Starting /dee2/code/volunteer_pipeline.sh ERR1864487 current disk space = 3089706012672 free memory = 1451429416 ERR1864487 SRAfilesize e76599f60e19aabd35594e81450bb6e0 ERR1864487.sra ERR1864487.sra file validated ERR1864487 is paired end ERR1864487 is conventional basespace ERR1864487 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864487_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.93125 34.0 31.0 34.0 30.0 34.0 2 32.0255 34.0 31.0 34.0 30.0 34.0 3 32.335 34.0 31.0 34.0 30.0 34.0 4 35.7845 37.0 35.0 37.0 35.0 37.0 5 35.527 37.0 35.0 37.0 33.0 37.0 6 35.44125 37.0 35.0 37.0 33.0 37.0 7 35.4255 37.0 35.0 37.0 33.0 37.0 8 35.45675 37.0 35.0 37.0 33.0 37.0 9 37.0945 39.0 38.0 39.0 33.0 39.0 10-11 37.044624999999996 39.0 38.0 39.0 33.5 39.0 12-13 37.006875 39.0 37.5 39.0 33.0 39.0 14-15 38.399 41.0 38.5 41.0 33.5 41.0 16-17 38.4125 41.0 38.5 41.0 33.5 41.0 18-19 38.30575 41.0 38.5 41.0 33.5 41.0 20-21 38.240750000000006 40.5 38.0 41.0 33.0 41.0 22-23 38.126000000000005 40.0 38.0 41.0 33.0 41.0 24-25 38.064750000000004 40.0 38.0 41.0 33.5 41.0 26-27 37.912125 40.0 38.0 41.0 32.5 41.0 28-29 37.946875 40.0 38.0 41.0 33.0 41.0 30-31 37.77025 40.0 38.0 41.0 32.5 41.0 32-33 37.610375000000005 40.0 38.0 41.0 31.5 41.0 34-35 37.58125 40.0 38.0 41.0 32.0 41.0 36-37 37.5345 40.0 38.0 41.0 32.0 41.0 38-39 37.230875 40.0 37.5 41.0 31.0 41.0 40-41 37.150875 40.0 38.0 41.0 30.5 41.0 42-43 37.044250000000005 40.0 37.0 41.0 31.0 41.0 44-45 36.988749999999996 40.0 37.0 41.0 30.5 41.0 46-47 37.163375 40.0 37.0 41.0 31.0 41.0 48-49 37.048249999999996 40.0 37.0 41.0 31.0 41.0 50-51 36.799625 40.0 37.0 41.0 30.5 41.0 52-53 36.560625 40.0 36.0 41.0 30.0 41.0 54-55 36.490625 40.0 36.0 41.0 30.0 41.0 56-57 36.151250000000005 39.0 36.0 41.0 28.5 41.0 58-59 35.948625 39.0 35.0 41.0 28.5 41.0 60-61 35.786375 39.0 35.0 40.5 28.0 41.0 62-63 35.3695 38.5 35.0 40.0 28.0 41.0 64-65 34.979 38.0 34.5 40.0 27.0 41.0 66-67 34.590375 37.0 34.0 40.0 26.5 41.0 68-69 34.203374999999994 37.0 34.0 39.5 26.0 41.0 70-71 33.806375 36.0 34.0 39.0 26.0 40.0 72-73 33.4015 36.0 33.0 39.0 26.0 40.0 74-75 32.949124999999995 35.0 33.0 37.5 25.5 39.5 76-77 32.036375 34.5 31.5 36.5 24.5 39.0 78-79 32.163875000000004 35.0 32.0 36.5 25.0 39.0 80-81 31.98675 35.0 32.5 36.0 24.5 37.5 82-83 31.715 35.0 32.0 36.0 24.5 37.0 84-85 31.357374999999998 35.0 32.0 35.0 23.5 37.0 86-87 31.049 34.5 32.0 35.0 21.5 36.0 88-89 30.669625 34.0 31.0 35.0 20.0 36.0 90-91 30.57575 34.0 31.0 35.0 20.0 35.5 92-93 30.235500000000002 34.0 31.0 35.0 18.5 35.0 94-95 29.88275 34.0 31.0 35.0 10.0 35.0 96-97 29.645625 34.0 31.0 35.0 2.0 35.0 98-99 29.405124999999998 34.0 31.0 35.0 2.0 35.0 100-101 28.648625000000003 33.5 29.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 28.0 3 18.0 4 8.0 5 5.0 6 4.0 7 9.0 8 10.0 9 8.0 10 5.0 11 7.0 12 8.0 13 19.0 14 10.0 15 16.0 16 17.0 17 10.0 18 7.0 19 16.0 20 14.0 21 15.0 22 21.0 23 15.0 24 25.0 25 14.0 26 15.0 27 39.0 28 50.0 29 43.0 30 61.0 31 87.0 32 94.0 33 116.0 34 174.0 35 280.0 36 444.0 37 920.0 38 1205.0 39 163.