Starting /dee2/code/volunteer_pipeline.sh ERR1864491 current disk space = 3089901297664 free memory = 1447484548 ERR1864491 SRAfilesize c0e49329522ece2d5c7cba83c8cc26e3 ERR1864491.sra ERR1864491.sra file validated ERR1864491 is paired end ERR1864491 is conventional basespace ERR1864491 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864491_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.1045 33.0 31.0 34.0 28.0 34.0 2 31.49325 34.0 31.0 34.0 28.0 34.0 3 31.7425 34.0 31.0 34.0 28.0 34.0 4 35.22325 37.0 35.0 37.0 33.0 37.0 5 34.83625 37.0 35.0 37.0 32.0 37.0 6 34.80325 37.0 35.0 37.0 32.0 37.0 7 34.69425 37.0 35.0 37.0 32.0 37.0 8 34.69225 37.0 35.0 37.0 32.0 37.0 9 36.356 39.0 37.0 39.0 32.0 39.0 10-11 36.335375 39.0 37.0 39.0 32.0 39.0 12-13 36.112875 39.0 37.0 39.0 32.0 39.0 14-15 37.525999999999996 40.0 38.0 41.0 32.0 41.0 16-17 37.444374999999994 40.0 38.0 41.0 32.0 41.0 18-19 37.43575 40.0 38.0 41.0 32.0 41.0 20-21 37.354124999999996 40.0 38.0 41.0 32.0 41.0 22-23 37.151875000000004 40.0 38.0 41.0 31.5 41.0 24-25 37.14175 40.0 38.0 41.0 31.0 41.0 26-27 36.91075 40.0 37.5 41.0 30.5 41.0 28-29 36.725125 40.0 37.0 41.0 30.0 41.0 30-31 36.553124999999994 40.0 37.0 41.0 30.0 41.0 32-33 36.49075 40.0 37.0 41.0 30.0 41.0 34-35 36.4105 40.0 37.0 41.0 30.0 41.0 36-37 36.42225 40.0 37.0 41.0 30.0 41.0 38-39 36.149625 40.0 36.0 41.0 28.5 41.0 40-41 36.118875 40.0 36.5 41.0 29.0 41.0 42-43 36.095124999999996 40.0 36.0 41.0 28.0 41.0 44-45 35.947 40.0 36.0 41.0 27.5 41.0 46-47 35.789 39.5 36.0 41.0 27.5 41.0 48-49 35.93475 40.0 36.0 41.0 28.0 41.0 50-51 36.0405 40.0 36.0 41.0 28.0 41.0 52-53 35.90475 40.0 36.0 41.0 28.0 41.0 54-55 35.70725 39.5 36.0 41.0 27.0 41.0 56-57 35.52775 39.0 35.0 41.0 27.0 41.0 58-59 35.304249999999996 39.0 35.0 41.0 26.0 41.0 60-61 35.012625 39.0 35.0 41.0 26.0 41.0 62-63 34.725750000000005 38.0 35.0 40.0 25.0 41.0 64-65 34.244125 38.0 34.0 40.0 23.5 41.0 66-67 33.941375 37.0 34.0 40.0 23.0 41.0 68-69 33.607 37.0 33.5 39.5 22.5 41.0 70-71 33.11575 36.0 33.0 39.0 22.0 41.0 72-73 32.62925 36.0 32.5 39.0 19.5 40.0 74-75 32.28275 35.0 32.0 37.5 20.0 39.5 76-77 31.225875000000002 34.5 30.5 36.0 19.5 39.0 78-79 31.53775 35.0 32.0 36.5 19.0 39.0 80-81 31.5075 35.0 32.0 36.0 20.0 37.5 82-83 31.115125 35.0 32.0 36.0 18.0 37.0 84-85 30.774125 35.0 32.0 35.5 14.5 37.0 86-87 30.476374999999997 35.0 31.0 35.0 11.0 36.0 88-89 30.292625 35.0 31.0 35.0 7.0 36.0 90-91 30.036375 34.0 31.0 35.0 4.5 36.0 92-93 29.683 34.0 31.0 35.0 2.0 35.0 94-95 29.3415 34.0 30.0 35.0 2.0 35.0 96-97 29.170875 34.0 30.0 35.0 2.0 35.0 98-99 28.882625 34.0 30.0 35.0 2.0 35.0 100-101 27.781625 33.5 27.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 81.0 3 32.0 4 9.0 5 8.0 6 9.0 7 13.0 8 10.0 9 6.0 10 8.0 11 9.0 12 9.0 13 16.0 14 18.0 15 14.0 16 13.0 17 9.0 18 9.0 19 14.0 20 12.0 21 17.0 22 12.0 23 18.0 24 17.0 25 18.0 26 41.0 27 31.0 28 47.0 29 64.0 30 58.0 31 79.0 32 87.0 33 162.0 34 198.0 35 260.0 36 449.0 37 835.0 38 1137.0 39 171.