Starting /dee2/code/volunteer_pipeline.sh ERR1864488 current disk space = 3090085482496 free memory = 1580554924 ERR1864488 SRAfilesize 8ced672cf76472c5002fc88c108d380b ERR1864488.sra ERR1864488.sra file validated ERR1864488 is paired end ERR1864488 is conventional basespace ERR1864488 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864488_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.02125 34.0 31.0 34.0 30.0 34.0 2 32.226 34.0 31.0 34.0 30.0 34.0 3 32.45725 34.0 31.0 34.0 30.0 34.0 4 35.86875 37.0 35.0 37.0 35.0 37.0 5 35.68825 37.0 35.0 37.0 35.0 37.0 6 35.6185 37.0 35.0 37.0 35.0 37.0 7 35.55 37.0 35.0 37.0 35.0 37.0 8 35.56825 37.0 35.0 37.0 33.0 37.0 9 37.256 39.0 38.0 39.0 34.0 39.0 10-11 37.213625 39.0 38.0 39.0 34.5 39.0 12-13 37.22 39.0 38.0 39.0 34.0 39.0 14-15 38.595625 41.0 38.5 41.0 34.0 41.0 16-17 38.547250000000005 41.0 38.5 41.0 34.5 41.0 18-19 38.513125 41.0 38.5 41.0 34.0 41.0 20-21 38.334625 40.5 38.5 41.0 34.0 41.0 22-23 38.277125 40.0 38.0 41.0 34.0 41.0 24-25 38.204375 40.0 38.0 41.0 33.5 41.0 26-27 38.127375 40.0 38.0 41.0 33.0 41.0 28-29 38.053625 40.0 38.0 41.0 33.0 41.0 30-31 37.99825 40.0 38.0 41.0 33.0 41.0 32-33 37.807874999999996 40.0 38.0 41.0 33.0 41.0 34-35 37.71725 40.0 38.0 41.0 33.0 41.0 36-37 37.629999999999995 40.0 38.0 41.0 32.5 41.0 38-39 37.298874999999995 40.0 37.5 41.0 31.0 41.0 40-41 37.363 40.0 37.5 41.0 31.5 41.0 42-43 37.201625 40.0 37.0 41.0 31.0 41.0 44-45 37.238625 40.0 37.0 41.0 31.5 41.0 46-47 37.391625000000005 40.0 37.5 41.0 32.0 41.0 48-49 37.278 40.0 37.5 41.0 31.5 41.0 50-51 37.115125000000006 40.0 37.0 41.0 31.0 41.0 52-53 36.747375000000005 40.0 36.0 41.0 30.0 41.0 54-55 36.583125 40.0 36.0 41.0 30.0 41.0 56-57 36.43875 39.0 36.0 41.0 30.0 41.0 58-59 36.202375 39.0 35.0 41.0 29.0 41.0 60-61 35.989000000000004 39.0 35.0 40.5 29.0 41.0 62-63 35.66875 38.5 35.0 40.0 29.0 41.0 64-65 35.198625 38.0 34.5 40.0 28.0 41.0 66-67 34.768625 37.0 34.0 40.0 27.5 41.0 68-69 34.375375 36.5 34.0 39.0 26.5 41.0 70-71 34.083749999999995 36.0 34.0 39.0 26.5 40.0 72-73 33.631375000000006 36.0 33.0 38.5 26.0 40.0 74-75 33.160250000000005 35.0 33.0 37.5 26.0 39.5 76-77 32.173625 34.5 31.5 36.0 25.5 39.0 78-79 32.370000000000005 35.0 32.0 36.0 25.5 39.0 80-81 32.170125 35.0 32.5 36.0 25.5 37.0 82-83 31.912625 35.0 32.0 36.0 25.5 37.0 84-85 31.54 35.0 32.0 35.0 24.5 36.5 86-87 31.270249999999997 34.0 32.0 35.0 24.0 36.0 88-89 30.880375 34.0 31.0 35.0 22.5 36.0 90-91 30.707625 34.0 31.0 35.0 21.5 35.5 92-93 30.308125 34.0 31.0 35.0 19.0 35.0 94-95 30.124625 34.0 31.0 35.0 18.0 35.0 96-97 29.878625 34.0 31.0 35.0 13.5 35.0 98-99 29.69 34.0 31.0 35.0 2.0 35.0 100-101 28.8855 33.5 30.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 23.0 3 14.0 4 3.0 5 12.0 6 6.0 7 6.0 8 5.0 9 2.0 10 7.0 11 8.0 12 10.0 13 10.0 14 13.0 15 10.0 16 5.0 17 9.0 18 13.0 19 15.0 20 18.0 21 10.0 22 14.0 23 16.0 24 13.0 25 25.0 26 29.0 27 33.0 28 38.0 29 54.0 30 73.0 31 99.0 32 86.0 33 120.0 34 188.0 35 271.0 36 464.0 37 962.0 38 1177.0 39 139.