Starting /dee2/code/volunteer_pipeline.sh ERR4131602 current disk space = 3051732967424 free memory = 1571364524 ERR4131602 SRAfilesize 7491ed4411298bfca28d8ac409f4f046 ERR4131602.sra ERR4131602.sra file validated ERR4131602 is single end ERR4131602 is conventional basespace ERR4131602 read1 length is 39-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR4131602_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 39-76 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.7105 32.0 32.0 32.0 32.0 32.0 2 31.66475 32.0 32.0 32.0 32.0 32.0 3 31.706 32.0 32.0 32.0 32.0 32.0 4 31.734 32.0 32.0 32.0 32.0 32.0 5 31.7485 32.0 32.0 32.0 32.0 32.0 6 35.065 36.0 36.0 36.0 36.0 36.0 7 35.49425 36.0 36.0 36.0 36.0 36.0 8 35.48075 36.0 36.0 36.0 36.0 36.0 9 35.493 36.0 36.0 36.0 36.0 36.0 10-11 35.373000000000005 36.0 36.0 36.0 36.0 36.0 12-13 35.437375 36.0 36.0 36.0 36.0 36.0 14-15 35.434125 36.0 36.0 36.0 36.0 36.0 16-17 35.397125 36.0 36.0 36.0 36.0 36.0 18-19 35.33175 36.0 36.0 36.0 36.0 36.0 20-21 35.328125 36.0 36.0 36.0 36.0 36.0 22-23 35.3305 36.0 36.0 36.0 36.0 36.0 24-25 35.3595 36.0 36.0 36.0 36.0 36.0 26-27 35.257000000000005 36.0 36.0 36.0 36.0 36.0 28-29 35.169 36.0 36.0 36.0 36.0 36.0 30-31 35.115625 36.0 36.0 36.0 36.0 36.0 32-33 35.064875 36.0 36.0 36.0 36.0 36.0 34-35 35.100750000000005 36.0 36.0 36.0 36.0 36.0 36-37 35.087875 36.0 36.0 36.0 36.0 36.0 38-39 35.128625 36.0 36.0 36.0 36.0 36.0 40-41 34.97011752938235 36.0 36.0 36.0 36.0 36.0 42-43 35.081270317579396 36.0 36.0 36.0 36.0 36.0 44-45 35.05601400350088 36.0 36.0 36.0 36.0 36.0 46-47 35.014128532133036 36.0 36.0 36.0 36.0 36.0 48-49 35.03688422105526 36.0 36.0 36.0 36.0 36.0 50-51 34.965366341585394 36.0 36.0 36.0 36.0 36.0 52-53 34.86918459229615 36.0 36.0 36.0 36.0 36.0 54-55 34.800900450225114 36.0 36.0 36.0 36.0 36.0 56-57 34.94134567283642 36.0 36.0 36.0 36.0 36.0 58-59 34.755316487365526 36.0 36.0 36.0 34.0 36.0 60-61 34.738145857891915 36.0 36.0 36.0 32.0 36.0 62-63 34.75450676014022 36.0 36.0 36.0 32.0 36.0 64-65 34.716449674511765 36.0 36.0 36.0 32.0 36.0 66-67 34.716629100926625 36.0 36.0 36.0 32.0 36.0 68-69 34.807636811313586 36.0 36.0 36.0 32.0 36.0 70-71 34.48446708533638 36.0 36.0 36.0 32.0 36.0 72-73 34.383809018557535 36.0 36.0 36.0 32.0 36.0 74-75 34.21761387070468 36.0 36.0 36.0 32.0 36.0 76 33.39837083010085 36.0 32.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 4.0 22 1.0 23 4.0 24 6.0 25 8.0 26 17.0 27 23.0 28 33.0 29 54.0 30 72.0 31 91.0 32 115.0 33 192.0 34 427.0 35 2953.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.85 13.350000000000001 14.924999999999999 32.875 2 26.375 23.125 26.924999999999997 23.575 3 24.25 28.175 22.275 25.3 4 27.375 35.275 17.5 19.85 5 26.450000000000003 35.199999999999996 20.349999999999998 18.0 6 19.05122382033813 37.421145596770124 24.35023971738582 19.17739086550593 7 18.3 19.275000000000002 41.15 21.275 8 20.625 22.5 28.9 27.975 9 21.75 21.25 31.4 25.6 10-11 24.087500000000002 31.874999999999996 21.8625 22.175 12-13 22.025 26.625 28.050000000000004 23.3 14-15 23.025000000000002 26.575 27.8625 22.537499999999998 16-17 23.45 27.500000000000004 26.075 22.975 18-19 23.5375 25.974999999999998 26.625 23.8625 20-21 23.0625 27.987499999999997 27.1375 21.8125 22-23 22.5125 28.4 26.325 22.7625 24-25 22.5125 28.262500000000003 26.2875 22.9375 26-27 22.35 27.975 25.2125 24.462500000000002 28-29 23.525 27.9375 25.35 23.1875 30-31 22.665333166645834 26.978372296537067 27.065883235404424 23.29041130141268 32-33 22.330582645661416 27.719429857464366 26.819204801200303 23.13078269567392 34-35 23.19039879984998 26.790848856107015 26.778347293411674 23.24040505063133 36-37 22.537499999999998 27.775 26.974999999999998 22.7125 38-39 23.6125 26.637499999999996 26.224999999999998 23.525 40-41 23.568392098024507 26.894223555888974 26.6816704176044 22.85571392848212 42-43 23.055763940985248 26.556639159789945 26.544136034008503 23.843460865216304 44-45 21.792948237059264 27.68192048012003 26.981745436359088 23.543385846461614 46-47 23.168292073018254 27.056764191047762 26.16904226056514 23.605901475368842 