Starting /dee2/code/volunteer_pipeline.sh ERR1864490 current disk space = 3089841168384 free memory = 1486002548 ERR1864490 SRAfilesize 33801d1a374596cacd1141a1e59be334 ERR1864490.sra ERR1864490.sra file validated ERR1864490 is paired end ERR1864490 is conventional basespace ERR1864490 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864490_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.49375 33.0 31.0 34.0 30.0 34.0 2 31.8945 34.0 31.0 34.0 30.0 34.0 3 31.975 34.0 31.0 34.0 30.0 34.0 4 35.474 37.0 35.0 37.0 33.0 37.0 5 35.19975 37.0 35.0 37.0 33.0 37.0 6 35.095 37.0 35.0 37.0 32.0 37.0 7 35.11875 37.0 35.0 37.0 33.0 37.0 8 35.14925 37.0 35.0 37.0 33.0 37.0 9 36.81475 39.0 37.0 39.0 33.0 39.0 10-11 36.750375 39.0 37.0 39.0 33.0 39.0 12-13 36.504125 39.0 37.0 39.0 32.5 39.0 14-15 38.0065 40.0 38.0 41.0 33.0 41.0 16-17 37.9035 40.0 38.0 41.0 33.0 41.0 18-19 37.824375 40.0 38.0 41.0 33.0 41.0 20-21 37.777125 40.0 38.0 41.0 32.5 41.0 22-23 37.611999999999995 40.0 38.0 41.0 32.0 41.0 24-25 37.576499999999996 40.0 38.0 41.0 32.0 41.0 26-27 37.317625 40.0 38.0 41.0 32.0 41.0 28-29 37.255875 40.0 38.0 41.0 31.0 41.0 30-31 37.086749999999995 40.0 37.5 41.0 31.0 41.0 32-33 36.975375 40.0 37.0 41.0 30.5 41.0 34-35 36.9255 40.0 37.0 41.0 30.5 41.0 36-37 36.942750000000004 40.0 37.0 41.0 30.5 41.0 38-39 36.72525 40.0 37.0 41.0 30.0 41.0 40-41 36.551249999999996 40.0 36.5 41.0 30.0 41.0 42-43 36.476625 40.0 36.5 41.0 30.0 41.0 44-45 36.4195 40.0 36.0 41.0 30.0 41.0 46-47 36.3425 40.0 36.0 41.0 29.5 41.0 48-49 36.448499999999996 40.0 36.5 41.0 30.0 41.0 50-51 36.44125 40.0 36.0 41.0 30.0 41.0 52-53 36.245000000000005 40.0 36.0 41.0 28.5 41.0 54-55 36.025999999999996 40.0 35.5 41.0 28.0 41.0 56-57 35.799625 39.0 35.0 41.0 28.0 41.0 58-59 35.67675 39.0 35.0 41.0 28.0 41.0 60-61 35.377250000000004 39.0 35.0 41.0 26.5 41.0 62-63 35.10275 38.5 34.5 40.0 27.0 41.0 64-65 34.71775 38.0 34.0 40.0 26.0 41.0 66-67 34.401624999999996 37.5 34.0 40.0 25.5 41.0 68-69 34.141375 37.0 34.0 39.5 26.0 41.0 70-71 33.604875 36.0 33.0 39.0 26.0 40.5 72-73 33.241749999999996 36.0 33.0 39.0 25.0 40.0 74-75 32.692625 35.0 33.0 37.5 22.5 39.5 76-77 31.74575 34.5 31.5 36.5 23.0 39.0 78-79 32.097625 35.0 32.0 37.0 24.5 39.0 80-81 31.982375 35.0 33.0 36.0 24.0 37.0 82-83 31.618875 35.0 32.0 36.0 23.0 37.0 84-85 31.280625 35.0 32.0 35.5 21.5 37.0 86-87 30.999125 35.0 32.0 35.0 20.0 36.0 88-89 30.758625000000002 35.0 31.5 35.0 20.0 36.0 90-91 30.446875 34.0 31.0 35.0 18.0 36.0 92-93 30.140625 34.0 31.0 35.0 14.0 35.0 94-95 29.715125 34.0 31.0 35.0 4.5 35.0 96-97 29.510375 34.0 30.0 35.0 2.0 35.0 98-99 29.206125 34.0 30.5 35.0 2.0 35.0 100-101 28.076125 33.5 28.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 49.0 3 20.0 4 10.0 5 8.0 6 16.0 7 3.0 8 5.0 9 10.0 10 9.0 11 8.0 12 7.0 13 14.0 14 11.0 15 10.0 16 7.0 17 6.0 18 16.0 19 23.0 20 11.0 21 10.0 22 10.0 23 18.0 24 26.0 25 23.0 26 43.0 27 26.0 28 48.0 29 56.0 30 66.0 31 105.0 32 103.0 33 142.0 34 193.0 35 254.0 36 467.0 37 855.0 38 1147.0 39 165.