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.494569335690834 6.112654710785552 8.891134124778985 46.50164182874463 2 23.625 7.85 34.150000000000006 34.375 3 23.925 11.525 22.375 42.175000000000004 4 27.075 17.7 21.175 34.050000000000004 5 26.700000000000003 22.7 26.400000000000002 24.2 6 20.974999999999998 27.575 27.0 24.45 7 15.25 21.95 43.6 19.2 8 17.2 24.25 33.45 25.1 9 17.2 24.075 35.85 22.875 10-11 19.162499999999998 32.550000000000004 28.4375 19.85 12-13 20.5125 25.7625 30.25 23.474999999999998 14-15 19.275000000000002 28.075 29.299999999999997 23.35 16-17 21.175 26.6 28.425 23.799999999999997 18-19 20.6125 26.85 27.8875 24.65 20-21 20.6375 26.9625 29.049999999999997 23.35 22-23 20.2875 27.8125 28.6125 23.2875 24-25 20.5125 26.5125 28.875 24.099999999999998 26-27 20.25 27.037499999999998 28.799999999999997 23.9125 28-29 21.1625 27.2625 28.825 22.75 30-31 20.075000000000003 27.85 29.15 22.925 32-33 20.5875 26.2875 29.762499999999996 23.3625 34-35 19.950000000000003 27.575 28.249999999999996 24.224999999999998 36-37 19.412499999999998 27.5875 28.575 24.425 38-39 19.5125 27.6375 28.287499999999998 24.5625 40-41 20.0375 28.000000000000004 28.212500000000002 23.75 42-43 20.575 27.825 27.9375 23.6625 44-45 20.75 26.924999999999997 28.812500000000004 23.5125 46-47 20.7 26.9625 28.512500000000003 23.825 48-49 20.875 27.750000000000004 27.1625 24.212500000000002 50-51 21.125 27.237499999999997 28.6625 22.975 52-53 21.087500000000002 28.237499999999997 27.5125 23.1625 54-55 20.175 27.4125 28.95 23.4625 56-57 20.7375 27.6875 28.825 22.75 58-59 20.7625 27.675 27.962500000000002 23.599999999999998 60-61 20.575 26.900000000000002 27.975 24.55 62-63 20.575 27.187499999999996 28.4 23.8375 64-65 19.55244405550694 28.60357544693087 28.416052006500813 23.427928491061383 66-67 20.875 27.025 28.5625 23.5375 68-69 21.705426356589147 27.68192048012003 27.26931732933233 23.34333583395849 70-71 21.9 27.4125 27.950000000000003 22.7375 72-73 20.377547193399177 27.61595199399925 27.765970746343292 24.24053006625828 74-75 20.677584698087262 27.11588948618577 28.66608326040755 23.540442555319416 76-77 20.40255031878985 27.403425428178522 28.42855356919615 23.76547068383548 78-79 21.4375 27.3125 27.987499999999997 23.2625 80-81 20.2625 27.237499999999997 27.950000000000003 24.55 82-83 20.4375 27.487499999999997 27.900000000000002 24.175 84-85 20.65 28.425 27.1375 23.7875 86-87 20.7 27.4125 28.175 23.7125 88-89 20.375 27.3 28.499999999999996 23.825 90-91 21.8 27.712500000000002 27.375 23.1125 92-93 21.224999999999998 26.787499999999998 29.2875 22.7 94-95 21.4125 27.250000000000004 27.250000000000004 24.087500000000002 96-97 21.0125 28.275 27.400000000000002 23.3125 98-99 22.1875 27.474999999999998 27.1375 23.200000000000003 100-101 21.975 27.575 27.875 22.