.6 28.175 26.25 22.975 7 15.825 23.575 43.7 16.900000000000002 8 18.099999999999998 24.45 35.199999999999996 22.25 9 18.475 23.775 37.15 20.599999999999998 10-11 19.6875 32.75 28.4375 19.125 12-13 21.15 26.1 29.75 23.0 14-15 20.025000000000002 28.7 30.012499999999996 21.2625 16-17 21.087500000000002 27.474999999999998 29.6875 21.75 18-19 20.7375 28.525 27.825 22.912499999999998 20-21 21.4 29.4125 27.400000000000002 21.7875 22-23 20.837500000000002 28.449999999999996 28.000000000000004 22.7125 24-25 21.0625 27.5875 28.15 23.200000000000003 26-27 21.3875 27.325 28.199999999999996 23.0875 28-29 21.75 27.8375 28.325 22.0875 30-31 20.7 27.700000000000003 28.15 23.45 32-33 21.0125 27.212500000000002 28.4 23.375 34-35 22.05 27.537499999999998 27.9375 22.475 36-37 20.6625 28.462500000000002 28.025 22.85 38-39 21.425 27.474999999999998 27.6625 23.4375 40-41 21.099999999999998 27.987499999999997 28.1375 22.775000000000002 42-43 21.087500000000002 28.1875 28.3625 22.3625 44-45 19.325 28.95 28.0875 23.6375 46-47 20.5375 27.375 28.462500000000002 23.625 48-49 21.425 27.712500000000002 27.987499999999997 22.875 50-51 20.2375 28.262500000000003 28.375 23.125 52-53 21.05 28.3875 26.787499999999998 23.775 54-55 21.0375 28.1125 28.1375 22.7125 56-57 20.2625 27.675 28.000000000000004 24.0625 58-59 21.475 27.6625 27.900000000000002 22.9625 60-61 21.075 27.775 28.075 23.075000000000003 62-63 21.3 26.275 28.9 23.525 64-65 20.4 28.1875 28.262500000000003 23.150000000000002 66-67 20.4125 28.037499999999998 28.287499999999998 23.2625 68-69 20.902612826603324 27.928491061382672 27.815976997124643 23.35291911488936 70-71 21.4125 28.0875 27.85 22.650000000000002 72-73 21.0625 28.037499999999998 28.287499999999998 22.6125 74-75 20.777597199649954 27.65345668208526 28.478559819977495 23.090386298287285 76-77 20.790098762345295 28.053506688336043 27.603450431303912 23.55294411801475 78-79 20.6625 29.012500000000003 26.887499999999996 23.4375 80-81 21.4375 27.8125 28.425 22.325 82-83 20.474999999999998 27.85 28.262500000000003 23.4125 84-85 21.325 28.225 27.0625 23.3875 86-87 21.625 27.3625 28.075 22.9375 88-89 20.5375 29.012500000000003 27.8875 22.5625 90-91 21.2375 27.8875 28.3375 22.537499999999998 92-93 20.962500000000002 28.025 27.5875 23.425 94-95 20.775 28.475 28.575 22.175 96-97 21.0125 28.5875 27.1 23.3 98-99 20.9125 29.062500000000004 27.55 22.475 100-101 21.224999999999998 28.975 27.150000000000002 22.650000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.0 22 1.0 23 2.0 24 2.5 25 3.0 26 3.5 27 4.0 28 10.5 29 13.0 30 18.0 31 21.0 32 22.0 33 31.5 34 39.0 35 60.0 36 75.5 37 101.0 38 124.5 39 156.0 40 194.5 41 215.0 42 239.5 43 251.0 44 273.0 45 272.0 46 251.0 47 251.5 48 248.0 49 226.5 50 180.0 51 149.0 52 123.0 53 87.5 54 70.5 55 56.0 56 47.5 57 36.5 58 28.0 59 25.0 60 16.5 61 14.5 62 12.5 63 8.0 64 9.5 65 8.0 66 3.0 67 1.5 68 3.0 69 2.0 70 1.5 71 2.0 72 0.5 73 0.