Starting /dee2/code/volunteer_pipeline.sh ERR1864486 current disk space = 3090278944768 free memory = 1400503780 ERR1864486 SRAfilesize 47930ec877f36b9e81699af641af4621 ERR1864486.sra ERR1864486.sra file validated ERR1864486 is paired end ERR1864486 is conventional basespace ERR1864486 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864486_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.859 34.0 31.0 34.0 30.0 34.0 2 31.98925 34.0 31.0 34.0 30.0 34.0 3 32.30975 34.0 31.0 34.0 30.0 34.0 4 35.72525 37.0 35.0 37.0 35.0 37.0 5 35.44875 37.0 35.0 37.0 33.0 37.0 6 35.44225 37.0 35.0 37.0 33.0 37.0 7 35.44325 37.0 36.0 37.0 33.0 37.0 8 35.42225 37.0 35.0 37.0 33.0 37.0 9 37.13575 39.0 38.0 39.0 34.0 39.0 10-11 37.069125 39.0 37.5 39.0 34.0 39.0 12-13 37.003625 39.0 38.0 39.0 34.0 39.0 14-15 38.53525 41.0 39.0 41.0 34.0 41.0 16-17 38.432625 41.0 38.5 41.0 34.0 41.0 18-19 38.31125 41.0 38.5 41.0 34.0 41.0 20-21 38.203500000000005 41.0 38.5 41.0 33.5 41.0 22-23 38.15975 40.0 38.0 41.0 33.0 41.0 24-25 38.095375 40.0 38.0 41.0 33.0 41.0 26-27 37.956625 40.0 38.0 41.0 33.0 41.0 28-29 37.917874999999995 40.0 38.0 41.0 33.0 41.0 30-31 37.83225 40.0 38.0 41.0 33.0 41.0 32-33 37.75075 40.0 38.0 41.0 33.0 41.0 34-35 37.550625 40.0 38.0 41.0 32.0 41.0 36-37 37.44625 40.0 38.0 41.0 31.0 41.0 38-39 37.270875000000004 40.0 37.5 41.0 31.5 41.0 40-41 37.208125 40.0 37.0 41.0 31.0 41.0 42-43 37.082375 40.0 37.0 41.0 30.5 41.0 44-45 37.08525 40.0 37.0 41.0 31.0 41.0 46-47 37.243 40.0 37.0 41.0 31.0 41.0 48-49 37.075125 40.0 37.0 41.0 31.0 41.0 50-51 36.879999999999995 40.0 37.0 41.0 30.5 41.0 52-53 36.567875 40.0 36.5 41.0 29.5 41.0 54-55 36.53075 40.0 36.0 41.0 30.0 41.0 56-57 36.311125 39.0 36.0 41.0 29.5 41.0 58-59 36.07425 39.0 35.5 41.0 29.0 41.0 60-61 35.799875 39.0 35.0 40.5 28.0 41.0 62-63 35.4005 38.0 35.0 40.0 28.0 41.0 64-65 35.106875 38.0 34.5 40.0 28.0 41.0 66-67 34.712125 37.0 34.0 40.0 27.5 41.0 68-69 34.319125 37.0 34.0 39.0 26.0 41.0 70-71 33.885374999999996 36.0 34.0 39.0 26.0 40.5 72-73 33.44475 36.0 33.5 38.5 26.0 40.0 74-75 33.003375 35.0 33.0 37.5 26.0 39.5 76-77 31.860875 34.5 31.5 36.0 23.0 39.0 78-79 32.17275 35.0 32.0 36.5 25.0 39.0 80-81 31.994999999999997 35.0 32.0 36.0 25.0 37.5 82-83 31.670875 35.0 32.0 36.0 23.5 37.0 84-85 31.341625 35.0 32.0 35.0 23.5 37.0 86-87 31.141750000000002 34.0 32.0 35.0 23.0 36.0 88-89 30.760875 34.0 31.0 35.0 20.0 36.0 90-91 30.474875 34.0 31.0 35.0 19.0 35.5 92-93 30.17725 34.0 31.0 35.0 18.0 35.0 94-95 29.8705 34.0 31.0 35.0 8.5 35.0 96-97 29.578375 34.0 30.5 35.0 2.0 35.0 98-99 29.378625 34.0 31.0 35.0 2.0 35.0 100-101 28.59825 33.5 29.5 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 35.0 3 17.0 4 7.0 5 5.0 6 8.0 7 5.0 8 7.0 9 5.0 10 6.0 11 9.0 12 9.0 13 10.0 14 7.0 15 13.0 16 11.0 17 17.0 18 11.0 19 19.0 20 15.0 21 16.0 22 14.0 23 10.0 24 25.0 25 14.0 26 30.0 27 36.0 28 41.0 29 54.0 30 56.0 31 87.0 32 81.0 33 132.0 34 174.0 35 283.0 36 439.0 37 968.0 38 1181.0 39 143.