Starting /dee2/code/volunteer_pipeline.sh ERR1864489 current disk space = 3090002411520 free memory = 1420777064 ERR1864489 SRAfilesize 2102a0843ea518a9ebf1730b1234be3c ERR1864489.sra ERR1864489.sra file validated ERR1864489 is paired end ERR1864489 is conventional basespace ERR1864489 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864489_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.2725 33.0 31.0 34.0 30.0 34.0 2 31.67275 34.0 31.0 34.0 30.0 34.0 3 31.805 34.0 31.0 34.0 29.0 34.0 4 35.3425 37.0 35.0 37.0 33.0 37.0 5 35.063 37.0 35.0 37.0 32.0 37.0 6 35.04375 37.0 35.0 37.0 32.0 37.0 7 34.978 37.0 35.0 37.0 32.0 37.0 8 35.0305 37.0 35.0 37.0 32.0 37.0 9 36.65575 39.0 37.0 39.0 33.0 39.0 10-11 36.61 39.0 37.0 39.0 33.0 39.0 12-13 36.383625 39.0 37.0 39.0 32.0 39.0 14-15 37.761875 40.0 38.0 41.0 32.5 41.0 16-17 37.732375 40.0 38.0 41.0 32.0 41.0 18-19 37.636875 40.0 38.0 41.0 32.0 41.0 20-21 37.574375 40.0 38.0 41.0 32.0 41.0 22-23 37.459875 40.0 38.0 41.0 32.0 41.0 24-25 37.363375000000005 40.0 38.0 41.0 32.0 41.0 26-27 37.1315 40.0 37.5 41.0 31.0 41.0 28-29 37.061499999999995 40.0 37.5 41.0 31.0 41.0 30-31 36.852375 40.0 37.0 41.0 30.0 41.0 32-33 36.738875 40.0 37.0 41.0 30.0 41.0 34-35 36.683125000000004 40.0 37.0 41.0 30.0 41.0 36-37 36.614999999999995 40.0 37.0 41.0 30.0 41.0 38-39 36.578625 40.0 36.5 41.0 30.0 41.0 40-41 36.40625 40.0 36.0 41.0 29.5 41.0 42-43 36.38175 40.0 36.5 41.0 30.0 41.0 44-45 36.2735 40.0 36.0 41.0 29.5 41.0 46-47 36.053375 39.0 36.0 41.0 29.0 41.0 48-49 36.205 39.5 36.0 41.0 29.5 41.0 50-51 36.299875 40.0 36.0 41.0 29.0 41.0 52-53 36.185 40.0 36.0 41.0 29.0 41.0 54-55 35.86875 39.0 35.0 41.0 28.0 41.0 56-57 35.705124999999995 39.0 35.0 41.0 28.0 41.0 58-59 35.568250000000006 39.0 35.0 41.0 28.0 41.0 60-61 35.275 39.0 35.0 41.0 27.0 41.0 62-63 34.91975 38.0 34.0 40.0 26.0 41.0 64-65 34.550125 38.0 34.0 40.0 26.0 41.0 66-67 34.159125 37.0 34.0 40.0 25.5 41.0 68-69 33.858000000000004 37.0 33.5 39.5 25.0 41.0 70-71 33.287875 36.0 33.0 39.0 22.5 41.0 72-73 32.904250000000005 35.5 33.0 39.0 23.0 40.0 74-75 32.515625 35.0 32.0 37.5 22.0 39.0 76-77 31.3735 34.5 30.5 36.0 21.0 39.0 78-79 31.788 35.0 32.0 36.5 21.5 39.0 80-81 31.62325 35.0 32.0 36.0 21.5 37.5 82-83 31.2815 35.0 32.0 36.0 19.5 37.0 84-85 30.934125 35.0 31.5 35.5 19.0 37.0 86-87 30.547875 35.0 31.0 35.0 17.5 36.0 88-89 30.457875 34.5 31.0 35.0 16.5 36.0 90-91 30.198625 34.0 31.0 35.0 11.0 36.0 92-93 30.035375000000002 34.0 31.0 35.0 7.0 35.0 94-95 29.56225 34.0 30.5 35.0 2.0 35.0 96-97 29.297125 34.0 30.5 35.0 2.0 35.0 98-99 28.948125 34.0 30.0 35.0 2.0 35.0 100-101 27.951375 33.5 28.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 55.0 3 23.0 4 12.0 5 13.0 6 10.0 7 4.0 8 7.0 9 6.0 10 5.0 11 10.0 12 11.0 13 14.0 14 7.0 15 4.0 16 14.0 17 14.0 18 14.0 19 11.0 20 25.0 21 17.0 22 17.0 23 21.0 24 16.0 25 27.0 26 40.0 27 33.0 28 50.0 29 42.0 30 77.0 31 90.0 32 101.0 33 153.0 34 221.0 35 320.0 36 442.0 37 794.0 38 1110.0 39 170.