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.99038218172615 6.049101493292837 6.859023032143761 49.101493292837255 2 23.45 8.175 36.55 31.825 3 23.423423423423422 11.11111111111111 23.323323323323322 42.14214214214214 4 27.825 17.65 20.65 33.875 5 25.324999999999996 24.15 26.400000000000002 24.125 6 20.599999999999998 29.725 27.55 22.125 7 16.325 22.975 43.475 17.224999999999998 8 17.2 23.325000000000003 36.4 23.075000000000003 9 17.150000000000002 23.200000000000003 36.9 22.75 10-11 19.5625 32.0 28.225 20.2125 12-13 21.212500000000002 24.8625 30.2 23.724999999999998 14-15 19.4875 27.625 30.275000000000002 22.6125 16-17 20.95 27.212500000000002 28.1875 23.65 18-19 20.424999999999997 27.4125 27.525 24.637500000000003 20-21 20.349999999999998 26.4625 29.825000000000003 23.3625 22-23 21.224999999999998 27.8625 28.025 22.8875 24-25 21.2 27.187499999999996 27.975 23.6375 26-27 20.962500000000002 27.6625 27.962500000000002 23.4125 28-29 20.6375 27.075 28.475 23.8125 30-31 20.3875 27.437499999999996 28.749999999999996 23.425 32-33 20.2375 26.150000000000002 28.825 24.7875 34-35 20.3125 27.0 28.9875 23.7 36-37 20.3125 27.725 28.0625 23.9 38-39 20.375 27.500000000000004 28.275 23.849999999999998 40-41 20.0875 27.962500000000002 28.1625 23.7875 42-43 20.8 27.212500000000002 28.4 23.5875 44-45 20.1125 26.75 28.7 24.4375 46-47 20.9375 26.7125 28.5625 23.7875 48-49 21.2875 27.3875 27.5125 23.8125 50-51 20.275000000000002 27.375 29.275000000000002 23.075000000000003 52-53 21.875 26.987499999999997 28.712500000000002 22.425 54-55 20.6375 27.224999999999998 28.65 23.4875 56-57 20.549999999999997 27.537499999999998 28.6125 23.3 58-59 20.5 27.925 27.787499999999998 23.7875 60-61 21.0625 26.9625 27.650000000000002 24.325 62-63 20.349999999999998 27.8375 28.3875 23.425 64-65 20.75 27.6375 27.5625 24.05 66-67 21.087500000000002 27.800000000000004 27.6125 23.5 68-69 20.91511438929866 27.340917614701837 28.30353794224278 23.44043005375672 70-71 21.5625 27.950000000000003 27.55 22.9375 72-73 21.3125 26.674999999999997 28.5625 23.45 74-75 21.315164395549445 27.365920740092513 27.890986373296663 23.427928491061383 76-77 20.4875 28.0875 27.3375 24.087500000000002 78-79 21.1125 27.575 27.5625 23.75 80-81 20.674999999999997 27.400000000000002 28.575 23.35 82-83 21.075 28.475 27.224999999999998 23.225 84-85 21.224999999999998 27.55 26.9625 24.2625 86-87 21.1625 26.987499999999997 27.925 23.925 88-89 21.1375 27.775 27.8375 23.25 90-91 21.425 26.85 28.349999999999998 23.375 92-93 20.225 27.6375 28.1625 23.974999999999998 94-95 21.85 27.3125 27.425 23.4125 96-97 22.125 27.725 26.150000000000002 24.0 98-99 21.725 27.962500000000002 27.925 22.3875 100-101 22.3125 27.950000000000003 26.375 23.