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.22784810126583 5.721518987341772 6.810126582278481 51.24050632911392 2 23.3 7.9750000000000005 34.675 34.050000000000004 3 23.21160580290145 10.55527763881941 22.461230615307652 43.77188594297149 4 26.825 18.325 22.075 32.775 5 24.575 23.674999999999997 26.974999999999998 24.775 6 19.625 28.525 28.575 23.275000000000002 7 15.6 21.9 44.15 18.35 8 16.825000000000003 25.474999999999998 34.849999999999994 22.85 9 17.424999999999997 22.0 38.224999999999994 22.35 10-11 18.675 32.1875 28.725 20.4125 12-13 20.474999999999998 25.362499999999997 30.9 23.2625 14-15 19.787499999999998 26.275 31.3125 22.625 16-17 20.7 27.3375 28.175 23.7875 18-19 20.05 27.462500000000002 28.125 24.3625 20-21 20.9125 26.950000000000003 28.299999999999997 23.8375 22-23 19.5 28.3125 28.5875 23.599999999999998 24-25 21.099999999999998 27.900000000000002 27.450000000000003 23.549999999999997 26-27 20.625 26.6 28.8375 23.9375 28-29 20.9875 26.8125 28.6375 23.5625 30-31 20.2375 26.924999999999997 29.3375 23.5 32-33 20.8625 27.075 28.349999999999998 23.7125 34-35 20.375 27.925 28.0625 23.6375 36-37 20.275000000000002 27.2625 28.4125 24.05 38-39 20.25 27.0875 28.512500000000003 24.15 40-41 20.5375 27.474999999999998 28.262500000000003 23.724999999999998 42-43 20.1 27.5125 27.787499999999998 24.6 44-45 19.8625 26.75 28.549999999999997 24.837500000000002 46-47 20.7875 28.1625 27.3625 23.6875 48-49 19.8875 27.775 28.1625 24.175 50-51 20.4875 27.462500000000002 28.375 23.674999999999997 52-53 20.674999999999997 28.825 28.050000000000004 22.45 54-55 21.1375 26.875 27.950000000000003 24.0375 56-57 20.225 27.55 28.925 23.3 58-59 20.9375 27.85 27.650000000000002 23.5625 60-61 21.1375 27.425 27.900000000000002 23.5375 62-63 20.45 26.6625 29.0875 23.799999999999997 64-65 20.7375 27.575 28.000000000000004 23.6875 66-67 20.95 27.025 28.537499999999998 23.4875 68-69 21.512500000000003 27.212500000000002 27.9375 23.3375 70-71 20.5875 28.5875 27.125 23.7 72-73 21.349999999999998 27.0875 27.5625 24.0 74-75 20.7625 27.237499999999997 29.025000000000002 22.975 76-77 20.8 26.700000000000003 28.449999999999996 24.05 78-79 21.55 26.5625 28.125 23.7625 80-81 20.175 26.525 28.875 24.425 82-83 20.7125 26.400000000000002 28.225 24.6625 84-85 21.712500000000002 26.9125 27.325 24.05 86-87 21.15 27.737499999999997 28.0625 23.05 88-89 20.5 27.237499999999997 28.425 23.8375 90-91 21.4875 26.6625 28.037499999999998 23.8125 92-93 21.325 27.025 27.8875 23.7625 94-95 22.0875 27.950000000000003 26.6125 23.35 96-97 21.85 27.1 27.500000000000004 23.549999999999997 98-99 21.375 27.275 28.325 23.025000000000002 100-101 21.775 27.35 27.3875 23.4875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 2.0 27 4.5 28 6.0 29 8.5 30 11.5 31 14.5 32 22.0 33 30.0 34 38.0 35 56.0 36 73.0 37 89.0 38 110.5 39 132.0 40 167.5 41 206.5 42 227.5 43 273.5 44 292.0 45 267.5 46 264.5 47 263.5 48 241.5 49 218.0 50 190.0 51 156.0 52 120.0 53 94.0 54 89.5 55 74.0 56 56.5 57 42.5 58 35.5 59 27.5 60 18.0 