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 59.458090655862236 6.811851101544694 3.8997214484679668 29.830336794125095 2 29.799999999999997 6.4 31.125000000000004 32.675 3 26.3 8.774999999999999 24.775 40.150000000000006 4 30.775000000000002 14.975 22.1 32.15 5 29.225 21.075 25.174999999999997 24.525 6 23.375 25.4 26.474999999999998 24.75 7 18.425 23.599999999999998 41.8 16.175 8 16.650000000000002 25.1 36.15 22.1 9 19.2 22.85 37.475 20.474999999999998 10-11 19.875 32.8625 29.012500000000003 18.25 12-13 20.849999999999998 27.3375 31.3125 20.5 14-15 20.549999999999997 28.299999999999997 30.25 20.9 16-17 20.849999999999998 28.6375 29.375 21.1375 18-19 20.549999999999997 30.0 27.9375 21.512500000000003 20-21 20.775 29.325000000000003 28.65 21.25 22-23 21.85 27.737499999999997 28.212500000000002 22.2 24-25 22.1 28.275 27.762500000000003 21.8625 26-27 21.349999999999998 28.787499999999998 27.8625 22.0 28-29 20.6125 28.4375 28.599999999999998 22.35 30-31 20.625 27.8375 28.5625 22.975 32-33 21.1625 28.499999999999996 27.737499999999997 22.6 34-35 20.7125 27.8375 28.8375 22.6125 36-37 20.925 27.437499999999996 28.125 23.5125 38-39 21.3125 27.6125 28.349999999999998 22.725 40-41 21.8875 28.5625 27.5625 21.987499999999997 42-43 20.9875 28.4 27.450000000000003 23.1625 44-45 20.325 28.725 27.925 23.025000000000002 46-47 20.525 28.499999999999996 28.4375 22.537499999999998 48-49 22.125 28.0875 27.675 22.112499999999997 50-51 20.8875 27.700000000000003 28.5875 22.825 52-53 21.087500000000002 28.1875 28.012500000000003 22.7125 54-55 21.9625 28.537499999999998 26.6 22.900000000000002 56-57 20.4 29.362500000000004 27.725 22.5125 58-59 21.2375 27.500000000000004 28.599999999999998 22.662499999999998 60-61 21.95 27.875 27.5875 22.5875 62-63 20.375 27.325 28.8625 23.4375 64-65 21.5 27.725 28.125 22.650000000000002 66-67 21.025 28.8625 28.037499999999998 22.075 68-69 20.875 28.199999999999996 28.287499999999998 22.6375 70-71 21.087500000000002 29.725 27.250000000000004 21.9375 72-73 20.775 28.762500000000003 27.9375 22.525000000000002 74-75 21.6625 27.575 28.3625 22.400000000000002 76-77 21.5 27.6375 28.675 22.1875 78-79 20.974999999999998 28.1375 28.175 22.7125 80-81 21.3625 27.525 28.4 22.7125 82-83 21.3 27.35 28.287499999999998 23.0625 84-85 21.224999999999998 28.725 27.0 23.05 86-87 20.875 29.4375 27.700000000000003 21.987499999999997 88-89 22.2 27.625 27.375 22.8 90-91 21.05 27.675 26.950000000000003 24.325 92-93 21.85 27.9375 27.3875 22.825 94-95 21.1375 28.675 28.075 22.112499999999997 96-97 21.9375 28.175 27.5125 22.375 98-99 21.625 27.237499999999997 28.037499999999998 23.1 100-101 22.125 28.6875 27.6 21.587500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.5 19 1.0 20 0.5 21 1.0 22 1.0 23 1.5 24 2.0 25 5.0 26 7.5 27 7.5 28 8.0 29 11.5 