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 2.0 26 4.5 27 5.0 28 7.0 29 9.0 30 13.0 31 20.0 32 25.5 33 28.5 34 37.0 35 50.5 36 72.0 37 94.0 38 119.5 39 138.5 40 165.5 41 208.0 42 228.0 43 254.0 44 276.5 45 266.5 46 251.0 47 256.0 48 253.5 49 224.5 50 180.5 51 151.0 52 128.0 53 101.5 54 91.5 55 77.0 56 63.0 57 49.5 58 33.5 59 23.5 60 17.0 61 14.0 62 13.0 63 9.5 64 6.0 65 5.5 66 4.0 67 4.0 68 4.0 69 3.0 70 3.0 71 1.5 72 0.5 73 0.5 74 0.0 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.225 2 0.0 3 0.1 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0125 70-71 0.0 72-73 0.0 74-75 0.0125 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.975 #Duplication Level Percentage of deduplicated Percentage of total 1 98.39244705281959 96.39999999999999 2 1.2758356723653992 2.5 3 0.25516713447307987 0.75 4 0.05103342689461597 0.2 5 0.0 0.0 6 0.025516713447307986 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCCCCTCAATGCTAACCACCGTAGGACCCTTGATTTTGTCAAGGGACAA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.35 0.0 0.0 0.0 0.0 78-79 0.42500000000000004 0.0 0.0 0.0 0.0 80-81 0.475 0.0 0.0 0.0 0.0 82-83 0.625 0.0 0.0 0.0 0.0 84-85 0.7625 0.0 0.0 0.0 0.0 86-87 0.8625 0.0 0.0 0.0 0.0 88-89 1.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864487 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864487_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.02425 34.0 31.0 34.0 30.0 34.0 2 32.1245 34.0 31.0 34.0 30.0 34.0 3 32.14 34.0 31.0 34.0 30.0 34.0 4 35.511 37.0 35.0 37.0 33.0 37.0 5 35.46925 37.0 35.0 37.0 33.0 37.0 6 35.45175 37.0 35.0 37.0 33.0 37.0 7 35.378 37.0 36.0 37.0 33.0 37.0 8 35.365 37.0 35.0 37.0 33.0 37.0 9 37.0605 39.0 37.0 39.0 33.0 39.0 10-11 36.994375000000005 39.0 37.0 39.0 33.0 39.0 12-13 36.877375 39.0 37.0 39.0 33.0 39.0 14-15 38.31125 41.0 38.0 41.0 33.0 41.0 16-17 38.2275 41.0 38.0 41.0 33.0 41.0 18-19 38.213375 40.5 38.0 41.0 33.0 41.0 20-21 38.186125000000004 40.0 38.0 41.0 33.5 41.0 22-23 38.034625 40.0 38.0 41.0 33.0 41.0 24-25 37.959625 40.0 38.0 41.0 33.0 41.0 26-27 37.7715 40.0 38.0 41.0 32.0 41.0 28-29 37.787 40.0 38.0 41.0 32.5 41.0 30-31 37.655875 40.0 38.0 41.0 31.5 41.0 32-33 37.5305 40.0 38.0 41.0 32.0 41.0 34-35 37.509625 40.0 38.0 41.0 31.0 41.0 36-37 37.308 40.0 38.0 41.0 31.0 41.0 38-39 37.30437499999999 40.0 38.0 41.0 31.0 41.0 40-41 37.173125 40.0 37.5 41.0 30.5 41.0 42-43 37.034 40.0 37.0 41.0 30.5 41.0 44-45 36.795375 40.0 37.0 41.0 30.0 41.0 46-47 36.606375 40.0 37.0 41.0 30.0 41.0 48-49 36.355625 39.5 36.0 41.0 29.5 41.0 50-51 36.141375 39.5 36.5 40.5 29.0 41.0 52-53 36.318875 39.0 36.0 40.5 30.0 41.0 54-55 36.69175 40.0 37.0 41.0 30.0 41.0 56-57 36.459375 40.0 36.0 41.0 29.0 41.0 58-59 36.070125 39.0 35.0 41.0 28.0 41.0 60-61 35.840875 39.0 35.0 41.0 28.0 41.0 62-63 35.587875 39.0 35.0 41.0 28.0 41.0 64-65 35.205 38.0 35.0 40.0 28.0 41.0 66-67 34.901624999999996 37.5 34.5 40.0 28.0 41.0 68-69 34.454 37.0 34.0 39.0 26.0 41.0 70-71 33.92875 36.0 34.0 39.0 26.0 41.0 72-73 33.47125 36.0 34.0 38.5 26.0 40.0 74-75 32.98225 35.0 33.0 37.0 25.5 39.0 76-77 32.59675 