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.62764062102316 6.261135148892848 4.275897174853652 42.83532705523034 2 26.150000000000002 5.775 32.15 35.925000000000004 3 23.599999999999998 8.225 23.375 44.800000000000004 4 28.1 14.05 20.9 36.95 5 29.775000000000002 19.3 24.625 26.3 6 24.65 24.65 25.15 25.55 7 17.65 22.7 43.275000000000006 16.375 8 17.75 24.6 35.375 22.275 9 18.0 23.425 37.574999999999996 21.0 10-11 20.0375 31.937500000000004 29.15 18.875 12-13 20.6625 26.6125 31.3 21.425 14-15 20.7625 26.6625 31.1 21.475 16-17 20.5375 27.375 29.6625 22.425 18-19 20.6875 28.425 28.525 22.3625 20-21 20.625 28.3625 28.6625 22.35 22-23 21.5375 27.975 28.3625 22.125 24-25 20.525 27.85 28.775000000000002 22.85 26-27 20.875 27.237499999999997 28.787499999999998 23.1 28-29 20.150000000000002 26.8 29.3375 23.7125 30-31 21.0125 28.1 27.725 23.1625 32-33 20.9375 27.462500000000002 28.5625 23.0375 34-35 20.9875 28.325 28.5875 22.1 36-37 20.7 28.549999999999997 28.349999999999998 22.400000000000002 38-39 20.825 27.075 28.175 23.925 40-41 20.3125 28.050000000000004 28.3875 23.25 42-43 20.3625 27.575 28.6125 23.45 44-45 20.3125 28.999999999999996 27.5125 23.175 46-47 20.4875 28.375 27.750000000000004 23.3875 48-49 19.525000000000002 28.849999999999998 28.425 23.200000000000003 50-51 21.099999999999998 27.950000000000003 27.5125 23.4375 52-53 21.1875 28.875 27.725 22.2125 54-55 19.650000000000002 29.025000000000002 28.15 23.175 56-57 19.537499999999998 28.4125 28.8625 23.1875 58-59 20.875 28.0625 28.525 22.537499999999998 60-61 20.7625 27.737499999999997 27.6375 23.8625 62-63 19.225 28.375 28.537499999999998 23.8625 64-65 20.65 28.999999999999996 27.2625 23.0875 66-67 20.1 29.2375 27.775 22.8875 68-69 20.5375 28.1625 28.499999999999996 22.8 70-71 21.125 27.400000000000002 28.262500000000003 23.2125 72-73 20.4 28.1625 28.025 23.4125 74-75 20.349999999999998 28.599999999999998 27.5875 23.4625 76-77 20.6125 27.800000000000004 28.225 23.3625 78-79 20.8875 27.675 28.425 23.0125 80-81 20.525 28.799999999999997 27.287499999999998 23.3875 82-83 19.6875 29.1125 28.075 23.125 84-85 20.9 27.6375 28.349999999999998 23.1125 86-87 20.4875 27.9125 28.0875 23.5125 88-89 20.724999999999998 28.5875 27.3375 23.35 90-91 20.9875 28.95 26.787499999999998 23.275000000000002 92-93 21.224999999999998 27.700000000000003 27.750000000000004 23.325000000000003 94-95 21.025 29.375 26.887499999999996 22.7125 96-97 21.2375 28.4125 27.35 23.0 98-99 20.65 28.575 28.199999999999996 22.575 100-101 21.5 29.8875 26.55 22.0625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 2.5 21 1.5 22 0.5 23 2.0 24 1.5 25 0.5 26 1.5 27 4.5 28 8.5 29 7.5 30 9.5 31 14.5 32 20.0 33 32.5 34 46.0 35 60.5 36 79.0 37 98.0 38 120.0 39 153.0 40 186.0 41 213.5 42 244.5 43 