61 13.0 62 10.5 63 9.5 64 9.5 65 6.5 66 4.5 67 4.5 68 3.5 69 2.0 70 1.0 71 1.5 72 1.5 73 1.5 74 0.5 75 0.5 76 0.5 77 0.0 78 1.0 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.25 2 0.0 3 0.05 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.15 #Duplication Level Percentage of deduplicated Percentage of total 1 98.65002547121753 96.825 2 0.9933774834437087 1.95 3 0.20376974019358124 0.6 4 0.1273560876209883 0.5 5 0.025471217524197655 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTGATTTCAGTCCCGGCATGTCAATGACGAACGCATAAGAGCTTGGATA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0125 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.037500000000000006 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.2875 0.0 0.0 0.0 0.0 76-77 0.3875 0.0 0.0 0.0 0.0 78-79 0.525 0.0 0.0 0.0 0.0 80-81 0.6875 0.0 0.0 0.0 0.0 82-83 0.7875 0.0 0.0 0.0 0.0 84-85 0.9750000000000001 0.0 0.0 0.0 0.0 86-87 1.35 0.0 0.0 0.0 0.0 88-89 1.7000000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGGAAGA 15 0.009957196 47.5 94-95 ATCGGAA 15 0.009957196 47.5 92-93 AGATCGG 25 0.001521768 38.0 90-91 >>END_MODULE ERR1864486 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864486_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.074 34.0 31.0 34.0 30.0 34.0 2 32.22425 34.0 31.0 34.0 30.0 34.0 3 32.2255 34.0 31.0 34.0 30.0 34.0 4 35.58375 37.0 37.0 37.0 33.0 37.0 5 35.51525 37.0 35.0 37.0 33.0 37.0 6 35.49425 37.0 36.0 37.0 33.0 37.0 7 35.45925 37.0 36.0 37.0 33.0 37.0 8 35.491 37.0 36.0 37.0 33.0 37.0 9 37.09875 39.0 38.0 39.0 34.0 39.0 10-11 37.07599999999999 39.0 37.5 39.0 33.5 39.0 12-13 37.028999999999996 39.0 37.5 39.0 33.5 39.0 14-15 38.445625 41.0 38.0 41.0 34.0 41.0 16-17 38.296125 41.0 38.0 41.0 33.0 41.0 18-19 38.26375 41.0 38.5 41.0 33.5 41.0 20-21 38.295500000000004 40.0 38.0 41.0 34.0 41.0 22-23 38.149249999999995 40.0 38.0 41.0 33.0 41.0 24-25 38.122875 40.0 38.0 41.0 33.0 41.0 26-27 37.979749999999996 40.0 38.0 41.0 32.5 41.0 28-29 37.884249999999994 40.0 38.0 41.0 33.0 41.0 30-31 37.677875 40.0 38.0 41.0 32.5 41.0 32-33 37.639125 40.0 38.0 41.0 32.0 41.0 34-35 37.698 40.0 38.0 41.0 32.5 41.0 36-37 37.51649999999999 40.0 38.0 41.0 31.5 41.0 38-39 37.431749999999994 40.0 38.0 41.0 31.5 41.0 40-41 37.270375 40.0 38.0 41.0 31.0 41.0 42-43 37.106875 40.0 37.0 41.0 31.0 41.0 44-45 36.967124999999996 40.0 37.0 41.0 30.5 41.0 46-47 36.732375 40.0 36.5 41.0 30.0 41.0 48-49 36.5845 39.5 36.0 41.0 30.0 41.0 50-51 36.3865 39.5 36.5 40.5 30.0 41.0 52-53 36.55275 39.0 37.0 40.5 30.5 41.0 54-55 36.744125 40.0 37.0 41.0 30.5 41.0 56-57 36.662125 40.0 36.5 41.0 30.5 41.0 58-59 36.181 39.0 36.0 41.0 28.0 41.0 60-61 35.9865 39.0 35.0 41.0 28.0 41.0 62-63 35.742875 39.0 35.0 41.0 28.0 41.0 64-65 35.467875 38.0 35.0 40.0 28.5 41.0 66-67 35.067375 37.5 35.0 40.0 28.0 41.0 68-69 34.636375 37.0 34.0 39.0 27.5 41.0 70-71 34.27875 36.5 34.0 39.0 27.5 41.0 72-73 33.87925 36.0 34.0 39.0 27.0 40.0 74-75 33.492875 35.5 34.0 37.5 26.5 39.5 76-77 32.991 35.0 