35.0 33.0 37.0 25.5 39.0 78-79 32.241125 35.0 33.0 36.5 25.0 38.5 80-81 31.818625 35.0 32.0 36.0 23.5 37.0 82-83 31.379875 35.0 32.0 35.5 21.5 37.0 84-85 31.033875000000002 35.0 31.5 35.0 20.5 36.5 86-87 30.7325 34.5 31.0 35.0 19.5 36.0 88-89 30.53 34.0 31.0 35.0 18.5 36.0 90-91 30.314375 34.0 31.0 35.0 18.0 35.5 92-93 30.091250000000002 34.0 31.0 35.0 14.0 35.0 94-95 29.811875 34.0 31.0 35.0 9.0 35.0 96-97 29.51475 34.0 30.0 35.0 2.0 35.0 98-99 29.015500000000003 34.0 30.0 35.0 2.0 35.0 100-101 28.0525 33.5 28.5 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 30.0 3 4.0 4 4.0 5 8.0 6 5.0 7 6.0 8 5.0 9 10.0 10 12.0 11 17.0 12 9.0 13 12.0 14 11.0 15 15.0 16 14.0 17 13.0 18 16.0 19 14.0 20 11.0 21 15.0 22 22.0 23 18.0 24 23.0 25 27.0 26 37.0 27 36.0 28 52.0 29 59.0 30 55.0 31 73.0 32 94.0 33 135.0 34 180.0 35 252.0 36 486.0 37 935.0 38 1129.0 39 156.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 27.900000000000002 18.975 14.899999999999999 38.224999999999994 2 23.599999999999998 24.6 35.15 16.650000000000002 3 20.1 28.375 28.849999999999998 22.675 4 22.675 32.324999999999996 24.099999999999998 20.9 5 24.7 34.425 24.099999999999998 16.775000000000002 6 19.55 39.275 23.65 17.525 7 21.15 20.549999999999997 37.5 20.8 8 21.6 25.2 29.425 23.775 9 21.825 25.45 29.625 23.1 10-11 23.0125 31.887500000000003 24.5625 20.5375 12-13 23.075000000000003 26.0125 27.0125 23.9 14-15 21.3125 28.9125 27.675 22.1 16-17 22.8375 27.725 26.775 22.662499999999998 18-19 22.575 28.9 27.425 21.099999999999998 20-21 22.6875 29.525000000000002 27.125 20.6625 22-23 23.25 29.049999999999997 26.325 21.375 24-25 22.8 29.025000000000002 27.0125 21.1625 26-27 22.975 28.712500000000002 26.775 21.5375 28-29 23.2625 28.325 27.1625 21.25 30-31 23.4125 28.6625 27.5875 20.3375 32-33 23.5625 28.3375 26.625 21.475 34-35 22.7125 28.475 27.700000000000003 21.1125 36-37 22.85 27.8125 27.9125 21.425 38-39 22.112499999999997 28.5625 27.375 21.95 40-41 23.3625 28.712500000000002 27.037499999999998 20.8875 42-43 23.4375 27.775 27.1625 21.625 44-45 22.2 29.037499999999998 27.6625 21.099999999999998 46-47 22.662499999999998 28.4 28.0875 20.849999999999998 48-49 23.1875 29.312500000000004 26.437500000000004 21.0625 50-51 24.025 28.000000000000004 26.6125 21.3625 52-53 22.85 28.65 27.5125 20.9875 54-55 23.0 28.449999999999996 27.875 20.674999999999997 56-57 23.325000000000003 29.262500000000003 26.55 20.8625 58-59 22.7 28.5625 26.887499999999996 21.85 60-61 23.875 27.975 26.437500000000004 21.712500000000002 62-63 22.8375 28.1625 27.325 21.675 64-65 23.425 28.749999999999996 27.700000000000003 20.125 66-67 23.075000000000003 27.4125 27.675 21.837500000000002 68-69 23.200000000000003 28.875 26.2875 21.637500000000003 70-71 23.8875 27.85 27.525 20.7375 72-73 24.025 28.199999999999996 27.287499999999998 20.4875 74-75 23.724999999999998 29.062500000000004 26.674999999999997 20.5375 76-77 24.0 27.437499999999996 27.8625 20.7 78-79 23.200000000000003 