30 15.5 31 23.0 32 26.0 33 30.0 34 42.5 35 57.0 36 76.5 37 92.0 38 120.5 39 145.5 40 174.5 41 214.0 42 228.0 43 250.5 44 280.5 45 298.5 46 303.5 47 277.5 48 234.0 49 198.5 50 166.0 51 144.0 52 121.0 53 95.0 54 75.5 55 61.0 56 50.0 57 34.0 58 24.5 59 18.0 60 15.5 61 13.5 62 9.5 63 11.0 64 8.5 65 3.5 66 2.5 67 2.0 68 2.5 69 1.5 70 1.5 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.275 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26841574167507 98.375 2 0.6054490413723511 1.2 3 0.07568113017154389 0.22499999999999998 4 0.050454086781029264 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1375 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.1875 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.2625 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.375 0.0 0.0 0.0 0.0 80-81 0.4125 0.0 0.0 0.0 0.0 82-83 0.5249999999999999 0.0 0.0 0.0 0.0 84-85 0.75 0.0 0.0 0.0 0.0 86-87 0.875 0.0 0.0 0.0 0.0 88-89 1.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864490 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864490_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.33975 33.0 31.0 34.0 28.0 34.0 2 31.388 34.0 31.0 34.0 28.0 34.0 3 31.4215 34.0 31.0 34.0 28.0 34.0 4 34.895 37.0 35.0 37.0 32.0 37.0 5 34.88175 37.0 35.0 37.0 32.0 37.0 6 34.8875 37.0 35.0 37.0 32.0 37.0 7 34.88825 37.0 35.0 37.0 32.0 37.0 8 34.75025 37.0 35.0 37.0 32.0 37.0 9 36.4745 39.0 37.0 39.0 32.0 39.0 10-11 36.461375000000004 39.0 37.0 39.0 32.0 39.0 12-13 36.297625 39.0 37.0 39.0 32.0 39.0 14-15 37.58425 40.0 38.0 41.0 32.0 41.0 16-17 37.551249999999996 40.0 38.0 41.0 32.0 41.0 18-19 37.45525 40.0 38.0 41.0 32.0 41.0 20-21 37.47175 40.0 38.0 41.0 31.5 41.0 22-23 37.333 40.0 38.0 41.0 31.5 41.0 24-25 37.241749999999996 40.0 38.0 41.0 31.0 41.0 26-27 37.00075 40.0 38.0 41.0 30.5 41.0 28-29 36.9655 40.0 38.0 41.0 30.0 41.0 30-31 36.850875 40.0 37.5 41.0 30.0 41.0 32-33 36.693625 40.0 37.0 41.0 30.0 41.0 34-35 36.566875 40.0 37.0 41.0 30.0 41.0 36-37 36.35375 40.0 37.0 41.0 29.5 41.0 38-39 36.22325 40.0 36.5 41.0 28.5 41.0 40-41 36.0 39.5 36.0 41.0 27.5 41.0 42-43 35.863 39.0 36.0 41.0 27.5 41.0 44-45 35.602625 39.0 35.0 40.5 26.5 41.0 46-47 35.581 39.0 35.5 41.0 26.0 41.0 48-49 35.435 39.0 35.0 41.0 26.0 41.0 50-51 34.735375000000005 38.0 34.0 39.5 25.0 40.5 52-53 34.649625 38.0 34.5 39.5 24.5 40.5 54-55 35.651375 39.0 36.0 40.5 26.5 41.0 56-57 35.578374999999994 39.0 35.5 41.0 27.0 41.0 58-59 35.501 39.0 35.5 41.0 26.5 41.0 60-61 35.2555 39.0 35.0 41.0 26.0 41.0 62-63 34.875625 38.5 35.0 40.5 26.0 41.0 64-65 34.552499999999995 38.0 34.0 40.0 25.0 41.0 66-67 34.14875 37.5 34.0 40.0 24.0 41.0 68-69 33.826375 37.0 34.0 39.5 23.5 41.0 70-71 33.398875 36.0 34.0 39.0 23.5 41.0 72-73 32.922 36.0 33.0 39.0 22.0 40.0 74-75 32.375625 35.0 33.0 37.5 20.5 39.0 76-77 31.961875 35.0 32.0 37.0 20.0 39.0 78-79 31.52625 35.0 32.0 36.5 18.0 38.5 80-81 31.266125 35.0 32.0 36.0 18.5 37.0 82-83 30.767 35.0 31.0 35.5 15.0 37.0 84-85 30.402875 34.5 31.0 35.0 12.0 36.5 86-87 30.2465 34.5 31.0 35.0 9.5 36.0 88-89 29.978875 34.0 31.0 35.0 7.0 36.0 90-91 29.774749999999997 34.0 30.5 35.0 4.5 35.5 92-93 29.50975 34.0 30.5 35.0 2.0 35.0 94-95 29.181375000000003 34.0 30.0 35.0 2.0 35.0 96-97 28.750375 34.0 29.5 35.0 2.0 35.0 98-99 28.171125 34.0 29.0 35.0 2.0 35.0 100-101 27.364125 33.5 27.