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 54.73710947421895 6.731013462026924 3.6576073152146305 34.8742697485395 2 28.325 6.125 32.425 33.125 3 25.3 8.774999999999999 23.474999999999998 42.449999999999996 4 30.2 15.5 21.6 32.7 5 29.2 19.275000000000002 27.075 24.45 6 24.45 25.624999999999996 24.275 25.650000000000002 7 18.0 23.075000000000003 42.725 16.2 8 17.525 23.05 37.775 21.65 9 17.25 21.85 39.425 21.475 10-11 20.2375 32.487500000000004 29.4375 17.837500000000002 12-13 21.0375 27.437499999999996 31.0375 20.4875 14-15 20.875 27.275 31.112499999999997 20.7375 16-17 21.975 27.3625 28.487499999999997 22.175 18-19 20.9125 28.512500000000003 28.962500000000002 21.6125 20-21 20.7875 29.325000000000003 28.6125 21.275 22-23 21.525 28.549999999999997 27.525 22.400000000000002 24-25 20.6125 28.15 28.7375 22.5 26-27 20.599999999999998 28.275 28.537499999999998 22.5875 28-29 20.974999999999998 28.475 28.925 21.625 30-31 20.6875 28.175 28.475 22.662499999999998 32-33 21.212500000000002 28.4125 27.474999999999998 22.900000000000002 34-35 21.15 27.237499999999997 28.3375 23.275000000000002 36-37 20.6875 27.025 29.375 22.912499999999998 38-39 20.849999999999998 27.250000000000004 28.9375 22.9625 40-41 20.825 27.975 28.225 22.975 42-43 21.375 29.175 27.925 21.525 44-45 20.6875 28.7 27.1375 23.474999999999998 46-47 21.975 28.199999999999996 27.400000000000002 22.425 48-49 21.8625 27.787499999999998 27.8625 22.4875 50-51 21.4875 27.925 27.712500000000002 22.875 52-53 20.7375 28.6875 28.499999999999996 22.075 54-55 20.5875 27.150000000000002 29.1625 23.1 56-57 20.925 27.825 28.449999999999996 22.8 58-59 21.3875 27.6625 28.15 22.8 60-61 20.9125 28.212500000000002 27.6375 23.2375 62-63 20.5375 27.750000000000004 29.362500000000004 22.35 64-65 22.112499999999997 28.3375 27.900000000000002 21.65 66-67 21.525 27.474999999999998 27.8625 23.1375 68-69 21.4125 28.237499999999997 28.000000000000004 22.35 70-71 21.462500000000002 28.462500000000002 28.075 22.0 72-73 21.087500000000002 28.0625 27.762500000000003 23.0875 74-75 21.762500000000003 27.037499999999998 28.237499999999997 22.9625 76-77 20.575 27.825 28.675 22.925 78-79 21.2625 27.875 27.775 23.0875 80-81 20.5 27.9125 28.1125 23.474999999999998 82-83 21.7 27.725 28.075 22.5 84-85 21.1875 28.7 27.675 22.4375 86-87 21.762500000000003 27.6 28.1375 22.5 88-89 21.2375 28.7375 27.575 22.45 90-91 20.7875 28.125 28.1375 22.95 92-93 21.0625 27.3 29.125 22.5125 94-95 21.425 27.700000000000003 28.625 22.25 96-97 21.4875 27.9375 27.212500000000002 23.3625 98-99 21.85 27.3875 28.0625 22.7 100-101 21.25 28.15 27.500000000000004 23.1 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.5 22 1.0 23 0.5 24 0.5 25 2.0 26 5.5 27 9.0 28 8.5 29 10.0 30 17.0 31 28.5 32 33.5 33 37.5 34 48.5 35 57.5 36 73.0 37 96.5 38 129.0 39 149.0 40 162.0 41 199.5 42 227.0 43 263.5 44 293.5 45 292.5 46 282.5 47 246.0 48 225.0 49 211.0 50 170.0 51 129.0 52 114.0 53 109.0 54 84.0 55 56.5 56 50.5 57 42.0 58 25.5 59 20.0 60 17.0 61 16.0 62 10.0 63 5.5 64 9.0 65 8.5 66 6.0 67 5.0 68 3.0 69 1.0 70 1.0 71 0.5 72 0.5 73 1.5 74 1.