28.6125 27.6125 20.575 80-81 23.1625 29.075 26.5625 21.2 82-83 23.6625 28.537499999999998 26.974999999999998 20.825 84-85 23.4125 28.349999999999998 27.625 20.6125 86-87 23.925 27.1 27.875 21.099999999999998 88-89 22.75 28.0625 27.3875 21.8 90-91 23.825 27.5875 27.762500000000003 20.825 92-93 24.337500000000002 27.800000000000004 27.3625 20.5 94-95 24.0375 28.275 26.174999999999997 21.512500000000003 96-97 24.6625 28.037499999999998 26.9125 20.3875 98-99 23.849999999999998 28.4375 26.2125 21.5 100-101 24.625 27.450000000000003 26.887499999999996 21.0375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 0.5 22 0.5 23 1.0 24 1.0 25 2.0 26 4.0 27 7.0 28 8.0 29 7.0 30 10.5 31 19.5 32 29.0 33 35.0 34 44.5 35 70.5 36 84.5 37 101.0 38 129.0 39 160.0 40 190.5 41 208.0 42 242.5 43 264.5 44 272.5 45 280.0 46 266.5 47 248.5 48 231.0 49 213.5 50 179.5 51 146.0 52 121.5 53 91.0 54 72.5 55 57.5 56 45.0 57 37.0 58 27.0 59 16.0 60 9.5 61 7.5 62 10.0 63 8.5 64 7.0 65 9.0 66 6.5 67 3.5 68 1.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.5 74 1.0 75 1.0 76 0.5 77 0.0 78 0.5 79 0.5 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19314170448816 98.35000000000001 2 0.7564296520423601 1.5 3 0.05042864346949068 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.35 0.0 0.0 0.0 0.0 78-79 0.4375 0.0 0.0 0.0 0.0 80-81 0.5 0.0 0.0 0.0 0.0 82-83 0.6499999999999999 0.0 0.0 0.0 0.0 84-85 0.8 0.0 0.0 0.0 0.0 86-87 0.8875 0.0 0.0 0.0 0.0 88-89 1.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 711394 spots for ERR1864487.sra Written 711394 spots for ERR1864487.sra Read 711394 spots for ERR1864487.sra Written 711394 spots for ERR1864487.sra Read 711394 spots for ERR1864487.sra Written 711394 spots for ERR1864487.sra Read 711394 spots for ERR1864487.sra Written 711394 spots for ERR1864487.sra Read 711394 spots for ERR1864487.sra Written 711394 spots for ERR1864487.sra Read 711394 spots for ERR1864487.sra Written 711394 spots for ERR1864487.sra Read 711394 spots for ERR1864487.sra Written 711394 spots for ERR1864487.sra Read 711394 spots for ERR1864487.sra Written 711394 spots for ERR1864487.sra Read 711394 spots for ERR1864487.sra Written 711394 spots for ERR1864487.sra Read 711394 spots for ERR1864487.sra Written 711394 spots for ERR1864487.sra Read 711394 spots for ERR1864487.sra Written 711394 spots for ERR1864487.sra Read 711394 spots for ERR1864487.sra Written 711394 spots for ERR1864487.sra Read 711394 spots for ERR1864487.sra Written 711394 spots for ERR1864487.sra Read 711394 spots for ERR1864487.sra Written 711394 spots for ERR1864487.sra Read 711394 spots for ERR1864487.sra Written 711394 spots for ERR1864487.sra Read 711394 spots for ERR1864487.sra Written 711394 spots for ERR1864487.sra Read 711405 spots for ERR1864487.sra Written 711405 spots for ERR1864487.sra Read 711394 spots for ERR1864487.sra Written 711394 spots for ERR1864487.sra Read 711394 spots for ERR1864487.sra Written 711394 spots for ERR1864487.sra Read 711394 spots for ERR1864487.sra Written 711394 spots for ERR1864487.sra SRR ids: ['ERR1864487.