Starting /dee2/code/volunteer_pipeline.sh ERR1864484 current disk space = 3090089529344 free memory = 1440482284 ERR1864484 SRAfilesize 52375b10b64e9e18349bac0068fbebec ERR1864484.sra ERR1864484.sra file validated ERR1864484 is paired end ERR1864484 is conventional basespace ERR1864484 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864484_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.94225 34.0 31.0 34.0 30.0 34.0 2 32.06775 34.0 31.0 34.0 30.0 34.0 3 32.35925 34.0 31.0 34.0 30.0 34.0 4 35.83525 37.0 35.0 37.0 35.0 37.0 5 35.55525 37.0 35.0 37.0 33.0 37.0 6 35.55025 37.0 35.0 37.0 33.0 37.0 7 35.53725 37.0 35.0 37.0 35.0 37.0 8 35.51375 37.0 35.0 37.0 35.0 37.0 9 37.20825 39.0 38.0 39.0 34.0 39.0 10-11 37.095 39.0 37.5 39.0 34.0 39.0 12-13 37.070125000000004 39.0 37.0 39.0 33.5 39.0 14-15 38.544624999999996 41.0 39.0 41.0 34.5 41.0 16-17 38.472 41.0 38.5 41.0 34.0 41.0 18-19 38.334625 41.0 38.0 41.0 33.5 41.0 20-21 38.313874999999996 40.5 38.5 41.0 33.5 41.0 22-23 38.14075 40.0 38.0 41.0 33.0 41.0 24-25 38.14875 40.0 38.0 41.0 33.0 41.0 26-27 38.035875000000004 40.0 38.0 41.0 33.0 41.0 28-29 38.085375 40.0 38.0 41.0 33.5 41.0 30-31 37.9345 40.0 38.0 41.0 33.0 41.0 32-33 37.800125 40.0 38.0 41.0 33.0 41.0 34-35 37.6845 40.0 38.0 41.0 32.5 41.0 36-37 37.575625 40.0 38.0 41.0 32.0 41.0 38-39 37.343875 40.0 37.5 41.0 31.5 41.0 40-41 37.2055 40.0 37.5 41.0 31.0 41.0 42-43 37.015875 40.0 37.0 41.0 31.0 41.0 44-45 37.114125 40.0 37.0 41.0 30.5 41.0 46-47 37.3275 40.0 37.5 41.0 32.0 41.0 48-49 37.250375000000005 40.0 37.0 41.0 31.0 41.0 50-51 36.997875 40.0 37.0 41.0 31.0 41.0 52-53 36.73075 40.0 36.5 41.0 30.0 41.0 54-55 36.59625 40.0 36.0 41.0 30.0 41.0 56-57 36.227875 39.0 35.5 41.0 29.5 41.0 58-59 35.946124999999995 39.0 35.0 41.0 28.5 41.0 60-61 35.844125 39.0 35.0 40.0 29.0 41.0 62-63 35.410375 38.0 35.0 40.0 28.0 41.0 64-65 34.98125 38.0 34.5 40.0 27.0 41.0 66-67 34.646 37.0 34.0 40.0 26.5 41.0 68-69 34.322125 37.0 34.0 39.0 26.5 41.0 70-71 33.872 36.0 34.0 39.0 26.0 40.5 72-73 33.481375 36.0 33.0 39.0 26.0 40.0 74-75 33.122625 35.0 33.0 37.5 26.0 39.5 76-77 32.082125 34.5 31.5 36.5 25.0 39.0 78-79 32.311625 35.0 32.5 36.5 25.0 39.0 80-81 32.042875 35.0 32.0 36.0 25.0 37.5 82-83 31.802999999999997 35.0 32.0 36.0 25.0 37.0 84-85 31.500124999999997 35.0 32.0 35.0 24.5 36.5 86-87 31.2885 34.5 32.0 35.0 24.0 36.0 88-89 30.933625 34.0 31.5 35.0 23.0 36.0 90-91 30.66875 34.0 31.0 35.0 20.0 35.5 92-93 30.42875 34.0 31.0 35.0 20.0 35.0 94-95 30.209874999999997 34.0 31.0 35.0 19.0 35.0 96-97 29.934375000000003 34.0 31.0 35.0 13.5 35.0 98-99 29.56675 34.0 31.0 35.0 2.0 35.0 100-101 28.74575 33.5 29.