269.0 44 291.0 45 291.5 46 274.5 47 250.0 48 227.5 49 212.5 50 178.0 51 143.5 52 122.5 53 104.5 54 80.5 55 63.5 56 45.0 57 26.5 58 24.0 59 22.0 60 14.5 61 7.0 62 7.0 63 8.5 64 5.0 65 4.5 66 4.0 67 3.0 68 3.0 69 2.0 70 2.5 71 1.5 72 0.5 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26933736457546 98.5 2 0.6802721088435374 1.35 3 0.05039052658100278 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.0875 0.0 0.0 0.0 0.0 56-57 0.1375 0.0 0.0 0.0 0.0 58-59 0.175 0.0 0.0 0.0 0.0 60-61 0.2 0.0 0.0 0.0 0.0 62-63 0.23750000000000002 0.0 0.0 0.0 0.0 64-65 0.275 0.0 0.0 0.0 0.0 66-67 0.375 0.0 0.0 0.0 0.0 68-69 0.4625 0.0 0.0 0.0 0.0 70-71 0.475 0.0 0.0 0.0 0.0 72-73 0.5625 0.0 0.0 0.0 0.0 74-75 0.65 0.0 0.0 0.0 0.0 76-77 0.8999999999999999 0.0 0.0 0.0 0.0 78-79 1.05 0.0 0.0 0.0 0.0 80-81 1.2625 0.0 0.0 0.0 0.0 82-83 1.525 0.0 0.0 0.0 0.0 84-85 1.8875 0.0 0.0 0.0 0.0 86-87 2.2750000000000004 0.0 0.0 0.0 0.0 88-89 2.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864491 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864491_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.28975 33.0 31.0 34.0 28.0 34.0 2 31.30825 34.0 31.0 34.0 27.0 34.0 3 31.47325 34.0 31.0 34.0 28.0 34.0 4 34.75075 37.0 35.0 37.0 32.0 37.0 5 34.856 37.0 35.0 37.0 32.0 37.0 6 34.789 37.0 35.0 37.0 32.0 37.0 7 34.865 37.0 35.0 37.0 32.0 37.0 8 34.696 37.0 35.0 37.0 32.0 37.0 9 36.39075 39.0 37.0 39.0 32.0 39.0 10-11 36.3135 39.0 37.0 39.0 32.0 39.0 12-13 36.300375 39.0 37.0 39.0 32.0 39.0 14-15 37.604875 40.0 38.0 41.0 32.0 41.0 16-17 37.500875 40.0 38.0 41.0 32.0 41.0 18-19 37.443375 40.0 38.0 41.0 31.5 41.0 20-21 37.414625 40.0 38.0 41.0 32.0 41.0 22-23 37.259125 40.0 38.0 41.0 31.0 41.0 24-25 37.197375 40.0 38.0 41.0 31.0 41.0 26-27 36.947874999999996 40.0 38.0 41.0 30.5 41.0 28-29 36.945125 40.0 37.5 41.0 30.5 41.0 30-31 36.772875 40.0 37.0 41.0 30.0 41.0 32-33 36.51925 40.0 37.0 41.0 30.0 41.0 34-35 36.42937499999999 40.0 37.0 41.0 29.0 41.0 36-37 36.1285 40.0 36.5 41.0 28.0 41.0 38-39 36.046125 40.0 36.0 41.0 27.0 41.0 40-41 35.966499999999996 39.5 36.0 41.0 27.0 41.0 42-43 35.665125 39.0 35.5 41.0 26.5 41.0 44-45 35.50875 39.0 35.0 41.0 25.5 41.0 46-47 35.73325 39.0 35.5 41.0 26.5 41.0 48-49 35.525875 39.0 35.5 41.0 26.0 41.0 50-51 34.6375 38.5 34.0 40.0 25.0 40.5 52-53 34.61725 38.5 34.5 39.5 24.5 40.5 54-55 35.686 39.5 36.0 41.0 27.0 41.0 56-57 35.487125 39.0 35.0 41.0 26.0 41.0 58-59 35.465625 39.0 35.0 41.0 26.5 41.0 60-61 35.26375 39.0 35.0 41.0 26.0 41.0 62-63 35.067875 39.0 35.0 41.0 26.0 41.0 64-65 34.661 38.0 34.5 40.0 25.5 41.0 66-67 34.229 37.5 34.0 40.0 25.0 41.0 68-69 33.85325 37.0 34.0 39.5 23.5 41.0 70-71 33.422875000000005 36.5 33.5 39.0 22.5 41.0 72-73 32.955625 36.0 33.0 39.0 22.0 40.0 74-75 32.38475 35.0 32.5 37.5 20.5 39.5 76-77 31.992625 35.0 32.0 37.0 20.0 39.0 78-79 31.590625 35.0 32.0 36.5 19.5 39.0 80-81 