33.0 37.0 26.0 39.0 78-79 32.523875000000004 35.0 33.0 36.5 26.0 38.5 80-81 32.112 35.0 33.0 36.0 25.5 37.0 82-83 31.718875 35.0 32.0 35.5 24.5 37.0 84-85 31.300125 35.0 32.0 35.0 22.5 36.5 86-87 30.99075 35.0 32.0 35.0 20.5 36.0 88-89 30.742625 34.5 31.5 35.0 20.0 36.0 90-91 30.444875 34.0 31.0 35.0 18.0 35.5 92-93 30.159625 34.0 31.0 35.0 17.0 35.0 94-95 29.92575 34.0 31.0 35.0 7.0 35.0 96-97 29.547375000000002 34.0 30.5 35.0 2.0 35.0 98-99 29.053874999999998 34.0 30.0 35.0 2.0 35.0 100-101 27.965249999999997 33.5 28.5 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 24.0 3 4.0 4 6.0 5 6.0 6 4.0 7 7.0 8 9.0 9 13.0 10 10.0 11 10.0 12 12.0 13 9.0 14 9.0 15 15.0 16 5.0 17 14.0 18 15.0 19 20.0 20 10.0 21 13.0 22 15.0 23 23.0 24 19.0 25 27.0 26 27.0 27 41.0 28 37.0 29 58.0 30 62.0 31 92.0 32 100.0 33 130.0 34 164.0 35 231.0 36 470.0 37 976.0 38 1147.0 39 166.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.625 18.125 14.725 38.525 2 24.325 24.975 33.275 17.424999999999997 3 21.175 27.075 29.5 22.25 4 22.95 33.875 22.15 21.025 5 23.925 35.675000000000004 23.549999999999997 16.85 6 19.175 38.475 23.775 18.575 7 20.474999999999998 20.75 39.0 19.775000000000002 8 21.45 25.074999999999996 29.375 24.099999999999998 9 21.9 22.425 32.1 23.575 10-11 22.55 31.7875 24.575 21.087500000000002 12-13 23.375 26.400000000000002 27.700000000000003 22.525000000000002 14-15 22.9625 29.025000000000002 27.1 20.9125 16-17 23.525 27.9125 27.1 21.462500000000002 18-19 23.575 27.925 26.9125 21.587500000000002 20-21 23.0625 30.075000000000003 26.137500000000003 20.724999999999998 22-23 23.0375 28.625 26.775 21.5625 24-25 22.725 29.099999999999998 27.1375 21.0375 26-27 22.3125 28.9125 26.8375 21.9375 28-29 22.8625 28.7375 27.1 21.3 30-31 23.575 28.15 27.625 20.65 32-33 22.5875 28.799999999999997 27.250000000000004 21.3625 34-35 24.087500000000002 29.062500000000004 26.275 20.575 36-37 23.3875 29.575000000000003 26.200000000000003 20.837500000000002 38-39 22.225 29.099999999999998 27.1 21.575 40-41 23.275000000000002 28.549999999999997 26.6 21.575 42-43 23.1 27.925 27.3375 21.637500000000003 44-45 23.6625 27.8375 27.0875 21.4125 46-47 23.275000000000002 28.962500000000002 26.5875 21.175 48-49 22.8625 28.075 26.8625 22.2 50-51 23.724999999999998 28.275 27.212500000000002 20.7875 52-53 24.3125 28.349999999999998 27.3125 20.025000000000002 54-55 23.7875 27.1 27.4125 21.7 56-57 22.775000000000002 27.85 28.275 21.099999999999998 58-59 23.375 28.787499999999998 26.825 21.0125 60-61 23.4125 28.537499999999998 26.787499999999998 21.2625 62-63 24.025 28.349999999999998 26.674999999999997 20.95 64-65 24.05 28.775000000000002 26.387500000000003 20.7875 66-67 23.7 28.4 26.8 21.099999999999998 68-69 23.45 29.1375 26.787499999999998 20.625 70-71 24.05 28.525 26.337500000000002 21.087500000000002 72-73 24.075 28.262500000000003 26.55 21.1125 74-75 22.675 28.975 27.5125 20.837500000000002 76-77 23.799999999999997 28.725 26.724999999999998 20.75 78-79 23.150000000000002 28.125 