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24337957124843 98.375 2 0.7061790668348046 1.4000000000000001 3 0.025220680958385876 0.075 4 0.0 0.0 5 0.0 0.0 6 0.025220680958385876 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGTCGTCGTCGTCGCCAGAAGCGCCACTACCAGTTTTAGTTTCCGTGT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.32499999999999996 0.0 0.0 0.0 0.0 80-81 0.4375 0.0 0.0 0.0 0.0 82-83 0.675 0.0 0.0 0.0 0.0 84-85 0.75 0.0 0.0 0.0 0.0 86-87 0.925 0.0 0.0 0.0 0.0 88-89 1.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864489 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864489_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.1815 33.0 31.0 34.0 28.0 34.0 2 31.073 33.0 31.0 34.0 27.0 34.0 3 31.1745 34.0 31.0 34.0 28.0 34.0 4 34.632 37.0 35.0 37.0 32.0 37.0 5 34.68325 37.0 35.0 37.0 32.0 37.0 6 34.6395 37.0 35.0 37.0 32.0 37.0 7 34.658 37.0 35.0 37.0 32.0 37.0 8 34.59125 37.0 35.0 37.0 32.0 37.0 9 36.24275 39.0 37.0 39.0 32.0 39.0 10-11 36.154125 39.0 37.0 39.0 32.0 39.0 12-13 36.04025 39.0 37.0 39.0 32.0 39.0 14-15 37.31225 40.0 38.0 41.0 31.5 41.0 16-17 37.30975 40.0 38.0 41.0 32.0 41.0 18-19 37.232875 40.0 38.0 41.0 31.0 41.0 20-21 37.278 40.0 38.0 41.0 32.0 41.0 22-23 37.176625 40.0 38.0 41.0 31.0 41.0 24-25 36.909875 40.0 38.0 41.0 30.5 41.0 26-27 36.714 40.0 37.0 41.0 30.0 41.0 28-29 36.704625 40.0 37.0 41.0 30.0 41.0 30-31 36.635374999999996 40.0 37.0 41.0 30.0 41.0 32-33 36.41225 40.0 37.0 41.0 29.0 41.0 34-35 36.329875 40.0 37.0 41.0 28.5 41.0 36-37 36.061 40.0 36.0 41.0 27.5 41.0 38-39 35.8905 40.0 36.0 41.0 27.0 41.0 40-41 35.836875 39.0 36.0 41.0 27.0 41.0 42-43 35.542625 39.0 35.5 41.0 26.0 41.0 44-45 35.28425 39.0 35.0 40.5 25.5 41.0 46-47 35.38875 39.0 35.0 41.0 25.5 41.0 48-49 35.120875 39.0 35.0 41.0 24.0 41.0 50-51 34.401125 38.0 34.0 39.5 23.5 40.5 52-53 34.350875 38.0 34.0 39.5 23.0 40.5 54-55 35.243875 39.0 35.0 40.5 24.5 41.0 56-57 35.152375000000006 39.0 35.0 41.0 25.0 41.0 58-59 35.144125 39.0 35.0 41.0 25.0 41.0 60-61 34.867125 39.0 35.0 41.0 24.5 41.0 62-63 34.573750000000004 38.5 34.0 40.5 22.5 41.0 64-65 34.277874999999995 38.0 34.0 40.0 22.5 41.0 66-67 33.92425 37.0 34.0 40.0 22.5 41.0 68-69 33.650999999999996 37.0 34.0 39.5 22.5 41.0 70-71 33.170500000000004 36.5 33.0 39.0 21.0 41.0 72-73 32.6015 36.0 33.0 39.0 20.0 40.0 74-75 32.169 35.0 32.0 37.5 19.0 39.0 76-77 31.86175 35.0 32.0 37.0 19.5 39.0 78-79 31.36625 35.0 32.0 36.5 17.5 38.5 80-81 31.13 35.0 32.0 36.0 18.0 37.0 82-83 30.724625 35.0 31.0 36.0 15.0 37.0 84-85 30.448875 35.0 31.0 35.0 11.0 36.5 86-87 30.1535 34.5 31.0 35.0 7.0 36.0 88-89 29.74425 34.0 30.5 35.0 4.5 36.0 90-91 29.584249999999997 34.0 30.5 35.0 2.0 35.5 92-93 29.28 34.0 30.0 35.0 2.0 35.0 94-95 29.05275 34.0 30.0 35.0 2.0 35.0 96-97 28.74725 34.0 30.0 35.0 2.0 35.0 98-99 28.2745 34.0 29.0 35.0 2.0 35.0 100-101 27.326625 33.5 27.