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zsgj1gsn ERR1864487.sra spots: 14227891 blocks: [[1, 711394], [711395, 1422788], [1422789, 2134182], [2134183, 2845576], [2845577, 3556970], [3556971, 4268364], [4268365, 4979758], [4979759, 5691152], [5691153, 6402546], [6402547, 7113940], [7113941, 7825334], [7825335, 8536728], [8536729, 9248122], [9248123, 9959516], [9959517, 10670910], [10670911, 11382304], [11382305, 12093698], [12093699, 12805092], [12805093, 13516486], [13516487, 14227891]] ERR1864487 file size 3410222 ERR1864487 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864487 ERR1864487_1.fastq ERR1864487_2.fastq Input file: ERR1864487_1.fastq Paired file: ERR1864487_2.fastq trimmed: ERR1864487-trimmed-pair1.fastq, ERR1864487-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:31:27 2025 >> started Thu Feb 13 14:31:47 2025 >> done (19.920s) 14227891 read pairs processed; of these: 197759 ( 1.39%) short read pairs filtered out after trimming by size control 207905 ( 1.46%) empty read pairs filtered out after trimming by size control 13822227 (97.15%) read pairs available; of these: 3148972 (22.78%) trimmed read pairs available after processing 10673255 (77.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 117 0.00% 19 229 0.00% 20 316 0.00% 21 488 0.00% 22 586 0.00% 23 707 0.01% 24 855 0.01% 25 1109 0.01% 26 1216 0.01% 27 1492 0.01% 28 1646 0.01% 29 1917 0.01% 30 2164 0.02% 31 2548 0.02% 32 2834 0.02% 33 3059 0.02% 34 3530 0.03% 35 3681 0.03% 36 4026 0.03% 37 4291 0.03% 38 4659 0.03% 39 5086 0.04% 40 5338 0.04% 41 5794 0.04% 42 5955 0.04% 43 6351 0.05% 44 6636 0.05% 45 7020 0.05% 46 7459 0.05% 47 7742 0.06% 48 8100 0.06% 49 8362 0.06% 50 9026 0.07% 51 9044 0.07% 52 9594 0.07% 53 10117 0.07% 54 10496 0.08% 55 11066 0.08% 56 11551 0.08% 57 12295 0.09% 58 12933 0.09% 59 16277 0.12% 60 19418 0.14% 61 19910 0.14% 62 20567 0.15% 63 21616 0.16% 64 21986 0.16% 65 22646 0.16% 66 23730 0.17% 67 24519 0.18% 68 25440 0.18% 69 26351 0.19% 70 27547 0.20% 71 28720 0.21% 72 29969 0.22% 73 31042 0.22% 74 32148 0.23% 75 32768 0.24% 76 33079 0.24% 77 34937 0.25% 78 36472 0.26% 79 38837 0.28% 80 40550 0.29% 81 42492 0.31% 82 45821 0.33% 83 46502 0.34% 84 48785 0.35% 85 52084 0.38% 86 54126 0.39% 87 56838 0.41% 88 58455 0.42% 89 62934 0.46% 90 68981 0.50% 91 76357 0.55% 92 83970 0.61% 93 93805 0.68% 94 105565 0.76% 95 124511 0.90% 96 146841 1.06% 97 181399 1.31% 98 235533 1.70% 99 316508 2.29% 100 427501 3.09% 101 10673255 77.22% 13822227 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=3.45 fanout-score-rank=16 prefix-density=0.61 prefix-fanout=3.2 sequence=GCATTCTCAGGCA criterion=fanout-score sequence-density=0.06 sequence-density-rank=31 fanout-score=290.28 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=18.0 