26.9125 21.8125 80-81 23.7125 28.6375 27.1375 20.5125 82-83 24.3125 28.262500000000003 26.575 20.849999999999998 84-85 24.025 28.6625 25.974999999999998 21.337500000000002 86-87 23.8625 28.8375 26.7125 20.5875 88-89 24.55 28.225 26.325 20.9 90-91 23.35 27.675 27.375 21.6 92-93 23.6125 28.599999999999998 27.275 20.5125 94-95 23.9125 28.775000000000002 26.7125 20.599999999999998 96-97 24.825 28.675 25.8125 20.6875 98-99 24.5375 29.362500000000004 25.424999999999997 20.674999999999997 100-101 25.575 28.4125 25.112499999999997 20.9 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 1.5 26 5.5 27 7.0 28 8.0 29 10.5 30 14.0 31 14.5 32 18.5 33 26.0 34 40.5 35 61.5 36 81.5 37 107.5 38 116.5 39 143.0 40 200.5 41 227.0 42 239.5 43 261.0 44 274.0 45 287.0 46 284.0 47 251.5 48 230.5 49 220.5 50 184.0 51 140.0 52 116.5 53 98.0 54 69.0 55 51.5 56 45.5 57 30.5 58 20.0 59 17.0 60 18.5 61 15.5 62 11.0 63 10.0 64 7.5 65 8.0 66 7.0 67 4.0 68 2.0 69 1.0 70 0.5 71 1.0 72 1.0 73 0.5 74 0.0 75 0.5 76 0.5 77 0.5 78 1.5 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3195564516129 98.52499999999999 2 0.5544354838709677 1.0999999999999999 3 0.12600806451612903 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0125 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.037500000000000006 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.2875 0.0 0.0 0.0 0.0 76-77 0.3625 0.0 0.0 0.0 0.0 78-79 0.525 0.0 0.0 0.0 0.0 80-81 0.6875 0.0 0.0 0.0 0.0 82-83 0.7875 0.0 0.0 0.0 0.0 84-85 0.95 0.0 0.0 0.0 0.0 86-87 1.35 0.0 0.0 0.0 0.0 88-89 1.7000000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGGAAGA 15 0.009957196 47.5 94-95 ATCGGAA 15 0.009957196 47.5 92-93 >>END_MODULE Read 700766 spots for ERR1864486.sra Written 700766 spots for ERR1864486.sra Read 700766 spots for ERR1864486.sra Written 700766 spots for ERR1864486.sra Read 700766 spots for ERR1864486.sra Written 700766 spots for ERR1864486.sra Read 700766 spots for ERR1864486.sra Written 700766 spots for ERR1864486.sra Read 700766 spots for ERR1864486.sra Written 700766 spots for ERR1864486.sra Read 700766 spots for ERR1864486.sra Written 700766 spots for ERR1864486.sra Read 700766 spots for ERR1864486.sra Written 700766 spots for ERR1864486.sra Read 700766 spots for ERR1864486.sra Written 700766 spots for ERR1864486.sra Read 700766 spots for ERR1864486.sra Written 700766 spots for ERR1864486.sra Read 700766 spots for ERR1864486.sra Written 700766 spots for ERR1864486.sra Read 700766 spots for ERR1864486.sra Written 700766 spots for ERR1864486.sra Read 700766 spots for ERR1864486.sra Written 700766 spots for ERR1864486.sra Read 700771 spots for ERR1864486.sra Written 700771 spots for ERR1864486.sra Read 700766 spots for ERR1864486.sra Written 700766 spots for ERR1864486.sra Read 700766 spots for ERR1864486.sra Written 700766 spots for ERR1864486.sra Read 700766 spots for ERR1864486.sra Written 700766 spots for ERR1864486.sra Read 700766 spots for ERR1864486.sra Written 700766 spots for ERR1864486.sra Read 700766 spots for ERR1864486.sra Written 700766 spots for ERR1864486.sra Read 700766 spots for ERR1864486.sra Written 700766 spots for ERR1864486.sra Read 700766 spots for ERR1864486.sra Written 700766 spots for ERR1864486.sra SRR ids: ['ERR1864486.