Starting /dee2/code/volunteer_pipeline.sh ERR1864485 current disk space = 3090224480256 free memory = 1449945856 ERR1864485 SRAfilesize ee49064060b14bed6a4fe1453bf87910 ERR1864485.sra ERR1864485.sra file validated ERR1864485 is paired end ERR1864485 is conventional basespace ERR1864485 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864485_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.80725 34.0 31.0 34.0 30.0 34.0 2 31.97825 34.0 31.0 34.0 30.0 34.0 3 32.2345 34.0 31.0 34.0 30.0 34.0 4 35.671 37.0 35.0 37.0 35.0 37.0 5 35.383 37.0 35.0 37.0 33.0 37.0 6 35.42025 37.0 35.0 37.0 33.0 37.0 7 35.415 37.0 35.0 37.0 33.0 37.0 8 35.375 37.0 35.0 37.0 33.0 37.0 9 37.04025 39.0 38.0 39.0 34.0 39.0 10-11 36.950874999999996 39.0 37.5 39.0 33.0 39.0 12-13 36.91525 39.0 37.0 39.0 33.0 39.0 14-15 38.31 41.0 38.0 41.0 33.0 41.0 16-17 38.25575 41.0 38.0 41.0 33.5 41.0 18-19 38.18 41.0 38.5 41.0 33.0 41.0 20-21 38.008875 40.5 38.0 41.0 33.0 41.0 22-23 38.065124999999995 40.0 38.0 41.0 33.5 41.0 24-25 37.99375 40.0 38.0 41.0 33.0 41.0 26-27 37.92725 40.0 38.0 41.0 33.0 41.0 28-29 37.77675 40.0 38.0 41.0 32.5 41.0 30-31 37.707125 40.0 38.0 41.0 32.5 41.0 32-33 37.61125 40.0 38.0 41.0 32.5 41.0 34-35 37.41175 40.0 38.0 41.0 31.5 41.0 36-37 37.30525 40.0 37.5 41.0 31.5 41.0 38-39 37.00675 40.0 37.5 41.0 30.5 41.0 40-41 36.963750000000005 40.0 37.0 41.0 30.0 41.0 42-43 36.915125 40.0 37.0 41.0 30.0 41.0 44-45 36.990750000000006 40.0 37.0 41.0 30.5 41.0 46-47 37.092375 40.0 37.0 41.0 31.0 41.0 48-49 36.94075 40.0 37.0 41.0 30.5 41.0 50-51 36.7705 40.0 37.0 41.0 30.0 41.0 52-53 36.481125000000006 40.0 36.0 41.0 29.5 41.0 54-55 36.45475 40.0 36.0 41.0 29.5 41.0 56-57 36.08525 39.0 35.5 41.0 28.0 41.0 58-59 35.90925 39.0 35.0 41.0 28.0 41.0 60-61 35.687375 39.0 35.0 40.0 28.0 41.0 62-63 35.462 38.0 35.0 40.0 28.0 41.0 64-65 35.03125 38.0 34.5 40.0 27.0 41.0 66-67 34.691375 37.5 34.0 40.0 27.0 41.0 68-69 34.393625 37.0 34.0 39.0 27.5 41.0 70-71 34.009375 36.0 34.0 39.0 26.0 40.0 72-73 33.546625 36.0 33.0 38.5 26.0 40.0 74-75 33.076 35.0 33.0 37.5 26.0 39.5 76-77 32.153375 34.5 31.5 36.5 25.5 39.0 78-79 32.313625 35.0 32.0 36.5 25.5 39.0 80-81 32.0095 35.0 32.0 36.0 25.0 37.5 82-83 31.796875 35.0 32.0 36.0 24.5 37.0 84-85 31.380375 35.0 32.0 35.0 24.0 37.0 86-87 31.15325 34.0 32.0 35.0 23.5 36.0 88-89 30.822375 34.0 32.0 35.0 20.0 36.0 90-91 30.533 34.0 31.0 35.0 20.0 35.5 92-93 30.205750000000002 34.0 31.0 35.0 18.0 35.0 94-95 30.033749999999998 34.0 31.0 35.0 18.0 35.0 96-97 29.778624999999998 34.0 30.5 35.0 6.0 35.0 98-99 29.5415 34.0 31.0 35.0 2.0 35.0 100-101 28.726750000000003 33.5 29.5 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 47.0 3 15.0 4 8.0 5 8.0 6 6.0 7 2.0 8 3.0 9 4.0 10 5.0 11 11.0 12 10.0 13 10.0 14 5.0 15 8.0 16 16.0 17 4.0 18 13.0 19 20.0 20 14.0 21 15.0 22 15.0 23 12.0 24 17.0 25 28.0 26 28.0 27 32.0 28 43.0 29 64.0 30 50.0 31 88.0 32 105.0 33 124.0 34 184.0 35 261.0 36 498.0 37 918.0 38 1171.0 39 138.