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 92.0 3 16.0 4 7.0 5 7.0 6 10.0 7 9.0 8 13.0 9 13.0 10 9.0 11 14.0 12 16.0 13 16.0 14 12.0 15 12.0 16 11.0 17 16.0 18 8.0 19 13.0 20 13.0 21 19.0 22 20.0 23 25.0 24 32.0 25 35.0 26 36.0 27 34.0 28 53.0 29 56.0 30 69.0 31 89.0 32 117.0 33 137.0 34 175.0 35 303.0 36 446.0 37 865.0 38 1047.0 39 135.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.8 25.3 8.825 30.075000000000003 2 24.975 26.25 33.725 15.049999999999999 3 19.575 27.450000000000003 32.1 20.875 4 23.400000000000002 31.775 25.0 19.825 5 23.65 37.3 21.2 17.849999999999998 6 19.325 39.550000000000004 21.575 19.55 7 20.5 24.575 35.55 19.375 8 19.825 26.575 29.7 23.9 9 20.849999999999998 26.150000000000002 30.575000000000003 22.425 10-11 22.0625 31.6875 24.474999999999998 21.775 12-13 23.2625 26.2125 28.075 22.45 14-15 21.8625 29.1625 27.3625 21.6125 16-17 22.775000000000002 28.199999999999996 27.500000000000004 21.525 18-19 22.625 28.475 27.5125 21.3875 20-21 22.325 28.512500000000003 27.1125 22.05 22-23 22.650000000000002 29.075 27.237499999999997 21.0375 24-25 22.45 28.15 28.0625 21.337500000000002 26-27 22.175 28.462500000000002 27.55 21.8125 28-29 22.925 29.049999999999997 26.525 21.5 30-31 22.5125 28.025 27.950000000000003 21.512500000000003 32-33 22.3375 29.025000000000002 26.900000000000002 21.7375 34-35 23.125 28.262500000000003 27.1 21.512500000000003 36-37 22.4375 28.3625 27.775 21.425 38-39 22.162499999999998 29.349999999999998 27.037499999999998 21.45 40-41 21.8125 28.975 27.712500000000002 21.5 42-43 22.6125 28.9375 27.3125 21.1375 44-45 22.662499999999998 28.037499999999998 27.85 21.45 46-47 23.2125 28.249999999999996 27.1625 21.375 48-49 22.1 28.1125 28.075 21.712500000000002 50-51 22.662499999999998 27.987499999999997 27.5875 21.762500000000003 52-53 22.650000000000002 28.487499999999997 27.025 21.837500000000002 54-55 22.400000000000002 28.9125 27.625 21.0625 56-57 22.275 29.45 26.950000000000003 21.325 58-59 21.7875 28.9875 28.050000000000004 21.175 60-61 22.7125 28.037499999999998 27.8125 21.4375 62-63 22.775000000000002 27.9375 28.012500000000003 21.275 64-65 23.7875 28.475 26.7125 21.025 66-67 22.25 29.1875 27.737499999999997 20.825 68-69 22.650000000000002 27.712500000000002 27.8875 21.75 70-71 22.275 29.6375 27.4125 20.674999999999997 72-73 22.95 29.075 26.937499999999996 21.0375 74-75 23.2125 28.6125 27.200000000000003 20.974999999999998 76-77 23.5875 28.1375 27.025 21.25 