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kalbfbv8 ERR1864486.sra spots: 14015325 blocks: [[1, 700766], [700767, 1401532], [1401533, 2102298], [2102299, 2803064], [2803065, 3503830], [3503831, 4204596], [4204597, 4905362], [4905363, 5606128], [5606129, 6306894], [6306895, 7007660], [7007661, 7708426], [7708427, 8409192], [8409193, 9109958], [9109959, 9810724], [9810725, 10511490], [10511491, 11212256], [11212257, 11913022], [11913023, 12613788], [12613789, 13314554], [13314555, 14015325]] ERR1864486 file size 3358949 ERR1864486 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864486 ERR1864486_1.fastq ERR1864486_2.fastq Input file: ERR1864486_1.fastq Paired file: ERR1864486_2.fastq trimmed: ERR1864486-trimmed-pair1.fastq, ERR1864486-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:56:47 2025 >> started Thu Feb 13 13:57:01 2025 >> done (13.410s) 14015325 read pairs processed; of these: 200852 ( 1.43%) short read pairs filtered out after trimming by size control 219605 ( 1.57%) empty read pairs filtered out after trimming by size control 13594868 (97.00%) read pairs available; of these: 3287074 (24.18%) trimmed read pairs available after processing 10307794 (75.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 95 0.00% 19 219 0.00% 20 347 0.00% 21 443 0.00% 22 604 0.00% 23 683 0.01% 24 846 0.01% 25 964 0.01% 26 1197 0.01% 27 1424 0.01% 28 1617 0.01% 29 1783 0.01% 30 2085 0.02% 31 2442 0.02% 32 2686 0.02% 33 2933 0.02% 34 3342 0.02% 35 3546 0.03% 36 3815 0.03% 37 4155 0.03% 38 4474 0.03% 39 4980 0.04% 40 5211 0.04% 41 5480 0.04% 42 5790 0.04% 43 6288 0.05% 44 6392 0.05% 45 6960 0.05% 46 7285 0.05% 47 7657 0.06% 48 7833 0.06% 49 8482 0.06% 50 8766 0.06% 51 9039 0.07% 52 9639 0.07% 53 9744 0.07% 54 10574 0.08% 55 10850 0.08% 56 11779 0.09% 57 12461 0.09% 58 13314 0.10% 59 16327 0.12% 60 19741 0.15% 61 20005 0.15% 62 20490 0.15% 63 21860 0.16% 64 22772 0.17% 65 23156 0.17% 66 23830 0.18% 67 25000 0.18% 68 25937 0.19% 69 27266 0.20% 70 28304 0.21% 71 29642 0.22% 72 31173 0.23% 73 32454 0.24% 74 33189 0.24% 75 34327 0.25% 76 34944 0.26% 77 37384 0.27% 78 38962 0.29% 79 41486 0.31% 80 43830 0.32% 81 45983 0.34% 82 48913 0.36% 83 50567 0.37% 84 53499 0.39% 85 56729 0.42% 86 59750 0.44% 87 63122 0.46% 88 65120 0.48% 89 69559 0.51% 90 76135 0.56% 91 83884 0.62% 92 91328 0.67% 93 102152 0.75% 94 114917 0.85% 95 133087 0.98% 96 155168 1.14% 97 188431 1.39% 98 241737 1.78% 99 320978 2.36% 100 425712 3.13% 101 10307794 75.82% 13594868 reads passed initial QC criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=25 prefix-density=0.87 prefix-fanout=2.0 sequence=GTGAAGGGAAAGTCCTGGAAAGGGTCCCAGATGTCAAGAGAGAAAGGATCAAAGA criterion=fanout-score sequence-density=0.05 sequence-density-rank=29 