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.5 19 1.5 20 1.0 21 1.5 22 1.5 23 1.0 24 2.5 25 5.0 26 6.5 27 6.5 28 11.5 29 15.5 30 14.5 31 19.0 32 28.5 33 42.5 34 49.0 35 55.5 36 70.5 37 82.0 38 94.5 39 126.0 40 171.0 41 204.0 42 215.5 43 237.5 44 255.5 45 259.5 46 265.5 47 254.5 48 253.5 49 236.0 50 192.0 51 157.5 52 127.5 53 111.0 54 97.5 55 81.5 56 61.5 57 36.0 58 25.0 59 21.5 60 17.0 61 12.0 62 14.0 63 15.0 64 10.5 65 9.5 66 7.0 67 4.0 68 2.0 69 1.0 70 1.0 71 1.0 72 1.5 73 1.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0125 66-67 0.0 68-69 0.025 70-71 0.0 72-73 0.0125 74-75 0.0125 76-77 0.0125 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.925 #Duplication Level Percentage of deduplicated Percentage of total 1 97.67861748774826 94.675 2 1.6507608976012382 3.2 3 0.5416559195254063 1.575 4 0.07737941707505804 0.3 5 0.051586278050038695 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTCTTTCTTCATTCCTGGTACATCTAGCATGATAACATGACCCTCAGGT 5 0.125 No Hit CCCCCCTCAATGCTAACCACCGTAGGACCCTTGATTTTGTCAAGGGACAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.44999999999999996 0.0 0.0 0.0 0.0 82-83 0.6125 0.0 0.0 0.0 0.0 84-85 0.7375 0.0 0.0 0.0 0.0 86-87 0.9875 0.0 0.0 0.0 0.0 88-89 1.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864488 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864488_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.135 34.0 31.0 34.0 30.0 34.0 2 32.23525 34.0 31.0 34.0 30.0 34.0 3 32.225 34.0 31.0 34.0 30.0 34.0 4 35.5115 37.0 35.0 37.0 33.0 37.0 5 35.5205 37.0 35.0 37.0 33.0 37.0 6 35.49875 37.0 36.0 37.0 33.0 37.0 7 35.50375 37.0 35.0 37.0 33.0 37.0 8 35.4095 37.0 35.0 37.0 33.0 37.0 9 37.10025 39.0 37.0 39.0 34.0 39.0 10-11 37.146125 39.0 37.5 39.0 34.0 39.0 12-13 37.00075 39.0 37.0 39.0 33.0 39.0 14-15 38.349625 41.0 38.0 41.0 33.5 41.0 16-17 38.27725 40.5 38.0 41.0 33.0 41.0 18-19 38.2365 40.5 38.0 41.0 33.0 41.0 20-21 38.278625 40.0 38.0 41.0 33.0 41.0 22-23 38.182125 40.0 38.0 41.0 33.0 41.0 24-25 38.079625 40.0 38.0 41.0 33.0 41.0 26-27 37.873374999999996 40.0 38.0 41.0 32.5 41.0 28-29 37.807625 40.0 38.0 41.0 32.5 41.0 30-31 37.638000000000005 40.0 38.0 41.0 32.0 41.0 32-33 37.538 40.0 38.0 41.0 31.5 41.0 34-35 37.48475 40.0 38.0 41.0 31.0 41.0 36-37 37.3885 40.0 38.0 41.0 31.0 41.0 38-39 37.299875 40.0 38.0 41.0 31.0 41.0 40-41 37.130125 40.0 37.5 41.0 30.5 41.0 42-43 37.036249999999995 40.0 37.0 41.0 31.0 41.0 44-45 36.807375 40.0 37.0 41.0 30.0 41.0 46-47 36.631625 40.0 36.5 41.0 30.0 41.0 48-49 36.477625 39.5 36.0 41.0 30.0 41.0 50-51 36.247625 39.5 36.0 40.5 30.0 41.0 52-53 36.409875 39.0 36.0 40.5 30.0 41.0 54-55 36.669624999999996 40.0 36.0 41.0 30.5 41.0 56-57 36.531375 39.5 36.0 41.0 30.0 41.0 58-59 35.92675 39.0 35.0 41.0 28.0 41.0 60-61 35.7495 39.0 35.0 41.0 28.0 41.0 62-63 35.517875000000004 38.5 35.0 40.0 28.0 41.0 64-65 35.209125 38.0 35.0 40.0 28.0 41.0 66-67 34.827625 37.0 34.0 40.0 27.5 41.0 68-69 34.390875 37.0 34.0 39.0 26.0 41.0 70-71 34.035624999999996 36.0 34.0 39.0 26.0 40.5 72-73 33.6245 36.0 33.5 38.5 26.0 40.0 74-75 33.1635 35.0 33.0 37.5 26.0 39.0 76-77 32.734624999999994 35.0 33.0 37.0 25.5 39.0 