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.175 2 0.0 3 0.1 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0125 70-71 0.0 72-73 0.0 74-75 0.0125 76-77 0.0125 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4212380473075 98.775 2 0.5032712632108707 1.0 3 0.0754906894816306 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.325 0.0 0.0 0.0 0.0 82-83 0.36250000000000004 0.0 0.0 0.0 0.0 84-85 0.48750000000000004 0.0 0.0 0.0 0.0 86-87 0.6375 0.0 0.0 0.0 0.0 88-89 0.8500000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864483 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864483_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.0655 34.0 31.0 34.0 30.0 34.0 2 32.14425 34.0 31.0 34.0 30.0 34.0 3 32.142 34.0 31.0 34.0 30.0 34.0 4 35.54375 37.0 35.0 37.0 33.0 37.0 5 35.5155 37.0 35.0 37.0 33.0 37.0 6 35.455 37.0 36.0 37.0 33.0 37.0 7 35.478 37.0 35.0 37.0 33.0 37.0 8 35.4785 37.0 35.0 37.0 33.0 37.0 9 37.1135 39.0 37.0 39.0 33.0 39.0 10-11 37.08975 39.0 37.0 39.0 33.5 39.0 12-13 37.067 39.0 37.0 39.0 33.0 39.0 14-15 38.463499999999996 41.0 38.0 41.0 33.5 41.0 16-17 38.293875 40.5 38.0 41.0 33.0 41.0 18-19 38.183875 40.0 38.0 41.0 33.0 41.0 20-21 38.177499999999995 40.0 38.0 41.0 33.0 41.0 22-23 38.21625 40.0 38.0 41.0 34.0 41.0 24-25 38.119625 40.0 38.0 41.0 33.0 41.0 26-27 37.908125 40.0 38.0 41.0 32.5 41.0 28-29 37.8655 40.0 38.0 41.0 33.0 41.0 30-31 37.721374999999995 40.0 38.0 41.0 32.0 41.0 32-33 37.65025 40.0 38.0 41.0 32.5 41.0 34-35 37.578625 40.0 38.0 41.0 31.5 41.0 36-37 37.517624999999995 40.0 38.0 41.0 31.0 41.0 38-39 37.45125 40.0 38.0 41.0 31.5 41.0 40-41 37.206 40.0 37.5 41.0 30.5 41.0 42-43 37.182625 40.0 37.0 41.0 31.0 41.0 44-45 36.974625 40.0 37.0 41.0 30.5 41.0 46-47 36.870000000000005 40.0 37.0 41.0 30.5 41.0 48-49 36.585 39.5 36.5 41.0 30.0 41.0 50-51 36.3795 39.5 36.0 40.5 30.0 41.0 52-53 36.543 39.0 37.0 40.5 30.5 41.0 54-55 36.795375 40.0 37.0 41.0 31.0 41.0 56-57 36.61125 40.0 36.0 41.0 30.0 41.0 58-59 36.1975 39.0 36.0 41.0 28.5 41.0 60-61 35.969625 39.0 35.0 41.0 28.0 41.0 62-63 35.747749999999996 39.0 35.0 41.0 28.0 41.0 64-65 35.481125000000006 38.0 35.0 40.0 28.0 41.0 66-67 35.062375 37.5 34.5 40.0 27.5 41.0 68-69 34.67725 37.0 34.0 39.5 27.5 41.0 70-71 34.282875000000004 36.5 34.0 39.0 27.0 41.0 72-73 33.828125 36.0 34.0 39.0 26.0 40.0 74-75 33.408125 35.5 33.5 37.5 26.0 39.0 76-77 33.006125 35.0 33.0 37.0 26.0 39.0 78-79 32.54175 35.0 33.0 36.5 25.5 39.0 80-81 32.226625 35.0 32.5 36.0 25.5 37.0 82-83 31.826625 35.0 32.0 36.0 24.5 37.0 84-85 31.329625 35.0 31.5 35.0 23.0 36.5 86-87 30.982625 34.5 31.0 35.0 21.0 36.0 88-89 30.846 35.0 31.0 35.0 20.0 36.0 90-91 30.643 34.5 31.0 35.0 20.0 35.5 92-93 30.322125 34.0 31.0 35.0 18.0 35.0 94-95 29.990125 34.0 31.0 35.0 11.0 35.0 96-97 29.66425 34.0 30.0 35.0 4.5 35.0 98-99 29.315375 34.0 30.5 35.0 2.0 35.0 100-101 28.432499999999997 33.5 29.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 21.0 3 5.0 4 1.0 5 12.0 6 4.0 7 7.0 8 9.0 9 7.0 10 7.0 11 16.0 12 2.0 13 5.0 14 19.0 15 13.0 16 12.0 17 9.0 18 9.0 19 12.0 20 15.0 21 17.0 22 17.0 23 19.0 24 24.0 25 23.0 26 28.0 27 45.0 28 42.0 29 51.0 30 80.0 31 89.0 32 106.0 33 130.0 34 191.0 35 279.0 36 433.0 37 890.0 38 1180.0 39 171.