78-79 22.95 28.525 27.55 20.974999999999998 80-81 21.625 29.575000000000003 27.725 21.075 82-83 22.0875 28.749999999999996 27.400000000000002 21.762500000000003 84-85 23.400000000000002 28.0625 27.487499999999997 21.05 86-87 21.5 29.012500000000003 27.85 21.637500000000003 88-89 23.1875 28.799999999999997 26.974999999999998 21.0375 90-91 22.175 28.9375 27.0 21.8875 92-93 23.5 27.8875 27.762500000000003 20.849999999999998 94-95 22.6375 27.8625 27.237499999999997 22.2625 96-97 21.987499999999997 29.3875 27.1 21.525 98-99 22.875 29.675 26.700000000000003 20.75 100-101 23.5625 28.012500000000003 26.5125 21.912499999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 2.0 17 2.5 18 1.0 19 1.5 20 1.0 21 1.0 22 2.0 23 3.5 24 5.0 25 4.5 26 3.5 27 5.0 28 10.5 29 15.0 30 20.5 31 27.5 32 33.0 33 43.0 34 54.5 35 60.5 36 82.5 37 102.5 38 130.0 39 166.0 40 199.5 41 235.0 42 248.5 43 271.5 44 296.0 45 289.5 46 261.5 47 230.0 48 200.0 49 183.0 50 176.5 51 140.0 52 106.5 53 86.5 54 57.5 55 44.5 56 39.0 57 31.0 58 25.0 59 20.0 60 12.5 61 10.5 62 9.0 63 6.0 64 6.0 65 5.5 66 5.5 67 4.0 68 3.0 69 3.5 70 2.0 71 1.0 72 1.5 73 1.0 74 1.0 75 1.5 76 1.0 77 0.5 78 0.0 79 0.5 80 0.5 81 0.5 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.32499999999999996 0.0 0.0 0.0 0.0 80-81 0.4375 0.0 0.0 0.0 0.0 82-83 0.6499999999999999 0.0 0.0 0.0 0.0 84-85 0.725 0.0 0.0 0.0 0.0 86-87 0.9 0.0 0.0 0.0 0.0 88-89 1.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 839094 spots for ERR1864489.sra Written 839094 spots for ERR1864489.sra Read 839094 spots for ERR1864489.sra Written 839094 spots for ERR1864489.sra Read 839094 spots for ERR1864489.sra Written 839094 spots for ERR1864489.sra Read 839095 spots for ERR1864489.sra Written 839095 spots for ERR1864489.sra Read 839094 spots for ERR1864489.sra Written 839094 spots for ERR1864489.sra Read 839094 spots for ERR1864489.sra Written 839094 spots for ERR1864489.sra Read 839094 spots for ERR1864489.sra Written 839094 spots for ERR1864489.sra Read 839094 spots for ERR1864489.sra Written 839094 spots for ERR1864489.sra Read 839094 spots for ERR1864489.sra Written 839094 spots for ERR1864489.sra Read 839094 spots for ERR1864489.sra Written 839094 spots for ERR1864489.sra Read 839094 spots for ERR1864489.sra Written 839094 spots for ERR1864489.sra Read 839094 spots for ERR1864489.sra Written 839094 spots for ERR1864489.sra Read 839094 spots for ERR1864489.sra Written 839094 spots for ERR1864489.sra Read 839094 spots for ERR1864489.sra Written 839094 spots for ERR1864489.sra Read 839094 spots for ERR1864489.sra Written 839094 spots for ERR1864489.sra Read 839094 spots for ERR1864489.sra Written 839094 spots for ERR1864489.sra Read 839094 spots for ERR1864489.sra Written 839094 spots for ERR1864489.sra Read 839094 spots for ERR1864489.sra Written 839094 spots for ERR1864489.sra Read 839094 spots for ERR1864489.sra Written 839094 spots for ERR1864489.sra Read 839094 spots for ERR1864489.sra Written 839094 spots for ERR1864489.sra SRR ids: ['ERR1864489.