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 66.0 3 17.0 4 15.0 5 12.0 6 5.0 7 9.0 8 8.0 9 7.0 10 18.0 11 11.0 12 16.0 13 10.0 14 5.0 15 10.0 16 11.0 17 15.0 18 12.0 19 22.0 20 15.0 21 24.0 22 24.0 23 25.0 24 27.0 25 27.0 26 27.0 27 38.0 28 51.0 29 62.0 30 83.0 31 77.0 32 118.0 33 129.0 34 174.0 35 279.0 36 463.0 37 935.0 38 1009.0 39 144.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.45 26.400000000000002 8.025 26.125 2 26.525 26.424999999999997 31.125000000000004 15.925 3 18.675 28.7 33.275 19.35 4 21.575 33.975 25.25 19.2 5 24.5 36.275 21.825 17.4 6 20.724999999999998 39.900000000000006 21.025 18.35 7 19.825 23.425 37.724999999999994 19.025 8 20.674999999999997 25.8 29.549999999999997 23.974999999999998 9 21.9 25.025 29.425 23.65 10-11 23.075000000000003 32.175 24.375 20.375 12-13 22.8125 27.237499999999997 27.375 22.575 14-15 22.725 28.749999999999996 27.224999999999998 21.3 16-17 23.3 27.474999999999998 27.3875 21.837500000000002 18-19 22.025 28.8625 27.375 21.7375 20-21 22.9375 28.6625 26.900000000000002 21.5 22-23 22.975 28.962500000000002 27.0125 21.05 24-25 22.625 28.325 28.349999999999998 20.7 26-27 22.5 29.225 27.037499999999998 21.2375 28-29 22.55 28.512500000000003 27.700000000000003 21.2375 30-31 22.162499999999998 28.037499999999998 29.462500000000002 20.3375 32-33 23.1875 28.349999999999998 27.462500000000002 21.0 34-35 22.6125 28.7375 26.900000000000002 21.75 36-37 21.1625 28.8375 28.499999999999996 21.5 38-39 23.2125 27.975 27.250000000000004 21.5625 40-41 22.4875 29.2 27.125 21.1875 42-43 22.075 28.175 28.225 21.525 44-45 22.775000000000002 27.237499999999997 28.675 21.3125 46-47 23.2625 28.287499999999998 27.6 20.849999999999998 48-49 22.6125 28.575 28.3875 20.424999999999997 50-51 23.599999999999998 27.3625 27.500000000000004 21.5375 52-53 22.0625 29.075 28.249999999999996 20.6125 54-55 21.625 29.1375 28.3875 20.849999999999998 56-57 21.987499999999997 28.825 28.325 20.8625 58-59 23.5 28.299999999999997 27.575 20.625 60-61 23.0875 28.575 27.05 21.2875 62-63 22.55 28.199999999999996 27.875 21.375 64-65 22.412499999999998 28.825 27.474999999999998 21.2875 66-67 21.875 28.499999999999996 28.262500000000003 21.3625 68-69 23.225 29.0875 26.7125 20.974999999999998 70-71 22.7375 28.999999999999996 27.6625 20.599999999999998 72-73 22.4625 28.6125 27.0875 21.837500000000002 74-75 23.375 28.425 27.3 20.9 76-77 22.575 28.237499999999997 27.537499999999998 21.65 78-79 22.037499999999998 29.262500000000003 28.000000000000004 