fanout-score=346.32 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=19.7 sequence=TTCTTCTTCACTTTCTCATCCTCTGCTTTGTATCTCTCTGCCTCTTGCACCATTCTCTCAATATCATCCTTGCCCAGTCTTCCCTTGTCATTGGTGATGGTAATCTTATTCTTCACTCCTGAAGCCTTATCTTCTGCAGAAACATTCAAGATGCCATTTGCATCGATGTCGAAGCATACATTGAT criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=3.43 fanout-score-rank=19 prefix-density=0.73 prefix-fanout=2.8 sequence=AACAAGAAACCAAGAAAATGTCTCT criterion=fanout-score sequence-density=0.04 sequence-density-rank=31 fanout-score=100.61 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=6.8 sequence=GAAGAGAAAAAAGGGGATCACTGGCACAGAGTAGAGAGATCGTATGGCAAGTTCATCAGGCAGTTTAAGCTGCCAGAGAATGTGGACTTGGA ERR1864486 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:57:32 Started mapping on | Feb 13 13:57:32 Finished on | Feb 13 13:58:09 Mapping speed, Million of reads per hour | 1322.74 Number of input reads | 13594868 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 12964448 Uniquely mapped reads % | 95.36% Average mapped length | 195.21 Number of splices: Total | 6442126 Number of splices: Annotated (sjdb) | 6229413 Number of splices: GT/AG | 6341466 Number of splices: GC/AG | 80301 Number of splices: AT/AC | 6690 Number of splices: Non-canonical | 13669 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 2.32 Insertion rate per base | 0.01% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 459548 % of reads mapped to multiple loci | 3.38% Number of reads mapped to too many loci | 60267 % of reads mapped to too many loci | 0.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.78% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 189724 189724 189724 N_multimapping 459548 459548 459548 N_noFeature 606868 12783558 717209 N_ambiguous 116189 869 44907 UnstrandedReadsAssigned:12241391 PositiveStrandReadsAssigned:180021 NegativeStrandReadsAssigned:12202332 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864486 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864486-trimmed-pair1.fastq ERR1864486-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,594,868 reads, 12,452,627 reads pseudoaligned [quant] estimated average fragment length: 155.025 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,139 rounds 52401 ERR1864486.ke.tsv 34699 ERR1864486.se.tsv 87100 total ==> ERR1864486.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1863.97 1161.09 61.542 Potri.005G024800.1.v4.1 1035 880.975 859 96.3329 Potri.004G059700.1.v4.1 961 806.979 18 2.20371 Potri.007G009000.2.v4.1 1416 1261.97 0 0 Potri.003G141000.2.v4.1 2943 2788.97 454.492 16.1 Potri.016G087400.1.v4.1 270 121.471 1067.6 868.327 Potri.015G069301.1.v4.1 564 410.109 0 0 Potri.010G195200.1.v4.1 1773 1618.97 18 1.09844 Potri.012G127500.1.v4.1 977 822.979 668 80.1923 ==> ERR1864486.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 931 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 99 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 ERR1864486 completed mapping pipeline successfully