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 26.0 3 12.0 4 11.0 5 7.0 6 7.0 7 4.0 8 5.0 9 11.0 10 5.0 11 9.0 12 9.0 13 10.0 14 10.0 15 15.0 16 11.0 17 13.0 18 11.0 19 12.0 20 8.0 21 10.0 22 15.0 23 17.0 24 19.0 25 14.0 26 34.0 27 42.0 28 44.0 29 43.0 30 57.0 31 94.0 32 102.0 33 124.0 34 177.0 35 269.0 36 475.0 37 949.0 38 1190.0 39 129.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.60359220844928 6.754363774348596 7.665064507968632 46.976979509233495 2 26.825 9.025 33.025 31.125000000000004 3 24.031007751937985 12.378094523630907 23.1807951987997 40.41010252563141 4 27.750000000000004 20.825 21.15 30.275000000000002 5 27.05 24.55 26.474999999999998 21.925 6 22.275 29.975 25.75 22.0 7 16.725 24.0 42.6 16.675 8 18.6 24.85 34.4 22.15 9 18.325 22.625 37.875 21.175 10-11 20.125 32.8125 27.0 20.0625 12-13 21.475 26.575 29.6875 22.2625 14-15 20.65 28.549999999999997 29.1625 21.637500000000003 16-17 21.3125 29.15 27.9375 21.6 18-19 21.462500000000002 28.075 28.499999999999996 21.9625 20-21 21.1375 28.050000000000004 28.0625 22.75 22-23 21.1625 28.050000000000004 28.675 22.112499999999997 24-25 21.3625 27.875 26.875 23.8875 26-27 20.3375 27.750000000000004 28.799999999999997 23.1125 28-29 21.275 28.475 27.8125 22.4375 30-31 21.762500000000003 26.2875 28.462500000000002 23.4875 32-33 21.475 27.400000000000002 28.1625 22.9625 34-35 21.1125 27.825 28.325 22.7375 36-37 20.7125 27.450000000000003 27.975 23.8625 38-39 21.375 27.875 27.750000000000004 23.0 40-41 21.837500000000002 28.1 27.6125 22.45 42-43 19.9875 28.549999999999997 28.025 23.4375 44-45 20.9375 27.725 27.762500000000003 23.575 46-47 20.65 28.1 27.787499999999998 23.4625 48-49 21.0375 27.85 27.825 23.2875 50-51 21.099999999999998 27.925 27.9375 23.0375 52-53 21.25 28.237499999999997 28.15 22.3625 54-55 20.95 28.8375 27.487499999999997 22.725 56-57 21.587500000000002 27.224999999999998 27.8625 23.325000000000003 58-59 20.95 28.299999999999997 28.299999999999997 22.45 60-61 21.2625 28.237499999999997 27.700000000000003 22.8 62-63 20.974999999999998 27.0625 28.5875 23.375 64-65 21.9 27.6375 27.187499999999996 23.275000000000002 66-67 20.375 28.025 28.4 23.200000000000003 68-69 21.027628453556694 27.86598324790599 28.34104263032879 22.765345668208525 70-71 21.0 27.675 27.787499999999998 23.5375 72-73 21.025 27.287499999999998 28.075 23.6125 74-75 21.57769721215152 27.25340667583448 28.353544193024128 22.815351918989872 76-77 21.95 27.450000000000003 26.7625 23.8375 78-79 20.8875 28.1875 28.287499999999998 22.6375 80-81 21.0125 26.887499999999996 28.675 23.425 82-83 20.9375 27.537499999999998 28.3625 23.1625 84-85 20.8625 28.0625 27.5875 23.4875 86-87 21.7375 27.125 28.275 22.8625 88-89 20.974999999999998 28.1 28.549999999999997 22.375 90-91 21.212500000000002 26.737499999999997 28.287499999999998 23.7625 92-93 21.725 27.8875 27.900000000000002 22.4875 94-95 21.762500000000003 28.0875 27.625 22.525000000000002 96-97 21.0625 27.787499999999998 27.762500000000003 