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.753799392097264 6.6109422492401215 7.624113475177305 47.01114488348531 2 25.474999999999998 8.325000000000001 33.074999999999996 33.125 3 23.2540675844806 12.015018773466833 22.27784730913642 42.453066332916144 4 28.975 18.975 20.674999999999997 31.374999999999996 5 28.225 24.2 24.675 22.900000000000002 6 21.175 31.05 24.875 22.900000000000002 7 15.85 23.075000000000003 43.55 17.525 8 17.7 24.825 35.275 22.2 9 17.4 21.349999999999998 39.875 21.375 10-11 20.0125 32.2 27.8125 19.975 12-13 20.925 25.7875 30.8125 22.475 14-15 20.775 27.700000000000003 29.462500000000002 22.0625 16-17 20.65 28.5875 28.599999999999998 22.162499999999998 18-19 21.212500000000002 28.462500000000002 27.85 22.475 20-21 21.3875 27.474999999999998 28.4375 22.7 22-23 20.0875 28.6625 28.6625 22.5875 24-25 21.212500000000002 27.4125 28.037499999999998 23.3375 26-27 20.2125 28.050000000000004 28.525 23.2125 28-29 20.7 28.237499999999997 28.1125 22.95 30-31 21.0625 28.799999999999997 27.237499999999997 22.900000000000002 32-33 21.2 27.987499999999997 27.462500000000002 23.35 34-35 20.9 27.4125 28.1625 23.525 36-37 20.837500000000002 27.375 27.8875 23.9 38-39 21.1375 27.3625 27.962500000000002 23.5375 40-41 21.4375 27.462500000000002 28.537499999999998 22.5625 42-43 20.549999999999997 28.575 27.625 23.25 44-45 20.7375 28.075 27.8375 23.35 46-47 21.275 27.3125 27.575 23.8375 48-49 20.8125 27.55 27.800000000000004 23.8375 50-51 21.3625 27.187499999999996 27.8125 23.6375 52-53 20.302537817227154 28.478559819977495 28.416052006500813 22.802850356294538 54-55 20.549999999999997 27.925 28.512500000000003 23.0125 56-57 20.8125 27.762500000000003 28.537499999999998 22.8875 58-59 21.325 27.8125 28.050000000000004 22.8125 60-61 21.762500000000003 27.3625 28.3375 22.537499999999998 62-63 19.75 28.425 28.5625 23.2625 64-65 19.142285571392847 29.35733933483371 28.33208302075519 23.168292073018254 66-67 21.15 27.275 28.549999999999997 23.025000000000002 68-69 20.88283106164812 27.622858571964485 28.87332749781168 22.620982868575716 70-71 20.80260032504063 28.353544193024128 28.778597324665583 22.06525815726966 72-73 21.077634704338042 26.840855106888363 28.403550443805475 23.67795974496812 74-75 20.080020005001252 28.75718929732433 28.182045511377847 22.980745186296573 76-77 20.740092511563944 29.003625453181648 27.17839729966246 23.07788473559195 78-79 21.025 28.799999999999997 27.474999999999998 22.7 80-81 20.549999999999997 27.275 28.7375 23.4375 82-83 21.087500000000002 27.800000000000004 28.3875 22.725 84-85 20.7875 27.775 27.8875 23.549999999999997 86-87 21.0625 28.275 27.6375 23.025000000000002 88-89 20.925 28.625 27.212500000000002 23.2375 90-91 21.125 28.225 27.3875 23.2625 92-93 21.05 28.237499999999997 27.825 22.8875 94-95 21.8 28.487499999999997 28.199999999999996 21.512500000000003 96-97 21.775 27.3125 27.3125 23.599999999999998 98-99 21.4125 28.5625 26.875 23.150000000000002 100-101 22.037499999999998 27.950000000000003 27.287499999999998 22.725 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 1.5 23 2.0 24 2.0 25 2.5 26 3.5 27 6.0 28 7.5 29 6.5 30 11.0 31 23.0 32 28.5 33 33.0 34 46.5 35 58.5 36 78.5 37 98.0 38 121.5 39 149.5 40 180.5 41 223.5 42 244.5 43 257.5 44 264.0 45 267.5 46 270.5 47 264.5 48 246.0 49 213.5 50 188.0 51 150.0 52 107.5 53 84.5 54 73.5 55 62.5 56 50.5 57 34.0 58 24.5 59 22.0 60 20.0 61 19.0 62 16.0 63 8.5 64 3.5 65 4.5 66 6.0 67 5.5 68 1.5 69 0.0 70 1.0 71 2.