sequence=TTCTTCTTCACTTTCTCATCCTCTGCTTTGTATCTCTCTGCCTCTTGCACCATTCTCTCAATATCATCCTTGCCCAGTCTTCCCTTGTCATTGGTGATGGTAATCTTATTCTTCACTCCTGAAGCCTTATCTTCTGCAGAAACATTCAAGATGCCATTTGCATCGATGTCGAAGCATACATTGAT criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=3.00 fanout-score-rank=23 prefix-density=0.89 prefix-fanout=2.6 sequence=AACAAGAAACCAAGAAAATGTCTCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=384.59 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=15.6 sequence=GAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAAGCTCTTATGCGTTCGTCATTGACATGCCGGGACTGAAATCAGGGGACATCAAGGTTCAAGTGGAGGATGACAATGTGCTGGTTATCAGTGGAGAGAGGAAGCGCGGAGAGGAGAAAGAAGGGGCCAAGTATGTGAGAATGGAAAGGAGGGTTGGTAAGTTTATGAGGAAGTTTGTGTTGCCTGAGA ERR1864487 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:32:16 Started mapping on | Feb 13 14:32:16 Finished on | Feb 13 14:32:52 Mapping speed, Million of reads per hour | 1382.22 Number of input reads | 13822227 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 13208614 Uniquely mapped reads % | 95.56% Average mapped length | 195.53 Number of splices: Total | 6500199 Number of splices: Annotated (sjdb) | 6278768 Number of splices: GT/AG | 6401450 Number of splices: GC/AG | 78427 Number of splices: AT/AC | 6570 Number of splices: Non-canonical | 13752 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 2.37 Insertion rate per base | 0.01% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 489914 % of reads mapped to multiple loci | 3.54% Number of reads mapped to too many loci | 23088 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.71% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 142724 142724 142724 N_multimapping 489914 489914 489914 N_noFeature 625179 13024793 739799 N_ambiguous 117362 822 47504 UnstrandedReadsAssigned:12466073 PositiveStrandReadsAssigned:182999 NegativeStrandReadsAssigned:12421311 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864487 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864487-trimmed-pair1.fastq ERR1864487-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,822,227 reads, 12,659,863 reads pseudoaligned [quant] estimated average fragment length: 166.003 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,260 rounds 52401 ERR1864487.ke.tsv 34699 ERR1864487.se.tsv 87100 total ==> ERR1864487.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1853 1159.54 60.0275 Potri.005G024800.1.v4.1 1035 869.997 737.09 81.2723 Potri.004G059700.1.v4.1 961 796.002 29 3.49481 Potri.007G009000.2.v4.1 1416 1251 0 0 Potri.003G141000.2.v4.1 2943 2778 511.241 17.6536 Potri.016G087400.1.v4.1 270 113.602 1068.59 902.33 Potri.015G069301.1.v4.1 564 399.126 0 0 Potri.010G195200.1.v4.1 1773 1608 25 1.4914 Potri.012G127500.1.v4.1 977 811.997 738 87.185 ==> ERR1864487.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 879 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 102 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 ERR1864487 completed mapping pipeline successfully