23.3875 98-99 21.5375 27.4125 28.3375 22.7125 100-101 22.237499999999997 28.5875 26.5125 22.662499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.0 23 1.5 24 3.5 25 3.0 26 1.5 27 3.0 28 5.0 29 11.0 30 14.0 31 14.5 32 20.5 33 30.5 34 46.0 35 67.0 36 78.0 37 96.5 38 123.5 39 134.0 40 169.0 41 215.0 42 241.5 43 259.5 44 265.5 45 271.5 46 280.0 47 265.0 48 241.5 49 224.0 50 191.0 51 154.5 52 120.0 53 97.5 54 78.0 55 52.5 56 39.0 57 31.0 58 31.0 59 29.0 60 20.0 61 14.0 62 12.5 63 10.5 64 8.0 65 7.5 66 4.5 67 2.0 68 2.0 69 2.5 70 2.0 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.175 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0125 70-71 0.0 72-73 0.0 74-75 0.0125 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.2375 0.0 0.0 0.0 0.0 74-75 0.3125 0.0 0.0 0.0 0.0 76-77 0.375 0.0 0.0 0.0 0.0 78-79 0.4875 0.0 0.0 0.0 0.0 80-81 0.575 0.0 0.0 0.0 0.0 82-83 0.675 0.0 0.0 0.0 0.0 84-85 0.8 0.0 0.0 0.0 0.0 86-87 0.925 0.0 0.0 0.0 0.0 88-89 1.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864484 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864484_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.05825 34.0 31.0 34.0 30.0 34.0 2 32.16425 34.0 31.0 34.0 30.0 34.0 3 32.27425 34.0 31.0 34.0 30.0 34.0 4 35.595 37.0 35.0 37.0 35.0 37.0 5 35.521 37.0 35.0 37.0 33.0 37.0 6 35.492 37.0 35.0 37.0 33.0 37.0 7 35.60225 37.0 35.0 37.0 33.0 37.0 8 35.495 37.0 35.0 37.0 33.0 37.0 9 37.16425 39.0 37.0 39.0 34.0 39.0 10-11 37.057375 39.0 37.0 39.0 33.0 39.0 12-13 36.991125 39.0 37.0 39.0 33.0 39.0 14-15 38.461625 41.0 38.0 41.0 34.0 41.0 16-17 38.316 40.5 38.0 41.0 33.0 41.0 18-19 38.310875 40.0 38.0 41.0 34.0 41.0 20-21 38.259249999999994 40.0 38.0 41.0 33.5 41.0 22-23 38.13675 40.0 38.0 41.0 33.0 41.0 24-25 38.11025 40.0 38.0 41.0 33.0 41.0 26-27 37.9125 40.0 38.0 41.0 33.0 41.0 28-29 37.866625 40.0 38.0 41.0 33.0 41.0 30-31 37.676625 40.0 38.0 41.0 32.0 41.0 32-33 37.587374999999994 40.0 38.0 41.0 32.0 41.0 34-35 37.535 40.0 38.0 41.0 31.5 41.0 36-37 37.429 40.0 38.0 41.0 31.0 41.0 38-39 37.34225 40.0 38.0 41.0 31.0 41.0 40-41 37.2015 40.0 37.5 41.0 31.0 41.0 42-43 37.013999999999996 40.0 37.0 41.0 30.0 41.0 44-45 36.900125 40.0 37.0 41.0 30.5 41.0 46-47 36.726625 40.0 37.0 41.0 30.5 41.0 48-49 36.3845 39.0 36.0 41.0 29.5 41.0 50-51 36.315375 39.5 36.5 40.5 29.5 41.0 52-53 36.479625 39.0 36.5 40.5 30.0 41.0 54-55 36.814875 40.0 37.0 41.0 31.0 41.0 56-57 36.623125 40.0 36.0 41.0 30.5 41.0 58-59 36.195625 39.0 36.0 41.0 28.5 41.0 60-61 35.80075 39.0 35.0 41.0 28.0 41.0 62-63 35.681625 38.5 35.0 40.5 28.0 41.0 64-65 35.332375 38.0 35.0 40.0 28.0 41.0 66-67 34.945 37.5 34.5 40.0 27.0 41.0 68-69 34.50125 37.0 34.0 39.0 27.5 41.0 70-71 34.104 36.0 34.0 39.0 26.0 41.0 72-73 33.707375 36.0 34.0 38.5 26.0 40.0 74-75 33.226749999999996 35.5 33.5 