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.3 2 0.0 3 0.125 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0125 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.025 66-67 0.0 68-69 0.0375 70-71 0.0125 72-73 0.0125 74-75 0.025 76-77 0.0125 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44681921046015 98.875 2 0.5280362081971335 1.05 3 0.025144581342720643 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.3 0.0 0.0 0.0 0.0 80-81 0.35 0.0 0.0 0.0 0.0 82-83 0.4125 0.0 0.0 0.0 0.0 84-85 0.48750000000000004 0.0 0.0 0.0 0.0 86-87 0.6875 0.0 0.0 0.0 0.0 88-89 0.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864485 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864485_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.9505 34.0 31.0 34.0 30.0 34.0 2 32.11975 34.0 31.0 34.0 30.0 34.0 3 32.13875 34.0 31.0 34.0 30.0 34.0 4 35.5005 37.0 35.0 37.0 33.0 37.0 5 35.39525 37.0 35.0 37.0 33.0 37.0 6 35.43575 37.0 36.0 37.0 33.0 37.0 7 35.39275 37.0 35.0 37.0 33.0 37.0 8 35.46525 37.0 35.0 37.0 33.0 37.0 9 37.10925 39.0 37.0 39.0 34.0 39.0 10-11 36.994125 39.0 37.0 39.0 33.0 39.0 12-13 36.926625 39.0 37.0 39.0 33.0 39.0 14-15 38.29837499999999 41.0 38.0 41.0 33.0 41.0 16-17 38.13725 40.5 38.0 41.0 32.5 41.0 18-19 38.1775 40.5 38.0 41.0 33.0 41.0 20-21 38.08375 40.0 38.0 41.0 33.0 41.0 22-23 38.0435 40.0 38.0 41.0 33.0 41.0 24-25 37.876875 40.0 38.0 41.0 32.0 41.0 26-27 37.74325 40.0 38.0 41.0 32.0 41.0 28-29 37.753 40.0 38.0 41.0 32.0 41.0 30-31 37.546125 40.0 38.0 41.0 32.0 41.0 32-33 37.49675 40.0 38.0 41.0 31.5 41.0 34-35 37.357 40.0 38.0 41.0 31.0 41.0 36-37 37.303 40.0 38.0 41.0 31.5 41.0 38-39 37.276250000000005 40.0 38.0 41.0 31.0 41.0 40-41 37.04425 40.0 37.0 41.0 30.0 41.0 42-43 36.92975 40.0 37.0 41.0 30.0 41.0 44-45 36.815 40.0 37.0 41.0 30.0 41.0 46-47 36.61925 40.0 37.0 41.0 30.0 41.0 48-49 36.40625 40.0 36.0 41.0 29.5 41.0 50-51 36.16 39.5 36.0 40.5 29.5 41.0 52-53 36.272375 39.0 36.5 40.5 30.0 41.0 54-55 36.491375 40.0 37.0 41.0 29.5 41.0 56-57 36.400125 40.0 36.0 41.0 29.5 41.0 58-59 35.878375 39.0 36.0 41.0 28.0 41.0 60-61 35.6065 39.0 35.0 41.0 27.5 41.0 62-63 35.4955 39.0 35.0 40.5 28.0 41.0 64-65 35.126125 38.0 35.0 40.0 27.5 41.0 66-67 34.746750000000006 37.5 34.5 40.0 26.0 41.0 68-69 34.36475 37.0 34.0 39.5 26.0 41.0 70-71 33.892375 36.5 34.0 39.0 26.0 41.0 72-73 33.53225 36.0 34.0 39.0 26.0 40.0 74-75 33.109625 35.5 33.5 37.5 25.5 39.5 76-77 32.646249999999995 35.0 33.0 37.0 25.0 39.0 78-79 32.19975 35.0 33.0 36.5 23.5 39.0 80-81 31.72175 35.0 32.5 36.0 22.0 37.0 82-83 31.451749999999997 35.0 32.0 36.0 21.5 37.0 84-85 31.106749999999998 35.0 32.0 35.0 20.0 36.5 86-87 30.6295 35.0 31.5 35.0 18.0 36.0 88-89 30.481749999999998 34.5 31.0 35.0 18.0 36.0 90-91 30.260125 34.0 31.0 35.0 16.5 35.5 92-93 29.990875000000003 34.0 31.0 35.0 9.5 35.0 94-95 29.725375 34.0 31.0 35.0 4.5 35.0 96-97 29.380125 34.0 30.0 35.0 2.0 35.0 98-99 29.032875 34.0 30.0 35.0 2.0 35.0 100-101 28.07675 33.5 28.5 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 13.0 4 4.0 5 8.0 6 8.0 7 6.0 8 8.0 9 11.0 10 8.0 11 23.0 12 11.0 13 17.0 14 12.0 15 15.0 16 10.0 17 16.0 18 16.0 19 13.0 20 11.0 21 16.0 22 19.0 23 15.0 24 29.0 25 31.0 26 36.0 27 39.0 28 51.0 29 49.0 30 55.0 31 71.0 32 103.0 33 127.0 34 169.0 35 242.0 36 441.0 37 940.0 38 1157.0 39 181.