31.284875 35.0 32.0 36.0 18.5 37.5 82-83 30.810375 35.0 31.0 36.0 15.0 37.0 84-85 30.371375 35.0 31.0 35.0 8.5 36.5 86-87 30.216500000000003 34.5 31.0 35.0 7.0 36.0 88-89 29.862499999999997 34.0 31.0 35.0 4.5 36.0 90-91 29.619 34.0 31.0 35.0 2.0 35.5 92-93 29.301875 34.0 30.0 35.0 2.0 35.0 94-95 29.007125000000002 34.0 30.0 35.0 2.0 35.0 96-97 28.630499999999998 34.0 29.5 35.0 2.0 35.0 98-99 28.155375 34.0 29.0 35.0 2.0 35.0 100-101 27.140375 33.5 27.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 66.0 3 14.0 4 10.0 5 8.0 6 12.0 7 10.0 8 17.0 9 11.0 10 9.0 11 15.0 12 17.0 13 18.0 14 9.0 15 14.0 16 10.0 17 15.0 18 12.0 19 14.0 20 18.0 21 24.0 22 23.0 23 19.0 24 30.0 25 25.0 26 39.0 27 34.0 28 48.0 29 49.0 30 75.0 31 82.0 32 99.0 33 157.0 34 200.0 35 259.0 36 430.0 37 934.0 38 1031.0 39 143.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.574999999999996 23.3 11.35 33.775 2 25.35 25.324999999999996 33.275 16.05 3 19.425 26.900000000000002 33.650000000000006 20.025000000000002 4 21.675 31.674999999999997 25.724999999999998 20.925 5 24.6 35.699999999999996 23.425 16.275000000000002 6 19.950000000000003 38.824999999999996 23.025000000000002 18.2 7 20.575 23.0 38.550000000000004 17.875 8 21.375 26.0 30.349999999999998 22.275 9 22.525000000000002 24.2 31.8 21.475 10-11 22.675 31.8125 25.724999999999998 19.787499999999998 12-13 23.65 25.687500000000004 28.625 22.037499999999998 14-15 22.650000000000002 28.4375 28.262500000000003 20.65 16-17 23.625 27.575 27.800000000000004 21.0 18-19 23.7 28.537499999999998 27.625 20.1375 20-21 22.525000000000002 28.6375 29.125 19.7125 22-23 23.3375 28.037499999999998 27.712500000000002 20.9125 24-25 23.225 28.725 27.9375 20.1125 26-27 22.8625 28.15 28.375 20.6125 28-29 22.575 29.025000000000002 28.1125 20.2875 30-31 22.5 28.9125 27.462500000000002 21.125 32-33 23.1 28.15 28.487499999999997 20.2625 34-35 22.525000000000002 27.8125 28.775000000000002 20.8875 36-37 23.3 27.962500000000002 27.925 20.8125 38-39 22.900000000000002 28.5875 27.3 21.212500000000002 40-41 23.375 28.525 27.925 20.175 42-43 22.5 28.5875 28.15 20.7625 44-45 23.6875 26.4625 28.7375 21.1125 46-47 23.1625 27.8375 28.1375 20.8625 48-49 22.412499999999998 28.512500000000003 27.575 21.5 50-51 22.6 28.825 27.825 20.75 52-53 22.6875 28.3125 27.825 21.175 54-55 23.0875 28.1625 28.0875 20.6625 56-57 22.662499999999998 28.3625 27.737499999999997 21.2375 58-59 22.75 28.3125 27.8875 21.05 60-61 22.425 28.812500000000004 28.512500000000003 20.25 62-63 21.475 28.962500000000002 28.262500000000003 21.3 64-65 24.4375 27.6125 28.012500000000003 19.9375 66-67 23.9 27.85 27.9125 20.3375 68-69 23.45 29.049999999999997 27.1 20.4 70-71 23.05 27.925 28.5875 20.4375 72-73 23.2625 27.55 28.675 20.5125 74-75 23.525 28.512500000000003 27.787499999999998 20.175 76-77 24.0 27.975 27.925 20.1 78-79 23.5375 28.9375 27.075 20.45 80-81 23.45 29.1625 