37.5 26.0 39.0 76-77 32.7745 35.0 33.0 37.0 26.0 39.0 78-79 32.414249999999996 35.0 33.0 36.5 25.0 38.5 80-81 31.993875 35.0 32.5 36.0 24.0 37.0 82-83 31.616750000000003 35.0 32.0 35.5 24.0 37.0 84-85 31.184 35.0 31.5 35.0 22.0 36.5 86-87 30.86475 34.0 31.0 35.0 20.0 36.0 88-89 30.731 34.0 31.0 35.0 20.0 36.0 90-91 30.528375 34.0 31.5 35.0 19.0 35.5 92-93 30.167875000000002 34.0 31.0 35.0 17.5 35.0 94-95 29.9735 34.0 31.0 35.0 11.0 35.0 96-97 29.545875000000002 34.0 30.5 35.0 2.0 35.0 98-99 29.06975 34.0 30.5 35.0 2.0 35.0 100-101 28.122625 33.5 28.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 4.0 4 8.0 5 2.0 6 8.0 7 8.0 8 12.0 9 10.0 10 13.0 11 12.0 12 17.0 13 9.0 14 5.0 15 9.0 16 14.0 17 5.0 18 18.0 19 11.0 20 11.0 21 18.0 22 18.0 23 26.0 24 24.0 25 37.0 26 31.0 27 40.0 28 38.0 29 68.0 30 53.0 31 65.0 32 94.0 33 120.0 34 198.0 35 277.0 36 471.0 37 971.0 38 1122.0 39 136.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.925 18.3 14.725 38.05 2 25.224999999999998 23.925 33.85 17.0 3 19.650000000000002 26.674999999999997 30.65 23.025000000000002 4 21.875 32.824999999999996 24.375 20.925 5 24.15 34.875 23.875 17.1 6 18.95 37.35 25.4 18.3 7 19.875 20.625 38.75 20.75 8 21.925 25.5 29.375 23.200000000000003 9 22.0 24.55 29.349999999999998 24.099999999999998 10-11 22.25 32.324999999999996 24.212500000000002 21.212500000000002 12-13 23.325000000000003 24.9125 28.125 23.6375 14-15 22.675 28.975 26.950000000000003 21.4 16-17 23.575 28.7 25.900000000000002 21.825 18-19 22.1875 30.0375 26.650000000000002 21.125 20-21 22.9875 29.0875 26.787499999999998 21.1375 22-23 23.2375 28.1625 27.8875 20.7125 24-25 22.4625 28.6625 27.8875 20.9875 26-27 22.45 28.237499999999997 27.925 21.3875 28-29 22.3875 28.4375 27.8375 21.337500000000002 30-31 22.55 28.6875 26.974999999999998 21.7875 32-33 23.75 28.675 27.025 20.549999999999997 34-35 23.0125 27.3625 27.8125 21.8125 36-37 22.912499999999998 27.525 28.449999999999996 21.1125 38-39 23.075000000000003 28.15 27.35 21.425 40-41 22.537499999999998 28.487499999999997 27.6 21.375 42-43 23.175 27.437499999999996 28.3625 21.025 44-45 23.1375 28.262500000000003 27.400000000000002 21.2 46-47 22.825 27.2625 28.125 21.7875 48-49 22.8625 27.575 28.8625 20.7 50-51 23.075000000000003 27.950000000000003 27.125 21.85 52-53 22.7375 27.5875 27.5875 22.0875 54-55 22.25 28.975 27.1 21.675 56-57 22.8375 28.725 27.2625 21.175 58-59 23.1625 27.9125 27.287499999999998 21.637500000000003 60-61 22.8 29.025000000000002 27.275 20.9 62-63 23.35 28.425 27.725 20.5 64-65 23.962500000000002 27.8125 27.3625 20.8625 66-67 21.675 29.25 27.250000000000004 21.825 68-69 23.0875 28.425 27.450000000000003 21.0375 70-71 22.625 27.4125 27.875 22.0875 72-73 22.3625 28.3875 28.1 21.15 74-75 22.5 27.6375 28.012500000000003 21.85 76-77 23.45 27.8125 28.175 20.5625 78-79 