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.549999999999997 17.1 15.25 39.1 2 24.525 23.575 34.949999999999996 16.950000000000003 3 20.599999999999998 27.575 29.95 21.875 4 22.35 33.650000000000006 22.225 21.775 5 24.675 36.199999999999996 23.425 15.7 6 20.225 39.550000000000004 22.6 17.625 7 20.4 21.6 38.375 19.625 8 20.849999999999998 24.975 30.525000000000002 23.65 9 19.6 25.1 31.374999999999996 23.925 10-11 22.725 31.4875 25.2375 20.549999999999997 12-13 24.4 24.875 27.3125 23.4125 14-15 23.1375 27.875 27.9125 21.075 16-17 23.5 28.299999999999997 27.075 21.125 18-19 22.825 28.275 27.212500000000002 21.6875 20-21 22.475 28.825 26.924999999999997 21.775 22-23 22.9625 28.525 27.0625 21.45 24-25 23.0625 29.012500000000003 27.250000000000004 20.674999999999997 26-27 21.8625 28.975 28.037499999999998 21.125 28-29 22.725 27.462500000000002 28.3375 21.475 30-31 22.5625 28.212500000000002 28.6875 20.5375 32-33 22.825 28.599999999999998 27.6375 20.9375 34-35 22.925 28.15 27.575 21.349999999999998 36-37 22.7375 28.999999999999996 26.8 21.462500000000002 38-39 23.3625 29.15 26.637499999999996 20.849999999999998 40-41 23.3375 28.5625 27.450000000000003 20.65 42-43 23.1 28.449999999999996 27.737499999999997 20.7125 44-45 23.0875 28.012500000000003 27.8625 21.0375 46-47 22.6 28.575 27.275 21.55 48-49 23.5125 28.125 27.1 21.2625 50-51 22.725 28.3125 27.125 21.837500000000002 52-53 23.1 29.1875 26.4125 21.3 54-55 22.45 28.462500000000002 28.1625 20.925 56-57 22.8375 28.9 26.9125 21.349999999999998 58-59 21.9375 28.8625 27.9375 21.2625 60-61 23.150000000000002 27.750000000000004 27.462500000000002 21.637500000000003 62-63 22.7375 28.6625 27.525 21.075 64-65 23.150000000000002 28.712500000000002 26.637499999999996 21.5 66-67 22.7625 28.3375 28.475 20.424999999999997 68-69 22.45 28.549999999999997 27.8375 21.1625 70-71 23.150000000000002 27.750000000000004 27.8125 21.2875 72-73 23.2625 28.3625 27.750000000000004 20.625 74-75 22.912499999999998 28.8625 26.7125 21.512500000000003 76-77 23.1875 28.6375 27.1 21.075 78-79 22.3 28.549999999999997 28.1375 21.0125 80-81 22.4625 28.8625 27.625 21.05 82-83 23.4375 27.5625 27.3375 21.6625 84-85 22.9875 28.599999999999998 27.737499999999997 20.674999999999997 86-87 23.5125 29.262500000000003 27.3 19.925 88-89 22.650000000000002 29.075 27.462500000000002 20.8125 90-91 22.6 28.5875 27.8125 21.0 92-93 23.65 28.299999999999997 27.237499999999997 20.8125 94-95 23.9875 27.125 27.625 21.2625 96-97 23.200000000000003 28.8375 27.787499999999998 20.175 98-99 22.8375 29.175 26.924999999999997 21.0625 100-101 23.45 29.062500000000004 26.887499999999996 20.599999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.5 25 3.0 26 2.5 27 6.0 28 9.5 29 10.5 30 16.5 31 22.5 32 28.0 33 45.5 34 52.5 35 66.0 36 92.5 37 109.0 38 135.0 39 163.0 40 181.0 41 224.5 42 266.0 43 266.5 44 262.5 45 273.5 46 283.5 47 269.0 48 237.0 49 189.0 50 150.5 51 135.5 52 114.5 53 85.5 54 62.5 55 48.5 56 42.0 57 32.5 58 26.5 59 20.5 60 12.0 61 12.5 62 12.5 63 7.5 64 2.5 65 2.0 66 3.5 67 3.0 68 1.5 69 1.5 70 1.0 71 0.0 72 0.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.3 0.0 0.0 0.0 0.0 80-81 0.35 0.0 0.0 0.0 0.0 82-83 0.42500000000000004 0.0 0.0 0.0 0.0 84-85 0.5125 0.0 0.0 0.0 0.0 86-87 0.7375 0.0 0.0 0.0 0.0 88-89 0.