78-79 32.45725 35.0 33.0 36.5 25.5 38.5 80-81 32.032875 35.0 32.5 36.0 24.5 37.0 82-83 31.558999999999997 35.0 32.0 35.5 23.5 37.0 84-85 31.17725 35.0 31.5 35.0 22.0 36.5 86-87 30.842624999999998 35.0 31.0 35.0 20.0 36.0 88-89 30.548375 34.0 31.0 35.0 19.0 36.0 90-91 30.310625 34.0 31.0 35.0 17.5 35.5 92-93 30.015875 34.0 31.0 35.0 12.5 35.0 94-95 29.760375 34.0 31.0 35.0 4.5 35.0 96-97 29.45825 34.0 30.0 35.0 2.0 35.0 98-99 29.10125 34.0 30.0 35.0 2.0 35.0 100-101 28.208 33.5 28.5 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 22.0 3 5.0 4 4.0 5 4.0 6 5.0 7 5.0 8 9.0 9 9.0 10 13.0 11 8.0 12 9.0 13 7.0 14 15.0 15 18.0 16 10.0 17 12.0 18 11.0 19 19.0 20 16.0 21 21.0 22 33.0 23 21.0 24 23.0 25 30.0 26 32.0 27 37.0 28 41.0 29 45.0 30 66.0 31 83.0 32 109.0 33 126.0 34 174.0 35 283.0 36 479.0 37 950.0 38 1062.0 39 184.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.325000000000003 16.875 16.275000000000002 37.525 2 25.6 24.775 32.95 16.675 3 20.275000000000002 29.25 28.299999999999997 22.175 4 22.475 32.9 23.375 21.25 5 24.8 35.975 22.3 16.925 6 18.6 39.425 22.8 19.175 7 20.825 21.025 38.0 20.150000000000002 8 21.15 25.074999999999996 28.725 25.05 9 21.525 24.349999999999998 30.65 23.474999999999998 10-11 21.4875 32.875 24.325 21.3125 12-13 23.7125 26.1 27.8375 22.35 14-15 22.412499999999998 28.799999999999997 27.200000000000003 21.587500000000002 16-17 22.95 29.225 25.85 21.975 18-19 22.3125 29.45 26.55 21.6875 20-21 22.5875 29.325000000000003 27.5625 20.525 22-23 22.0125 28.037499999999998 27.537499999999998 22.412499999999998 24-25 23.1875 28.425 27.775 20.6125 26-27 22.975 29.1375 27.0125 20.875 28-29 23.2375 28.599999999999998 26.8625 21.3 30-31 23.125 28.4375 27.3375 21.099999999999998 32-33 22.975 28.799999999999997 26.8 21.425 34-35 22.825 28.6375 27.437499999999996 21.099999999999998 36-37 22.4625 28.1375 28.037499999999998 21.3625 38-39 23.4375 28.4125 27.025 21.125 40-41 22.5875 28.65 27.250000000000004 21.512500000000003 42-43 23.375 29.1625 26.474999999999998 20.9875 44-45 22.5875 28.4375 27.762500000000003 21.212500000000002 46-47 23.4625 27.762500000000003 27.3875 21.3875 48-49 23.2375 28.349999999999998 26.6 21.8125 50-51 22.9875 27.400000000000002 28.175 21.4375 52-53 23.575 28.0875 27.675 20.6625 54-55 22.6375 28.462500000000002 27.575 21.325 56-57 23.400000000000002 28.299999999999997 26.937499999999996 21.3625 58-59 23.1875 28.537499999999998 28.275 20.0 60-61 23.65 27.6 27.025 21.725 62-63 23.1 28.65 27.537499999999998 20.7125 64-65 22.4875 29.275000000000002 27.6375 20.599999999999998 66-67 22.5125 28.449999999999996 27.325 21.712500000000002 68-69 24.712500000000002 28.1625 26.875 20.25 70-71 23.400000000000002 27.675 27.762500000000003 21.1625 72-73 23.325000000000003 28.1 27.500000000000004 21.075 74-75 23.9125 27.400000000000002 27.3875 21.3 76-77 23.8375 28.025 27.450000000000003 20.6875 78-79 22.875 28.575 27.712500000000002 20.837500000000002 80-81 23.825 28.4 27.075 20.7 82-83 24.1375 28.275 