27.0 20.3875 82-83 23.962500000000002 29.912499999999998 26.275 19.85 84-85 24.0 27.925 28.075 20.0 86-87 23.025000000000002 28.425 27.5875 20.962500000000002 88-89 24.3125 27.8625 27.450000000000003 20.375 90-91 24.1625 28.050000000000004 27.0125 20.775 92-93 23.45 29.549999999999997 27.025 19.975 94-95 24.2375 28.1 26.387500000000003 21.275 96-97 24.2875 28.262500000000003 27.037499999999998 20.4125 98-99 23.974999999999998 29.9 25.724999999999998 20.4 100-101 25.275 28.000000000000004 26.325 20.4 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 1.5 19 2.0 20 1.5 21 1.0 22 1.0 23 1.0 24 0.5 25 3.0 26 5.0 27 5.5 28 9.0 29 17.0 30 21.5 31 17.5 32 27.0 33 43.5 34 51.5 35 68.5 36 85.5 37 107.5 38 130.5 39 175.5 40 218.5 41 248.5 42 265.5 43 259.0 44 272.0 45 294.0 46 270.5 47 230.0 48 216.0 49 197.5 50 169.0 51 136.5 52 102.0 53 83.5 54 67.0 55 45.5 56 34.0 57 23.0 58 18.0 59 13.5 60 10.0 61 6.0 62 6.0 63 7.5 64 5.5 65 3.0 66 2.5 67 2.0 68 2.0 69 2.5 70 1.5 71 1.5 72 2.0 73 1.5 74 1.0 75 0.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.0875 0.0 0.0 0.0 0.0 56-57 0.1375 0.0 0.0 0.0 0.0 58-59 0.175 0.0 0.0 0.0 0.0 60-61 0.2 0.0 0.0 0.0 0.0 62-63 0.23750000000000002 0.0 0.0 0.0 0.0 64-65 0.275 0.0 0.0 0.0 0.0 66-67 0.375 0.0 0.0 0.0 0.0 68-69 0.4625 0.0 0.0 0.0 0.0 70-71 0.475 0.0 0.0 0.0 0.0 72-73 0.5625 0.0 0.0 0.0 0.0 74-75 0.675 0.0 0.0 0.0 0.0 76-77 0.925 0.0 0.0 0.0 0.0 78-79 1.075 0.0 0.0 0.0 0.0 80-81 1.2875 0.0 0.0 0.0 0.0 82-83 1.5625 0.0 0.0 0.0 0.0 84-85 1.975 0.0 0.0 0.0 0.0 86-87 2.3499999999999996 0.0 0.0 0.0 0.0 88-89 2.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 800045 spots for ERR1864491.sra Written 800045 spots for ERR1864491.sra Read 800045 spots for ERR1864491.sra Written 800045 spots for ERR1864491.sra Read 800045 spots for ERR1864491.sra Written 800045 spots for ERR1864491.sra Read 800045 spots for ERR1864491.sra Written 800045 spots for ERR1864491.sra Read 800045 spots for ERR1864491.sra Written 800045 spots for ERR1864491.sra Read 800045 spots for ERR1864491.sra Written 800045 spots for ERR1864491.sra Read 800045 spots for ERR1864491.sra Written 800045 spots for ERR1864491.sra Read 800045 spots for ERR1864491.sra Written 800045 spots for ERR1864491.sra Read 800045 spots for ERR1864491.sra Written 800045 spots for ERR1864491.sra Read 800045 spots for ERR1864491.sra Written 800045 spots for ERR1864491.sra Read 800045 spots for ERR1864491.sra Written 800045 spots for ERR1864491.sra Read 800045 spots for ERR1864491.sra Written 800045 spots for ERR1864491.sra Read 800045 spots for ERR1864491.sra Written 800045 spots for ERR1864491.sra Read 800045 spots for ERR1864491.sra Written 800045 spots for ERR1864491.sra Read 800045 spots for ERR1864491.sra Written 800045 spots for ERR1864491.sra Read 800045 spots for ERR1864491.sra Written 800045 spots for ERR1864491.sra Read 800045 spots for ERR1864491.sra Written 800045 spots for ERR1864491.sra Read 800047 spots for ERR1864491.sra Written 800047 spots for ERR1864491.sra Read 800045 spots for ERR1864491.sra Written 800045 spots for ERR1864491.sra Read 800045 spots for ERR1864491.sra Written 800045 spots for ERR1864491.sra SRR ids: ['ERR1864491.