22.925 27.6125 28.4 21.0625 80-81 23.05 28.5625 27.500000000000004 20.8875 82-83 24.25 28.15 27.037499999999998 20.5625 84-85 22.225 29.225 27.1125 21.4375 86-87 23.3 29.025000000000002 26.187500000000004 21.4875 88-89 23.7875 28.225 27.0875 20.9 90-91 23.400000000000002 28.775000000000002 27.6375 20.1875 92-93 23.625 28.3125 27.737499999999997 20.325 94-95 22.900000000000002 28.7 27.500000000000004 20.9 96-97 23.474999999999998 28.849999999999998 26.825 20.849999999999998 98-99 24.462500000000002 27.8875 26.8625 20.7875 100-101 23.674999999999997 28.8875 26.687499999999996 20.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.5 23 2.0 24 1.0 25 3.5 26 3.5 27 4.0 28 7.5 29 11.0 30 11.5 31 19.0 32 27.5 33 37.0 34 49.0 35 67.0 36 84.5 37 107.0 38 132.0 39 166.5 40 200.0 41 220.5 42 242.0 43 270.5 44 291.5 45 279.0 46 267.5 47 252.5 48 219.5 49 197.0 50 178.5 51 138.0 52 108.5 53 85.5 54 66.0 55 54.0 56 39.5 57 33.5 58 27.0 59 21.5 60 18.0 61 13.0 62 8.5 63 6.5 64 4.5 65 3.5 66 5.5 67 4.0 68 2.5 69 1.5 70 1.0 71 1.0 72 0.5 73 0.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.2375 0.0 0.0 0.0 0.0 74-75 0.3125 0.0 0.0 0.0 0.0 76-77 0.375 0.0 0.0 0.0 0.0 78-79 0.4875 0.0 0.0 0.0 0.0 80-81 0.575 0.0 0.0 0.0 0.0 82-83 0.625 0.0 0.0 0.0 0.0 84-85 0.75 0.0 0.0 0.0 0.0 86-87 0.875 0.0 0.0 0.0 0.0 88-89 1.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 883809 spots for ERR1864484.sra Written 883809 spots for ERR1864484.sra Read 883809 spots for ERR1864484.sra Written 883809 spots for ERR1864484.sra Read 883809 spots for ERR1864484.sra Written 883809 spots for ERR1864484.sra Read 883809 spots for ERR1864484.sra Written 883809 spots for ERR1864484.sra Read 883809 spots for ERR1864484.sra Written 883809 spots for ERR1864484.sra Read 883809 spots for ERR1864484.sra Written 883809 spots for ERR1864484.sra Read 883809 spots for ERR1864484.sra Written 883809 spots for ERR1864484.sra Read 883809 spots for ERR1864484.sra Written 883809 spots for ERR1864484.sra Read 883809 spots for ERR1864484.sra Written 883809 spots for ERR1864484.sra Read 883809 spots for ERR1864484.sra Written 883809 spots for ERR1864484.sra Read 883809 spots for ERR1864484.sra Written 883809 spots for ERR1864484.sra Read 883809 spots for ERR1864484.sra Written 883809 spots for ERR1864484.sra Read 883809 spots for ERR1864484.sra Written 883809 spots for ERR1864484.sra Read 883809 spots for ERR1864484.sra Written 883809 spots for ERR1864484.sra Read 883809 spots for ERR1864484.sra Written 883809 spots for ERR1864484.sra Read 883809 spots for ERR1864484.sra Written 883809 spots for ERR1864484.sra Read 883809 spots for ERR1864484.sra Written 883809 spots for ERR1864484.sra Read 883827 spots for ERR1864484.sra Written 883827 spots for ERR1864484.sra Read 883809 spots for ERR1864484.sra Written 883809 spots for ERR1864484.sra Read 883809 spots for ERR1864484.sra Written 883809 spots for ERR1864484.sra SRR ids: ['ERR1864484.