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.125 19.3 15.1 36.475 2 24.2 24.3 34.475 17.025000000000002 3 19.325 26.474999999999998 31.025000000000002 23.175 4 21.05 33.35 23.825 21.775 5 23.75 35.025 23.35 17.875 6 20.1 38.125 23.5 18.275 7 18.525 22.175 38.7 20.599999999999998 8 20.65 25.2 29.599999999999998 24.55 9 21.2 24.65 30.425 23.724999999999998 10-11 22.537499999999998 31.7875 24.3875 21.2875 12-13 24.5125 24.762500000000003 27.575 23.150000000000002 14-15 22.3875 28.525 27.650000000000002 21.4375 16-17 23.0375 28.1125 28.3625 20.4875 18-19 22.7125 28.287499999999998 28.0875 20.9125 20-21 22.8875 28.0875 27.6125 21.4125 22-23 23.425 28.325 27.3 20.95 24-25 22.2 28.9375 27.900000000000002 20.962500000000002 26-27 22.9375 28.95 26.787499999999998 21.325 28-29 22.05 29.062500000000004 27.55 21.337500000000002 30-31 22.037499999999998 28.262500000000003 28.299999999999997 21.4 32-33 22.475 28.325 27.2625 21.9375 34-35 23.8125 28.012500000000003 26.7625 21.4125 36-37 22.9375 27.400000000000002 28.025 21.637500000000003 38-39 23.7875 28.349999999999998 27.0875 20.775 40-41 22.4625 28.599999999999998 27.3625 21.575 42-43 22.775000000000002 28.7375 27.8875 20.599999999999998 44-45 21.7 28.1125 28.075 22.112499999999997 46-47 22.15 28.000000000000004 29.5 20.349999999999998 48-49 24.087500000000002 27.925 27.0875 20.9 50-51 22.6375 28.3375 27.3375 21.6875 52-53 22.7375 28.1375 27.3875 21.7375 54-55 22.775000000000002 28.8875 27.6125 20.724999999999998 56-57 23.5875 28.299999999999997 27.3625 20.75 58-59 23.025000000000002 28.925 28.225 19.825 60-61 22.662499999999998 27.650000000000002 28.199999999999996 21.4875 62-63 22.8 27.950000000000003 27.462500000000002 21.7875 64-65 23.2125 28.599999999999998 27.237499999999997 20.95 66-67 23.275000000000002 28.1125 27.875 20.7375 68-69 23.35 28.325 27.6 20.724999999999998 70-71 22.6875 28.575 28.1625 20.575 72-73 22.912499999999998 27.487499999999997 27.775 21.825 74-75 22.7 28.9375 26.7625 21.6 76-77 23.2625 27.125 27.8875 21.725 78-79 22.3625 28.349999999999998 27.85 21.4375 80-81 22.2 28.549999999999997 28.212500000000002 21.0375 82-83 23.1875 28.7375 26.974999999999998 21.099999999999998 84-85 23.1125 27.800000000000004 28.512500000000003 20.575 86-87 22.85 28.249999999999996 27.325 21.575 88-89 22.85 28.1375 26.924999999999997 22.0875 90-91 23.3875 28.3125 27.700000000000003 20.599999999999998 92-93 22.1875 29.225 27.3625 21.224999999999998 94-95 23.849999999999998 28.0625 27.1625 20.925 96-97 23.3375 28.7375 27.150000000000002 20.775 98-99 23.1125 28.499999999999996 28.1 20.2875 100-101 24.587500000000002 28.1625 26.5875 20.6625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 1.0 24 2.0 25 4.0 26 6.5 27 5.5 28 9.5 29 14.0 30 12.5 31 16.5 32 27.0 33 40.5 34 50.5 35 58.0 36 79.5 37 108.0 38 135.5 39 180.5 40 213.0 41 226.0 42 247.5 43 285.5 44 295.5 45 271.0 46 256.5 47 242.0 48 219.5 49 194.0 50 165.0 51 139.5 52 108.0 53 82.0 54 71.0 55 49.5 56 35.0 57 30.5 58 26.5 59 18.0 60 11.0 61 9.5 62 8.5 63 10.5 64 7.0 65 2.5 66 4.0 67 3.5 68 2.5 69 3.5 70 1.5 71 0.0 72 0.0 73 0.5 74 1.0 75 0.5 76 0.0 77 0.5 78 1.5 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.6125 0.0 0.0 0.0 0.0 88-89 0.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 730646 spots for ERR1864483.sra Written 730646 spots for ERR1864483.sra Read 730646 spots for ERR1864483.sra Written 730646 spots for ERR1864483.sra Read 730646 spots for ERR1864483.sra Written 730646 spots for ERR1864483.sra Read 730646 spots for ERR1864483.sra Written 730646 spots for ERR1864483.sra Read 730646 spots for ERR1864483.sra Written 730646 spots for ERR1864483.sra Read 730646 spots for ERR1864483.sra Written 730646 spots for ERR1864483.sra Read 730646 