20.7 80-81 23.0375 27.6 27.9375 21.425 82-83 22.825 28.1375 27.5625 21.475 84-85 22.650000000000002 27.925 27.787499999999998 21.637500000000003 86-87 22.225 28.275 28.787499999999998 20.7125 88-89 22.650000000000002 28.237499999999997 28.249999999999996 20.8625 90-91 22.45 28.499999999999996 28.425 20.625 92-93 22.4875 28.95 27.6125 20.95 94-95 22.0875 29.049999999999997 27.175 21.6875 96-97 22.4875 28.5875 27.437499999999996 21.4875 98-99 23.525 28.925 26.737499999999997 20.8125 100-101 24.5375 27.675 26.775 21.0125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.0 14 0.5 15 0.5 16 1.0 17 2.0 18 2.0 19 1.5 20 1.0 21 0.5 22 1.5 23 2.0 24 2.5 25 5.0 26 4.0 27 5.5 28 7.5 29 8.5 30 17.0 31 24.0 32 26.5 33 39.5 34 57.5 35 70.5 36 87.5 37 113.0 38 142.0 39 164.0 40 205.5 41 243.0 42 260.5 43 281.0 44 275.5 45 282.5 46 278.5 47 241.0 48 215.0 49 184.5 50 152.0 51 122.0 52 98.5 53 78.5 54 64.5 55 52.5 56 39.0 57 31.5 58 23.5 59 19.0 60 14.5 61 9.5 62 8.5 63 8.5 64 6.5 65 4.0 66 1.5 67 1.0 68 1.0 69 1.0 70 1.0 71 0.0 72 0.5 73 1.0 74 1.5 75 1.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.94997498749375 99.9 2 0.05002501250625312 0.1 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1375 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.21250000000000002 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.3125 0.0 0.0 0.0 0.0 76-77 0.325 0.0 0.0 0.0 0.0 78-79 0.42500000000000004 0.0 0.0 0.0 0.0 80-81 0.4625 0.0 0.0 0.0 0.0 82-83 0.575 0.0 0.0 0.0 0.0 84-85 0.8 0.0 0.0 0.0 0.0 86-87 0.925 0.0 0.0 0.0 0.0 88-89 1.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTCAAC 15 6.142176E-4 95.0 1 >>END_MODULE Read 826363 spots for ERR1864490.sra Written 826363 spots for ERR1864490.sra Read 826363 spots for ERR1864490.sra Written 826363 spots for ERR1864490.sra Read 826363 spots for ERR1864490.sra Written 826363 spots for ERR1864490.sra Read 826363 spots for ERR1864490.sra Written 826363 spots for ERR1864490.sra Read 826363 spots for ERR1864490.sra Written 826363 spots for ERR1864490.sra Read 826363 spots for ERR1864490.sra Written 826363 spots for ERR1864490.sra Read 826363 spots for ERR1864490.sra Written 826363 spots for ERR1864490.sra Read 826363 spots for ERR1864490.sra Written 826363 spots for ERR1864490.sra Read 826363 spots for ERR1864490.sra Written 826363 spots for ERR1864490.sra Read 826363 spots for ERR1864490.sra Written 826363 spots for ERR1864490.sra Read 826363 spots for ERR1864490.sra Written 826363 spots for ERR1864490.sra Read 826363 spots for ERR1864490.sra Written 826363 spots for ERR1864490.sra Read 826382 spots for ERR1864490.sra Written 826382 spots for ERR1864490.sra Read 826363 spots for ERR1864490.sra Written 826363 spots for ERR1864490.sra Read 826363 spots for ERR1864490.sra Written 826363 spots for ERR1864490.sra Read 826363 spots for ERR1864490.sra Written 826363 spots for ERR1864490.sra Read 826363 spots for ERR1864490.sra Written 826363 spots for ERR1864490.sra Read 826363 spots for ERR1864490.sra Written 826363 spots for ERR1864490.sra Read 826363 spots for ERR1864490.sra Written 826363 spots for ERR1864490.sra Read 826363 spots for ERR1864490.sra Written 826363 spots for ERR1864490.sra SRR ids: ['ERR1864490.