26.637499999999996 20.95 84-85 22.9625 27.775 28.000000000000004 21.2625 86-87 25.1875 28.237499999999997 26.387500000000003 20.1875 88-89 23.5625 29.1875 26.6125 20.6375 90-91 23.8375 27.762500000000003 27.287499999999998 21.1125 92-93 24.087500000000002 27.6625 27.0125 21.2375 94-95 23.225 28.212500000000002 26.974999999999998 21.587500000000002 96-97 23.7875 27.9375 27.175 21.099999999999998 98-99 23.150000000000002 28.199999999999996 26.700000000000003 21.95 100-101 24.3 28.499999999999996 26.437500000000004 20.7625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 1.0 19 2.0 20 1.0 21 0.5 22 1.0 23 3.0 24 5.0 25 5.0 26 4.0 27 8.0 28 15.0 29 17.0 30 20.0 31 21.5 32 28.5 33 35.5 34 43.5 35 68.5 36 83.0 37 98.0 38 126.0 39 145.0 40 184.0 41 229.5 42 235.5 43 245.0 44 275.5 45 279.0 46 251.0 47 228.0 48 238.5 49 218.0 50 166.5 51 138.0 52 117.5 53 97.0 54 80.0 55 62.5 56 42.5 57 34.5 58 28.0 59 22.0 60 16.0 61 11.5 62 13.0 63 12.0 64 11.5 65 9.0 66 6.0 67 5.0 68 2.5 69 2.0 70 2.0 71 1.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.425 #Duplication Level Percentage of deduplicated Percentage of total 1 98.65379730759462 97.1 2 1.143002286004572 2.25 3 0.1524003048006096 0.44999999999999996 4 0.05080010160020319 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.3375 0.0 0.0 0.0 0.0 80-81 0.475 0.0 0.0 0.0 0.0 82-83 0.6375 0.0 0.0 0.0 0.0 84-85 0.7875 0.0 0.0 0.0 0.0 86-87 1.0375 0.0 0.0 0.0 0.0 88-89 1.2374999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAGAAG 15 6.142176E-4 95.0 9 >>END_MODULE Read 631487 spots for ERR1864488.sra Written 631487 spots for ERR1864488.sra Read 631487 spots for ERR1864488.sra Written 631487 spots for ERR1864488.sra Read 631487 spots for ERR1864488.sra Written 631487 spots for ERR1864488.sra Read 631487 spots for ERR1864488.sra Written 631487 spots for ERR1864488.sra Read 631487 spots for ERR1864488.sra Written 631487 spots for ERR1864488.sra Read 631487 spots for ERR1864488.sra Written 631487 spots for ERR1864488.sra Read 631487 spots for ERR1864488.sra Written 631487 spots for ERR1864488.sra Read 631487 spots for ERR1864488.sra Written 631487 spots for ERR1864488.sra Read 631487 spots for ERR1864488.sra Written 631487 spots for ERR1864488.sra Read 631487 spots for ERR1864488.sra Written 631487 spots for ERR1864488.sra Read 631487 spots for ERR1864488.sra Written 631487 spots for ERR1864488.sra Read 631487 spots for ERR1864488.sra Written 631487 spots for ERR1864488.sra Read 631506 spots for ERR1864488.sra Written 631506 spots for ERR1864488.sra Read 631487 spots for ERR1864488.sra Written 631487 spots for ERR1864488.sra Read 631487 spots for ERR1864488.sra Written 631487 spots for ERR1864488.sra Read 631487 spots for ERR1864488.sra Written 631487 spots for ERR1864488.sra Read 631487 spots for ERR1864488.sra Written 631487 spots for ERR1864488.sra Read 631487 spots for ERR1864488.sra Written 631487 spots for ERR1864488.sra Read 631487 spots for ERR1864488.sra Written 631487 spots for ERR1864488.sra Read 631487 spots for ERR1864488.sra Written 631487 spots for ERR1864488.sra SRR ids: ['ERR1864488.