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e_l45pfr ERR1864489.sra spots: 16781881 blocks: [[1, 839094], [839095, 1678188], [1678189, 2517282], [2517283, 3356376], [3356377, 4195470], [4195471, 5034564], [5034565, 5873658], [5873659, 6712752], [6712753, 7551846], [7551847, 8390940], [8390941, 9230034], [9230035, 10069128], [10069129, 10908222], [10908223, 11747316], [11747317, 12586410], [12586411, 13425504], [13425505, 14264598], [14264599, 15103692], [15103693, 15942786], [15942787, 16781881]] ERR1864489 file size 4026272 ERR1864489 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864489 ERR1864489_1.fastq ERR1864489_2.fastq Input file: ERR1864489_1.fastq Paired file: ERR1864489_2.fastq trimmed: ERR1864489-trimmed-pair1.fastq, ERR1864489-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:16:28 2025 >> started Thu Feb 13 14:16:43 2025 >> done (14.768s) 16781881 read pairs processed; of these: 396431 ( 2.36%) short read pairs filtered out after trimming by size control 571676 ( 3.41%) empty read pairs filtered out after trimming by size control 15813774 (94.23%) read pairs available; of these: 3715572 (23.50%) trimmed read pairs available after processing 12098202 (76.50%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 156 0.00% 19 313 0.00% 20 458 0.00% 21 678 0.00% 22 864 0.01% 23 1053 0.01% 24 1248 0.01% 25 1449 0.01% 26 1701 0.01% 27 1944 0.01% 28 2264 0.01% 29 2516 0.02% 30 2850 0.02% 31 3186 0.02% 32 3533 0.02% 33 3960 0.03% 34 4398 0.03% 35 4639 0.03% 36 5066 0.03% 37 5466 0.03% 38 5713 0.04% 39 6078 0.04% 40 6429 0.04% 41 6711 0.04% 42 6997 0.04% 43 7466 0.05% 44 7938 0.05% 45 8199 0.05% 46 8590 0.05% 47 9000 0.06% 48 9369 0.06% 49 9844 0.06% 50 10195 0.06% 51 10662 0.07% 52 11470 0.07% 53 11844 0.07% 54 12325 0.08% 55 13028 0.08% 56 13531 0.09% 57 14451 0.09% 58 15297 0.10% 59 22913 0.14% 60 28744 0.18% 61 29396 0.19% 62 28955 0.18% 63 28947 0.18% 64 29445 0.19% 65 29684 0.19% 66 30385 0.19% 67 31048 0.20% 68 32114 0.20% 69 33184 0.21% 70 34223 0.22% 71 35452 0.22% 72 37105 0.23% 73 37294 0.24% 74 38210 0.24% 75 39205 0.25% 76 39323 0.25% 77 40319 0.25% 78 42428 0.27% 79 44456 0.28% 80 46850 0.30% 81 48829 0.31% 82 51088 0.32% 83 54196 0.34% 84 57645 0.36% 85 60924 0.39% 86 64546 0.41% 87 68487 0.43% 88 69199 0.44% 89 72309 0.46% 90 80739 0.51% 91 88403 0.56% 92 99069 0.63% 93 111621 0.71% 94 125010 0.79% 95 143877 0.91% 96 170178 1.08% 97 208616 1.32% 98 272887 1.73% 99 361337 2.28% 100 494053 3.12% 101 12098202 76.50% 15813774 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=5.48 fanout-score-rank=23 prefix-density=0.22 prefix-fanout=2.9 