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yxtv9rpt ERR1864491.sra spots: 16000902 blocks: [[1, 800045], [800046, 1600090], [1600091, 2400135], [2400136, 3200180], [3200181, 4000225], [4000226, 4800270], [4800271, 5600315], [5600316, 6400360], [6400361, 7200405], [7200406, 8000450], [8000451, 8800495], [8800496, 9600540], [9600541, 10400585], [10400586, 11200630], [11200631, 12000675], [12000676, 12800720], [12800721, 13600765], [13600766, 14400810], [14400811, 15200855], [15200856, 16000902]] ERR1864491 file size 3837892 ERR1864491 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864491 ERR1864491_1.fastq ERR1864491_2.fastq Input file: ERR1864491_1.fastq Paired file: ERR1864491_2.fastq trimmed: ERR1864491-trimmed-pair1.fastq, ERR1864491-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:24:53 2025 >> started Thu Feb 13 14:25:07 2025 >> done (14.439s) 16000902 read pairs processed; of these: 335609 ( 2.10%) short read pairs filtered out after trimming by size control 472301 ( 2.95%) empty read pairs filtered out after trimming by size control 15192992 (94.95%) read pairs available; of these: 3862320 (25.42%) trimmed read pairs available after processing 11330672 (74.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 116 0.00% 19 264 0.00% 20 482 0.00% 21 630 0.00% 22 741 0.00% 23 923 0.01% 24 1085 0.01% 25 1422 0.01% 26 1555 0.01% 27 1758 0.01% 28 2123 0.01% 29 2299 0.02% 30 2582 0.02% 31 3050 0.02% 32 3379 0.02% 33 3713 0.02% 34 4071 0.03% 35 4233 0.03% 36 4788 0.03% 37 5005 0.03% 38 5384 0.04% 39 5711 0.04% 40 5989 0.04% 41 6309 0.04% 42 6678 0.04% 43 6919 0.05% 44 7350 0.05% 45 7810 0.05% 46 8126 0.05% 47 8720 0.06% 48 9128 0.06% 49 9241 0.06% 50 9827 0.06% 51 10268 0.07% 52 10952 0.07% 53 11567 0.08% 54 12062 0.08% 55 12721 0.08% 56 13393 0.09% 57 14372 0.09% 58 15348 0.10% 59 20744 0.14% 60 25470 0.17% 61 25821 0.17% 62 26073 0.17% 63 26766 0.18% 64 27623 0.18% 65 28338 0.19% 66 29190 0.19% 67 30078 0.20% 68 31087 0.20% 69 32854 0.22% 70 33618 0.22% 71 34751 0.23% 72 36744 0.24% 73 38314 0.25% 74 40148 0.26% 75 41218 0.27% 76 41915 0.28% 77 43120 0.28% 78 45734 0.30% 79 47637 0.31% 80 50560 0.33% 81 52711 0.35% 82 56155 0.37% 83 60123 0.40% 84 64069 0.42% 85 69474 0.46% 86 73963 0.49% 87 78723 0.52% 88 79631 0.52% 89 83405 0.55% 90 92040 0.61% 91 100172 0.66% 92 111064 0.73% 93 124446 0.82% 94 138226 0.91% 95 157163 1.03% 96 183429 1.21% 97 220087 1.45% 98 278773 1.83% 99 359367 2.37% 100 479402 3.16% 101 11330672 74.58% 15192992 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=33 