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 845750 spots for ERR1864485.sra Written 845750 spots for ERR1864485.sra Read 845750 spots for ERR1864485.sra Written 845750 spots for ERR1864485.sra Read 845750 spots for ERR1864485.sra Written 845750 spots for ERR1864485.sra Read 845750 spots for ERR1864485.sra Written 845750 spots for ERR1864485.sra Read 845750 spots for ERR1864485.sra Written 845750 spots for ERR1864485.sra Read 845750 spots for ERR1864485.sra Written 845750 spots for ERR1864485.sra Read 845750 spots for ERR1864485.sra Written 845750 spots for ERR1864485.sra Read 845754 spots for ERR1864485.sra Written 845754 spots for ERR1864485.sra Read 845750 spots for ERR1864485.sra Written 845750 spots for ERR1864485.sra Read 845750 spots for ERR1864485.sra Written 845750 spots for ERR1864485.sra Read 845750 spots for ERR1864485.sra Written 845750 spots for ERR1864485.sra Read 845750 spots for ERR1864485.sra Written 845750 spots for ERR1864485.sra Read 845750 spots for ERR1864485.sra Written 845750 spots for ERR1864485.sra Read 845750 spots for ERR1864485.sra Written 845750 spots for ERR1864485.sra Read 845750 spots for ERR1864485.sra Written 845750 spots for ERR1864485.sra Read 845750 spots for ERR1864485.sra Written 845750 spots for ERR1864485.sra Read 845750 spots for ERR1864485.sra Written 845750 spots for ERR1864485.sra Read 845750 spots for ERR1864485.sra Written 845750 spots for ERR1864485.sra Read 845750 spots for ERR1864485.sra Written 845750 spots for ERR1864485.sra Read 845750 spots for ERR1864485.sra Written 845750 spots for ERR1864485.sra SRR ids: ['ERR1864485.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vs0e7u_a ERR1864485.sra spots: 16915004 blocks: [[1, 845750], [845751, 1691500], [1691501, 2537250], [2537251, 3383000], [3383001, 4228750], [4228751, 5074500], [5074501, 5920250], [5920251, 6766000], [6766001, 7611750], [7611751, 8457500], [8457501, 9303250], [9303251, 10149000], [10149001, 10994750], [10994751, 11840500], [11840501, 12686250], [12686251, 13532000], [13532001, 14377750], [14377751, 15223500], [15223501, 16069250], [16069251, 16915004]] ERR1864485 file size 4058383 ERR1864485 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864485 ERR1864485_1.fastq ERR1864485_2.fastq Input file: ERR1864485_1.fastq Paired file: ERR1864485_2.fastq trimmed: ERR1864485-trimmed-pair1.fastq, ERR1864485-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:01:20 2025 >> started Thu Feb 13 14:01:35 2025 >> done (15.279s) 16915004 read pairs processed; of these: 252835 ( 1.49%) short read pairs filtered out after trimming by size control 280927 ( 1.66%) empty read pairs filtered out after trimming by size control 16381242 (96.84%) read pairs available; of these: 3726389 (22.75%) trimmed read pairs available after processing 12654853 (77.25%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 142 0.00% 19 284 0.00% 20 443 0.00% 21 567 0.00% 22 770 0.00% 23 917 0.01% 24 1122 0.01% 25 1202 0.01% 26 1477 0.01% 27 1712 0.01% 28 2115 0.01% 29 2434 0.01% 30 2662 0.02% 31 2857 0.02% 32 3428 0.02% 33 3804 0.02% 34 4179 0.03% 35 4502 0.03% 36 4838 0.03% 37 5337 0.03% 38 5737 0.04% 39 6053 0.04% 40 6554 0.04% 41 6859 0.04% 42 7192 0.04% 43 7550 0.05% 44 8046 0.05% 45 8582 0.05% 46 8826 0.05% 47 9317 0.06% 48 9907 0.06% 49 10103 0.06% 50 10599 0.06% 51 11035 0.07% 52 11529 0.07% 53 11877 0.07% 54 12554 0.08% 55 13109 0.08% 56 13829 0.08% 57 14645 0.09% 58 15444 0.09% 59 19707 0.12% 60 23063 0.14% 61 23720 0.14% 62 24897 0.15% 63 26339 0.16% 64 26570 0.16% 65 27134 0.17% 66 28267 0.17% 67 29227 0.18% 68 30310 0.19% 69 31210 0.19% 70 32723 0.20% 71 34565 0.21% 72 35882 0.22% 73 37222 0.23% 74 38412 0.23% 75 39014 0.24% 76 39445 0.24% 77 41532 0.25% 78 43996 