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jwvbex5w ERR1864484.sra spots: 17676198 blocks: [[1, 883809], [883810, 1767618], [1767619, 2651427], [2651428, 3535236], [3535237, 4419045], [4419046, 5302854], [5302855, 6186663], [6186664, 7070472], [7070473, 7954281], [7954282, 8838090], [8838091, 9721899], [9721900, 10605708], [10605709, 11489517], [11489518, 12373326], [12373327, 13257135], [13257136, 14140944], [14140945, 15024753], [15024754, 15908562], [15908563, 16792371], [16792372, 17676198]] ERR1864484 file size 4241991 ERR1864484 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864484 ERR1864484_1.fastq ERR1864484_2.fastq Input file: ERR1864484_1.fastq Paired file: ERR1864484_2.fastq trimmed: ERR1864484-trimmed-pair1.fastq, ERR1864484-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:06:23 2025 >> started Thu Feb 13 14:06:40 2025 >> done (16.491s) 17676198 read pairs processed; of these: 252234 ( 1.43%) short read pairs filtered out after trimming by size control 268999 ( 1.52%) empty read pairs filtered out after trimming by size control 17154965 (97.05%) read pairs available; of these: 3986521 (23.24%) trimmed read pairs available after processing 13168444 (76.76%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 134 0.00% 19 297 0.00% 20 459 0.00% 21 589 0.00% 22 768 0.00% 23 886 0.01% 24 1237 0.01% 25 1294 0.01% 26 1636 0.01% 27 1866 0.01% 28 2030 0.01% 29 2469 0.01% 30 2807 0.02% 31 3108 0.02% 32 3485 0.02% 33 3942 0.02% 34 4298 0.03% 35 4721 0.03% 36 4944 0.03% 37 5386 0.03% 38 5929 0.03% 39 6329 0.04% 40 6780 0.04% 41 7172 0.04% 42 7546 0.04% 43 8150 0.05% 44 8562 0.05% 45 8947 0.05% 46 9375 0.05% 47 9785 0.06% 48 10197 0.06% 49 10657 0.06% 50 11326 0.07% 51 11866 0.07% 52 12336 0.07% 53 12981 0.08% 54 13438 0.08% 55 14087 0.08% 56 14900 0.09% 57 15789 0.09% 58 16510 0.10% 59 20835 0.12% 60 24758 0.14% 61 25510 0.15% 62 25861 0.15% 63 27409 0.16% 64 28062 0.16% 65 28863 0.17% 66 30431 0.18% 67 31230 0.18% 68 32493 0.19% 69 33655 0.20% 70 34747 0.20% 71 36804 0.21% 72 38484 0.22% 73 39519 0.23% 74 41040 0.24% 75 41866 0.24% 76 42334 0.25% 77 44184 0.26% 78 46862 0.27% 79 49598 0.29% 80 52281 0.30% 81 54402 0.32% 82 58695 0.34% 83 59522 0.35% 84 61946 0.36% 85 66005 0.38% 86 69772 0.41% 87 73157 0.43% 88 75220 0.44% 89 79946 0.47% 90 87979 0.51% 91 97559 0.57% 92 107880 0.63% 93 119405 0.70% 94 134211 0.78% 95 157181 0.92% 96 185716 1.08% 97 228514 1.33% 98 296266 1.73% 99 398014 2.32% 100 529287 3.09% 101 13168444 76.76% 17154965 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=4.25 fanout-score-rank=24 prefix-density=0.22 prefix-fanout=2.8 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.06 