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3hb73vj7 ERR1864488.sra spots: 12629759 blocks: [[1, 631487], [631488, 1262974], [1262975, 1894461], [1894462, 2525948], [2525949, 3157435], [3157436, 3788922], [3788923, 4420409], [4420410, 5051896], [5051897, 5683383], [5683384, 6314870], [6314871, 6946357], [6946358, 7577844], [7577845, 8209331], [8209332, 8840818], [8840819, 9472305], [9472306, 10103792], [10103793, 10735279], [10735280, 11366766], [11366767, 11998253], [11998254, 12629759]] ERR1864488 file size 3024735 ERR1864488 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864488 ERR1864488_1.fastq ERR1864488_2.fastq Input file: ERR1864488_1.fastq Paired file: ERR1864488_2.fastq trimmed: ERR1864488-trimmed-pair1.fastq, ERR1864488-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:07:09 2025 >> started Thu Feb 13 14:07:21 2025 >> done (12.776s) 12629759 read pairs processed; of these: 188870 ( 1.50%) short read pairs filtered out after trimming by size control 207327 ( 1.64%) empty read pairs filtered out after trimming by size control 12233562 (96.86%) read pairs available; of these: 2890940 (23.63%) trimmed read pairs available after processing 9342622 (76.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 94 0.00% 19 217 0.00% 20 351 0.00% 21 463 0.00% 22 571 0.00% 23 711 0.01% 24 832 0.01% 25 1024 0.01% 26 1123 0.01% 27 1376 0.01% 28 1615 0.01% 29 1752 0.01% 30 2144 0.02% 31 2203 0.02% 32 2666 0.02% 33 2880 0.02% 34 3256 0.03% 35 3571 0.03% 36 3701 0.03% 37 4047 0.03% 38 4486 0.04% 39 4550 0.04% 40 5069 0.04% 41 5258 0.04% 42 5532 0.05% 43 5852 0.05% 44 6113 0.05% 45 6469 0.05% 46 6829 0.06% 47 7014 0.06% 48 7370 0.06% 49 7771 0.06% 50 8136 0.07% 51 8576 0.07% 52 8821 0.07% 53 9452 0.08% 54 9630 0.08% 55 10193 0.08% 56 10715 0.09% 57 11407 0.09% 58 11829 0.10% 59 15080 0.12% 60 17794 0.15% 61 18244 0.15% 62 18772 0.15% 63 19516 0.16% 64 20201 0.17% 65 20796 0.17% 66 21657 0.18% 67 22098 0.18% 68 23105 0.19% 69 23873 0.20% 70 25027 0.20% 71 26066 0.21% 72 27581 0.23% 73 28755 0.24% 74 29151 0.24% 75 30041 0.25% 76 30185 0.25% 77 31877 0.26% 78 33618 0.27% 79 35553 0.29% 80 37305 0.30% 81 39099 0.32% 82 41830 0.34% 83 42747 0.35% 84 45477 0.37% 85 48419 0.40% 86 50485 0.41% 87 53569 0.44% 88 55380 0.45% 89 59273 0.48% 90 64716 0.53% 91 71117 0.58% 92 78990 0.65% 93 87885 0.72% 94 97551 0.80% 95 115186 0.94% 96 136762 1.12% 97 166479 1.36% 98 213662 1.75% 99 285950 2.34% 100 384399 3.14% 101 9342622 76.37% 12233562 reads passed initial QC criterion=sequence-density sequence-density=1.00 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=26 prefix-density=1.04 prefix-fanout=2.0 sequence=GTGAAGGGAAAGTCCTGGAAAGGGTCCCAGATGTCAAGAGAGAAAGGATCAAAGA criterion=fanout-score sequence-density=0.09 sequence-density-rank=32 fanout-score=147.09 fanout-score-rank=1 prefix-density=1.10 prefix-fanout=11.8 