spots for ERR1864483.sra Written 730646 spots for ERR1864483.sra Read 730646 spots for ERR1864483.sra Written 730646 spots for ERR1864483.sra Read 730646 spots for ERR1864483.sra Written 730646 spots for ERR1864483.sra Read 730646 spots for ERR1864483.sra Written 730646 spots for ERR1864483.sra Read 730646 spots for ERR1864483.sra Written 730646 spots for ERR1864483.sra Read 730646 spots for ERR1864483.sra Written 730646 spots for ERR1864483.sra Read 730658 spots for ERR1864483.sra Written 730658 spots for ERR1864483.sra Read 730646 spots for ERR1864483.sra Written 730646 spots for ERR1864483.sra Read 730646 spots for ERR1864483.sra Written 730646 spots for ERR1864483.sra Read 730646 spots for ERR1864483.sra Written 730646 spots for ERR1864483.sra Read 730646 spots for ERR1864483.sra Written 730646 spots for ERR1864483.sra Read 730646 spots for ERR1864483.sra Written 730646 spots for ERR1864483.sra Read 730646 spots for ERR1864483.sra Written 730646 spots for ERR1864483.sra Read 730646 spots for ERR1864483.sra Written 730646 spots for ERR1864483.sra SRR ids: ['ERR1864483.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_aqnuwq6x ERR1864483.sra spots: 14612932 blocks: [[1, 730646], [730647, 1461292], [1461293, 2191938], [2191939, 2922584], [2922585, 3653230], [3653231, 4383876], [4383877, 5114522], [5114523, 5845168], [5845169, 6575814], [6575815, 7306460], [7306461, 8037106], [8037107, 8767752], [8767753, 9498398], [9498399, 10229044], [10229045, 10959690], [10959691, 11690336], [11690337, 12420982], [12420983, 13151628], [13151629, 13882274], [13882275, 14612932]] ERR1864483 file size 3503098 ERR1864483 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864483 ERR1864483_1.fastq ERR1864483_2.fastq Input file: ERR1864483_1.fastq Paired file: ERR1864483_2.fastq trimmed: ERR1864483-trimmed-pair1.fastq, ERR1864483-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:06:08 2025 >> started Thu Feb 13 14:06:28 2025 >> done (20.011s) 14612932 read pairs processed; of these: 222341 ( 1.52%) short read pairs filtered out after trimming by size control 247926 ( 1.70%) empty read pairs filtered out after trimming by size control 14142665 (96.78%) read pairs available; of these: 3216148 (22.74%) trimmed read pairs available after processing 10926517 (77.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 108 0.00% 19 241 0.00% 20 394 0.00% 21 539 0.00% 22 621 0.00% 23 784 0.01% 24 958 0.01% 25 1122 0.01% 26 1319 0.01% 27 1462 0.01% 28 1744 0.01% 29 2032 0.01% 30 2387 0.02% 31 2593 0.02% 32 2924 0.02% 33 3341 0.02% 34 3455 0.02% 35 3978 0.03% 36 4177 0.03% 37 4538 0.03% 38 4793 0.03% 39 5345 0.04% 40 5588 0.04% 41 5997 0.04% 42 6363 0.04% 43 6565 0.05% 44 6908 0.05% 45 7402 0.05% 46 7586 0.05% 47 8062 0.06% 48 8267 0.06% 49 8966 0.06% 50 9246 0.07% 51 9810 0.07% 52 10021 0.07% 53 10535 0.07% 54 11052 0.08% 55 11423 0.08% 56 11958 0.08% 57 13001 0.09% 58 13415 0.09% 59 16903 0.12% 60 20585 0.15% 61 21153 0.15% 62 21683 0.15% 63 22772 0.16% 64 23094 0.16% 65 23877 0.17% 66 24780 0.18% 67 25835 0.18% 68 26398 0.19% 69 27758 0.20% 70 28680 0.20% 71 29866 0.21% 72 31180 0.22% 73 32419 0.23% 74 33579 0.24% 75 34404 0.24% 76 34523 0.24% 77 35854 0.25% 78 38286 0.27% 79 39891 0.28% 80 42149 0.30% 81 43427 0.31% 82 46724 0.33% 83 48021 0.34% 