0.27% 79 46178 0.28% 80 48796 0.30% 81 50449 0.31% 82 54591 0.33% 83 55492 0.34% 84 57942 0.35% 85 61509 0.38% 86 65080 0.40% 87 68762 0.42% 88 70334 0.43% 89 75196 0.46% 90 82501 0.50% 91 90711 0.55% 92 100448 0.61% 93 111475 0.68% 94 125785 0.77% 95 146603 0.89% 96 173462 1.06% 97 213194 1.30% 98 276190 1.69% 99 369546 2.26% 100 494771 3.02% 101 12654853 77.25% 16381242 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=3.98 fanout-score-rank=26 prefix-density=0.19 prefix-fanout=2.7 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.05 sequence-density-rank=23 fanout-score=367.93 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=26.8 sequence=TCTTCTTCTTCTC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=5.57 fanout-score-rank=25 prefix-density=0.12 prefix-fanout=4.6 sequence=GGAAAGACCATCAC criterion=fanout-score sequence-density=0.05 sequence-density-rank=18 fanout-score=425.31 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=29.9 sequence=AAGAAGAAGAAG ERR1864485 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:02:05 Started mapping on | Feb 13 14:02:06 Finished on | Feb 13 14:02:44 Mapping speed, Million of reads per hour | 1551.91 Number of input reads | 16381242 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 15873576 Uniquely mapped reads % | 96.90% Average mapped length | 195.48 Number of splices: Total | 8678212 Number of splices: Annotated (sjdb) | 8532641 Number of splices: GT/AG | 8549441 Number of splices: GC/AG | 108344 Number of splices: AT/AC | 8741 Number of splices: Non-canonical | 11686 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 2.32 Insertion rate per base | 0.01% Insertion average length | 2.02 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 374989 % of reads mapped to multiple loci | 2.29% Number of reads mapped to too many loci | 49773 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.48% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 155329 155329 155329 N_multimapping 374989 374989 374989 N_noFeature 554000 15715669 620856 N_ambiguous 157524 663 66024 UnstrandedReadsAssigned:15162052 PositiveStrandReadsAssigned:157244 NegativeStrandReadsAssigned:15186696 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864485 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864485-trimmed-pair1.fastq ERR1864485-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,381,242 reads, 15,373,159 reads pseudoaligned [quant] estimated average fragment length: 163.598 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,201 rounds 52401 ERR1864485.ke.tsv 34699 ERR1864485.se.tsv 87100 total ==> ERR1864485.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1855.4 2074.2 94.3766 Potri.005G024800.1.v4.1 1035 872.402 669 64.7384 Potri.004G059700.1.v4.1 961 798.402 15 1.58607 Potri.007G009000.2.v4.1 1416 1253.4 0 0 Potri.003G141000.2.v4.1 2943 2780.4 582 17.6713 Potri.016G087400.1.v4.1 270 115.078 849.631 623.289 Potri.015G069301.1.v4.1 564 401.483 0 0 Potri.010G195200.1.v4.1 1773 1610.4 104 5.45194 Potri.012G127500.1.v4.1 977 814.402 290 30.0616 ==> ERR1864485.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1340 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 270 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 17 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 ERR1864485 completed mapping pipeline successfully