sequence=TTCTTCTTCACTTTCTCATCCTCTGCTTTGTATCTCTCTGCCTCTTGCACCATTCTCTCAATATCATCCTTGCCCAGTCTTCCCTTGTCATTGGTGATGGTAATCTTATTCTTCACTCCTGAAGCCTTATCTTCTGCAGAAACATT criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=2.98 fanout-score-rank=21 prefix-density=0.85 prefix-fanout=2.6 sequence=AACAAGAAACCAAGAAAATGTCTCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=378.75 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=15.0 sequence=AGAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAAGCTCTTATGCGTTCGTCATTGACATGCCGGGACTGAAATCAGGGGACATCAAGGTTCAAGTGGAGGATGACAATGTGCTGGTTATCAGTGGAGAGAGGAAGCGCGGAGAGGAGAAAGAAGGGGCCAAGTATGTGAGAATGGAAAGGAGGGTTGGTAAGTTTATGAGGAAGTTTGTGTTGCCTGAGA ERR1864488 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:07:52 Started mapping on | Feb 13 14:07:52 Finished on | Feb 13 14:08:19 Mapping speed, Million of reads per hour | 1631.14 Number of input reads | 12233562 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 11625546 Uniquely mapped reads % | 95.03% Average mapped length | 195.25 Number of splices: Total | 4855585 Number of splices: Annotated (sjdb) | 4650039 Number of splices: GT/AG | 4781775 Number of splices: GC/AG | 55195 Number of splices: AT/AC | 4203 Number of splices: Non-canonical | 14412 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.02% Deletion average length | 2.42 Insertion rate per base | 0.01% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 460718 % of reads mapped to multiple loci | 3.77% Number of reads mapped to too many loci | 40277 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.85% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 165508 165508 165508 N_multimapping 460718 460718 460718 N_noFeature 660305 11412435 814702 N_ambiguous 101942 1105 42267 UnstrandedReadsAssigned:10863299 PositiveStrandReadsAssigned:212006 NegativeStrandReadsAssigned:10768577 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864488 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864488-trimmed-pair1.fastq ERR1864488-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,233,562 reads, 10,993,765 reads pseudoaligned [quant] estimated average fragment length: 159.853 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,038 rounds 52401 ERR1864488.ke.tsv 34699 ERR1864488.se.tsv 87100 total ==> ERR1864488.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1859.15 1042 59.567 Potri.005G024800.1.v4.1 1035 876.147 1246 151.145 Potri.004G059700.1.v4.1 961 802.158 13 1.72241 Potri.007G009000.2.v4.1 1416 1257.15 0 0 Potri.003G141000.2.v4.1 2943 2784.15 242.774 9.26748 Potri.016G087400.1.v4.1 270 117.536 967 874.391 Potri.015G069301.1.v4.1 564 405.243 0 0 Potri.010G195200.1.v4.1 1773 1614.15 17 1.11933 Potri.012G127500.1.v4.1 977 818.152 540 70.1474 ==> ERR1864488.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 623 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 78 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 ERR1864488 completed mapping pipeline successfully