84 49805 0.35% 85 52388 0.37% 86 55712 0.39% 87 58610 0.41% 88 59744 0.42% 89 63840 0.45% 90 70029 0.50% 91 77284 0.55% 92 85219 0.60% 93 95194 0.67% 94 107020 0.76% 95 125038 0.88% 96 148866 1.05% 97 183389 1.30% 98 239048 1.69% 99 321287 2.27% 100 428814 3.03% 101 10926517 77.26% 14142665 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=4.08 fanout-score-rank=24 prefix-density=0.20 prefix-fanout=2.8 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.06 sequence-density-rank=11 fanout-score=375.50 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=30.4 sequence=CTTCTTCTTCTC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=3.95 fanout-score-rank=29 prefix-density=0.18 prefix-fanout=2.3 sequence=AAGACCATCACCCTTGAGGTGGAAAGCTCTGACAC criterion=fanout-score sequence-density=0.06 sequence-density-rank=12 fanout-score=380.43 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=30.1 sequence=AAGAAGAAGAGAAGCCTCAAGAGGAGGTGATTGGTACTGAATTTGAAGAGAAAC ERR1864483 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:07:03 Started mapping on | Feb 13 14:07:04 Finished on | Feb 13 14:07:42 Mapping speed, Million of reads per hour | 1339.83 Number of input reads | 14142665 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 13605993 Uniquely mapped reads % | 96.21% Average mapped length | 195.49 Number of splices: Total | 7524572 Number of splices: Annotated (sjdb) | 7399270 Number of splices: GT/AG | 7412552 Number of splices: GC/AG | 93927 Number of splices: AT/AC | 7563 Number of splices: Non-canonical | 10530 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 2.34 Insertion rate per base | 0.01% Insertion average length | 2.02 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 336794 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 124947 % of reads mapped to too many loci | 0.88% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.47% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 221170 221170 221170 N_multimapping 336794 336794 336794 N_noFeature 475670 13470655 532896 N_ambiguous 137100 630 58552 UnstrandedReadsAssigned:12993223 PositiveStrandReadsAssigned:134708 NegativeStrandReadsAssigned:13014545 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864483 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864483-trimmed-pair1.fastq ERR1864483-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,142,665 reads, 13,240,455 reads pseudoaligned [quant] estimated average fragment length: 165.056 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,124 rounds 52401 ERR1864483.ke.tsv 34699 ERR1864483.se.tsv 87100 total ==> ERR1864483.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1853.94 1299 68.1276 Potri.005G024800.1.v4.1 1035 870.944 337 37.6227 Potri.004G059700.1.v4.1 961 796.949 8 0.976045 Potri.007G009000.2.v4.1 1416 1251.94 0 0 Potri.003G141000.2.v4.1 2943 2778.94 408 14.2755 Potri.016G087400.1.v4.1 270 113.99 755.616 644.536 Potri.015G069301.1.v4.1 564 400.021 0 0 Potri.010G195200.1.v4.1 1773 1608.94 151 9.12529 Potri.012G127500.1.v4.1 977 812.949 623 74.5135 ==> ERR1864483.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1199 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 229 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 6 ERR1864483 completed mapping pipeline successfully