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1co9be04 ERR1864490.sra spots: 16527279 blocks: [[1, 826363], [826364, 1652726], [1652727, 2479089], [2479090, 3305452], [3305453, 4131815], [4131816, 4958178], [4958179, 5784541], [5784542, 6610904], [6610905, 7437267], [7437268, 8263630], [8263631, 9089993], [9089994, 9916356], [9916357, 10742719], [10742720, 11569082], [11569083, 12395445], [12395446, 13221808], [13221809, 14048171], [14048172, 14874534], [14874535, 15700897], [15700898, 16527279]] ERR1864490 file size 3964860 ERR1864490 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864490 ERR1864490_1.fastq ERR1864490_2.fastq Input file: ERR1864490_1.fastq Paired file: ERR1864490_2.fastq trimmed: ERR1864490-trimmed-pair1.fastq, ERR1864490-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:26:47 2025 >> started Thu Feb 13 14:27:02 2025 >> done (14.418s) 16527279 read pairs processed; of these: 343302 ( 2.08%) short read pairs filtered out after trimming by size control 460152 ( 2.78%) empty read pairs filtered out after trimming by size control 15723825 (95.14%) read pairs available; of these: 3652971 (23.23%) trimmed read pairs available after processing 12070854 (76.77%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 125 0.00% 19 291 0.00% 20 461 0.00% 21 606 0.00% 22 792 0.01% 23 951 0.01% 24 1196 0.01% 25 1355 0.01% 26 1565 0.01% 27 1794 0.01% 28 2201 0.01% 29 2556 0.02% 30 2791 0.02% 31 3177 0.02% 32 3413 0.02% 33 3827 0.02% 34 4255 0.03% 35 4565 0.03% 36 4908 0.03% 37 5230 0.03% 38 5458 0.03% 39 5814 0.04% 40 6183 0.04% 41 6557 0.04% 42 6873 0.04% 43 7303 0.05% 44 7500 0.05% 45 8005 0.05% 46 8161 0.05% 47 8673 0.06% 48 9117 0.06% 49 9629 0.06% 50 9895 0.06% 51 10453 0.07% 52 11038 0.07% 53 11390 0.07% 54 11826 0.08% 55 12690 0.08% 56 13296 0.08% 57 14194 0.09% 58 15157 0.10% 59 21506 0.14% 60 26480 0.17% 61 26756 0.17% 62 26534 0.17% 63 26935 0.17% 64 27552 0.18% 65 28157 0.18% 66 28673 0.18% 67 29143 0.19% 68 30319 0.19% 69 31324 0.20% 70 32517 0.21% 71 33729 0.21% 72 35557 0.23% 73 36293 0.23% 74 37448 0.24% 75 38146 0.24% 76 38398 0.24% 77 39253 0.25% 78 41266 0.26% 79 43015 0.27% 80 45645 0.29% 81 47699 0.30% 82 50323 0.32% 83 53555 0.34% 84 57097 0.36% 85 60672 0.39% 86 63634 0.40% 87 67152 0.43% 88 68679 0.44% 89 71367 0.45% 90 79455 0.51% 91 88038 0.56% 92 98729 0.63% 93 111460 0.71% 94 124060 0.79% 95 143029 0.91% 96 169719 1.08% 97 207584 1.32% 98 269960 1.72% 99 359239 2.28% 100 491603 3.13% 101 12070854 76.77% 15723825 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=4.63 fanout-score-rank=22 prefix-density=0.27 