sequence=TCGTCGTCGTCGCCAGAAGCGCCACTACCAGTTTTAGTTTCCGTGTTACTGTTGCCGTTGTTTGAAGTAGGCGTCTCGGCATCATTAGCTCCAGCGCTTACCTTTCGACCGAGAGATGATGG criterion=fanout-score sequence-density=0.07 sequence-density-rank=18 fanout-score=303.85 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=27.6 sequence=CTTCTTCTTCTTTTT criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=22.62 fanout-score-rank=16 prefix-density=0.30 prefix-fanout=8.8 sequence=GAAGCTGAAACT criterion=fanout-score sequence-density=0.08 sequence-density-rank=8 fanout-score=249.62 fanout-score-rank=1 prefix-density=0.75 prefix-fanout=26.0 sequence=AAGAAGAAGAAA ERR1864489 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:17:19 Started mapping on | Feb 13 14:17:19 Finished on | Feb 13 14:17:53 Mapping speed, Million of reads per hour | 1674.40 Number of input reads | 15813774 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 15185545 Uniquely mapped reads % | 96.03% Average mapped length | 195.04 Number of splices: Total | 8449836 Number of splices: Annotated (sjdb) | 8302117 Number of splices: GT/AG | 8325034 Number of splices: GC/AG | 105014 Number of splices: AT/AC | 8556 Number of splices: Non-canonical | 11232 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 2.31 Insertion rate per base | 0.01% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 327289 % of reads mapped to multiple loci | 2.07% Number of reads mapped to too many loci | 32110 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.68% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 370608 370608 370608 N_multimapping 327289 327289 327289 N_noFeature 498221 15016493 567717 N_ambiguous 158335 704 58391 UnstrandedReadsAssigned:14528989 PositiveStrandReadsAssigned:168348 NegativeStrandReadsAssigned:14559437 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864489 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864489-trimmed-pair1.fastq ERR1864489-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,813,774 reads, 14,724,176 reads pseudoaligned [quant] estimated average fragment length: 161.316 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,182 rounds 52401 ERR1864489.ke.tsv 34699 ERR1864489.se.tsv 87100 total ==> ERR1864489.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1857.68 614 29.8062 Potri.005G024800.1.v4.1 1035 874.684 130 13.403 Potri.004G059700.1.v4.1 961 800.693 3 0.337882 Potri.007G009000.2.v4.1 1416 1255.68 0 0 Potri.003G141000.2.v4.1 2943 2782.68 345.201 11.1871 Potri.016G087400.1.v4.1 270 117.536 901.327 691.548 Potri.015G069301.1.v4.1 564 403.807 0 0 Potri.010G195200.1.v4.1 1773 1612.68 105 5.87152 Potri.012G127500.1.v4.1 977 816.684 318 35.1143 ==> ERR1864489.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2625 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 321 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 27 ERR1864489 completed mapping pipeline successfully