sequence-density-rank=23 fanout-score=369.37 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=27.3 sequence=CTTCTTCTTCTC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=3.51 fanout-score-rank=28 prefix-density=0.18 prefix-fanout=2.1 sequence=AAGACCATCACCCTTGAGGTGGAAAGCTCTGACACCATCGACAATGTGAAGGCCAAGATCCAGGACAAGGA criterion=fanout-score sequence-density=0.06 sequence-density-rank=14 fanout-score=332.75 fanout-score-rank=1 prefix-density=0.75 prefix-fanout=26.7 sequence=AAGAAGAAGAAG ERR1864484 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:07:11 Started mapping on | Feb 13 14:07:11 Finished on | Feb 13 14:07:49 Mapping speed, Million of reads per hour | 1625.21 Number of input reads | 17154965 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 16664900 Uniquely mapped reads % | 97.14% Average mapped length | 195.37 Number of splices: Total | 9090472 Number of splices: Annotated (sjdb) | 8940019 Number of splices: GT/AG | 8954609 Number of splices: GC/AG | 114456 Number of splices: AT/AC | 8982 Number of splices: Non-canonical | 12425 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 2.33 Insertion rate per base | 0.01% Insertion average length | 2.03 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 366169 % of reads mapped to multiple loci | 2.13% Number of reads mapped to too many loci | 45569 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.43% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 146697 146697 146697 N_multimapping 366169 366169 366169 N_noFeature 554653 16500021 623593 N_ambiguous 165264 695 68861 UnstrandedReadsAssigned:15944983 PositiveStrandReadsAssigned:164184 NegativeStrandReadsAssigned:15972446 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864484 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864484-trimmed-pair1.fastq ERR1864484-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,154,965 reads, 16,147,436 reads pseudoaligned [quant] estimated average fragment length: 162.247 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,128 rounds 52401 ERR1864484.ke.tsv 34699 ERR1864484.se.tsv 87100 total ==> ERR1864484.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1856.75 1624 71.7773 Potri.005G024800.1.v4.1 1035 873.753 338 31.7456 Potri.004G059700.1.v4.1 961 799.764 5 0.513054 Potri.007G009000.2.v4.1 1416 1254.75 0 0 Potri.003G141000.2.v4.1 2943 2781.75 610.743 18.0175 Potri.016G087400.1.v4.1 270 115.619 701.2 497.699 Potri.015G069301.1.v4.1 564 402.842 0 0 Potri.010G195200.1.v4.1 1773 1611.75 131 6.67004 Potri.012G127500.1.v4.1 977 815.759 566 56.939 ==> ERR1864484.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1397 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 346 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 12 ERR1864484 completed mapping pipeline successfully