prefix-fanout=2.6 sequence=TCGTCGTCGTCGCCAGAAGCGCCACTACCAGTTTTAGTTTCCGTGTTACTGTTGCCGTTGTTTGAAGTAGGCGTCTCGGCATCATTAGCTCCAGCGCTTACCTTTCGACCGAGAGATGATGG criterion=fanout-score sequence-density=0.07 sequence-density-rank=19 fanout-score=279.43 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=26.5 sequence=CTTCTTCTTTTT criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=27.88 fanout-score-rank=12 prefix-density=0.27 prefix-fanout=9.9 sequence=GAAGCTGAAACT criterion=fanout-score sequence-density=0.08 sequence-density-rank=9 fanout-score=243.85 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=26.4 sequence=AAGAAGAAGAAA ERR1864490 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:27:39 Started mapping on | Feb 13 14:27:39 Finished on | Feb 13 14:28:12 Mapping speed, Million of reads per hour | 1715.33 Number of input reads | 15723825 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 15053336 Uniquely mapped reads % | 95.74% Average mapped length | 195.19 Number of splices: Total | 8118672 Number of splices: Annotated (sjdb) | 7977183 Number of splices: GT/AG | 8000134 Number of splices: GC/AG | 99226 Number of splices: AT/AC | 8345 Number of splices: Non-canonical | 10967 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 2.30 Insertion rate per base | 0.01% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 312323 % of reads mapped to multiple loci | 1.99% Number of reads mapped to too many loci | 38780 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.01% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 416788 416788 416788 N_multimapping 312323 312323 312323 N_noFeature 527986 14846356 631012 N_ambiguous 160705 886 56185 UnstrandedReadsAssigned:14364645 PositiveStrandReadsAssigned:206094 NegativeStrandReadsAssigned:14366139 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864490 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864490-trimmed-pair1.fastq ERR1864490-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,723,825 reads, 14,522,186 reads pseudoaligned [quant] estimated average fragment length: 160.674 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,202 rounds 52401 ERR1864490.ke.tsv 34699 ERR1864490.se.tsv 87100 total ==> ERR1864490.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1858.33 627 30.751 Potri.005G024800.1.v4.1 1035 875.326 142 14.7854 Potri.004G059700.1.v4.1 961 801.326 6 0.682426 Potri.007G009000.2.v4.1 1416 1256.33 0 0 Potri.003G141000.2.v4.1 2943 2783.33 380.12 12.4472 Potri.016G087400.1.v4.1 270 117.58 641.634 497.355 Potri.015G069301.1.v4.1 564 404.419 0 0 Potri.010G195200.1.v4.1 1773 1613.33 63 3.55903 Potri.012G127500.1.v4.1 977 817.326 145 16.1691 ==> ERR1864490.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2163 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 336 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 ERR1864490 completed mapping pipeline successfully