prefix-density=0.15 prefix-fanout=2.4 sequence=CTTGTCAGCATC criterion=fanout-score sequence-density=0.07 sequence-density-rank=20 fanout-score=306.14 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=28.0 sequence=CTTCTTCTTCTTTT criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=4.44 fanout-score-rank=25 prefix-density=0.11 prefix-fanout=4.0 sequence=GGAAAGACCATC criterion=fanout-score sequence-density=0.07 sequence-density-rank=19 fanout-score=295.46 fanout-score-rank=1 prefix-density=0.74 prefix-fanout=26.3 sequence=AAGAAGAAGAAG ERR1864491 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:25:40 Started mapping on | Feb 13 14:25:41 Finished on | Feb 13 14:26:15 Mapping speed, Million of reads per hour | 1608.67 Number of input reads | 15192992 Average input read length | 194 UNIQUE READS: Uniquely mapped reads number | 14704237 Uniquely mapped reads % | 96.78% Average mapped length | 194.69 Number of splices: Total | 8081057 Number of splices: Annotated (sjdb) | 7942285 Number of splices: GT/AG | 7963945 Number of splices: GC/AG | 98507 Number of splices: AT/AC | 8401 Number of splices: Non-canonical | 10204 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 2.26 Insertion rate per base | 0.01% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 293807 % of reads mapped to multiple loci | 1.93% Number of reads mapped to too many loci | 59063 % of reads mapped to too many loci | 0.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.86% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 241159 241159 241159 N_multimapping 293807 293807 293807 N_noFeature 488943 14544835 548929 N_ambiguous 155711 681 55900 UnstrandedReadsAssigned:14059583 PositiveStrandReadsAssigned:158721 NegativeStrandReadsAssigned:14099408 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864491 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864491-trimmed-pair1.fastq ERR1864491-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,192,992 reads, 14,252,309 reads pseudoaligned [quant] estimated average fragment length: 148.997 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,046 rounds 52401 ERR1864491.ke.tsv 34699 ERR1864491.se.tsv 87100 total ==> ERR1864491.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1870 686 34.9789 Potri.005G024800.1.v4.1 1035 887.003 132 14.1897 Potri.004G059700.1.v4.1 961 813.009 7 0.820968 Potri.007G009000.2.v4.1 1416 1268 0 0 Potri.003G141000.2.v4.1 2943 2795 294 10.0297 Potri.016G087400.1.v4.1 270 127.354 896.672 671.345 Potri.015G069301.1.v4.1 564 416.097 0 0 Potri.010G195200.1.v4.1 1773 1625 85 4.98756 Potri.012G127500.1.v4.1 977 829.003 322 37.0359 ==> ERR1864491.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2129 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 331 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 ERR1864491 completed mapping pipeline successfully