48-49 22.930732683170792 27.631907976994246 26.069017254313575 23.36834208552138 50-51 22.543135783945985 26.319079769942487 28.119529882470616 23.018254563640912 52-53 23.68980612883052 25.403377110694187 27.21701063164478 23.68980612883052 54-55 22.792094070552913 26.945208906680012 26.10708031023267 24.1556167125344 56-57 21.898449224612307 27.56378189094547 27.388694347173587 23.149074537268636 58-59 22.504378283712782 26.619964973730298 27.77082812109082 23.1048286214661 60-61 23.445514825472287 26.323032653571875 26.648317277617917 23.58313524333792 62-63 22.44616925388082 26.677516274411616 27.265898848272407 23.610415623435152 64-65 23.335002503755632 26.70255383074612 27.516274411617424 22.44616925388082 66-67 23.42849987478087 27.773603806661658 27.18507387928876 21.61282243926872 68-69 23.055729492799 28.290544771446463 24.608641202254226 24.04508453350031 70-71 22.165142212755292 27.16451572484651 27.189575241197844 23.480766821200348 72-73 23.245558775355928 26.697744739826128 26.823736928310442 23.232959556507495 74-75 23.539680408218075 23.606821538874716 28.561836981334764 24.291661071572445 76 24.282389449185416 0.0 39.9922420480993 35.725368502715284 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 1.0 19 2.5 20 3.0 21 2.0 22 2.5 23 2.5 24 4.0 25 9.0 26 10.0 27 7.0 28 7.0 29 11.5 30 18.0 31 29.5 32 40.5 33 46.0 34 63.5 35 82.0 36 98.0 37 113.5 38 134.5 39 168.0 40 194.0 41 237.0 42 264.5 43 269.0 44 303.0 45 322.5 46 324.5 47 322.5 48 297.0 49 257.0 50 228.0 51 209.5 52 176.5 53 141.0 54 116.5 55 110.5 56 116.0 57 98.5 58 76.0 59 70.0 60 60.5 61 46.0 62 33.5 63 26.5 64 17.0 65 16.0 66 18.5 67 14.0 68 10.0 69 6.5 70 6.5 71 7.0 72 6.5 73 10.0 74 9.5 75 5.5 76 4.0 77 2.5 78 1.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.9249999999999999 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0125 32-33 0.025 34-35 0.0125 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.01250625312656328 54-55 0.02501250625312656 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 39 1.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 1.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 1.0 58 0.0 59 0.0 60 1.0 61 2.0 62 0.0 63 0.0 64 0.0 65 1.0 66 0.0 67 0.0 68 1.0 69 0.0 70 3.0 71 9.0 72 23.0 73 92.0 74 283.0 75 1004.0 76 2578.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.13771240172457 97.725 2 0.6593963986812071 1.3 3 0.1521683996956632 0.44999999999999996 4 0.025361399949277198 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025361399949277198 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTACTCGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA 17 0.42500000000000004 TruSeq Adapter, Index 27 (97% over 39bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1356658 READS because READLEN < 1 Read 1356658 spots for ERR4131602.sra Written 1356658 spots for ERR4131602.sra Rejected 1356658 READS because READLEN < 1 Read 1356658 spots for ERR4131602.sra Written 1356658 spots for ERR4131602.sra Rejected 1356658 READS because READLEN < 1 Read 1356658 spots for ERR4131602.sra Written 1356658 spots for ERR4131602.sra Rejected 1356658 READS because READLEN < 1 Read 1356658 spots for ERR4131602.sra Written 1356658 spots for ERR4131602.sra Rejected 1356658 READS because READLEN < 1 Read 1356658 spots for ERR4131602.sra Written 1356658 spots for ERR4131602.sra Rejected 1356658 READS because READLEN < 1 Read 1356658 spots for ERR4131602.sra Written 1356658 spots for ERR4131602.sra Rejected 1356658 READS because READLEN < 1 Read 1356658 spots for ERR4131602.sra Written 1356658 spots for ERR4131602.sra Rejected 1356658 READS because READLEN < 1 Read 1356658 spots for ERR4131602.sra Written 1356658 spots for ERR4131602.sra Rejected 1356658 READS because READLEN < 1 Read 1356658 spots for ERR4131602.sra Written 1356658 spots for ERR4131602.sra Rejected 1356658 READS because READLEN < 1 Read 1356658 spots for ERR4131602.sra Written 1356658 spots for ERR4131602.sra Rejected 1356661 READS because READLEN < 1 Read 1356661 spots for ERR4131602.sra Written 1356661 spots for ERR4131602.sra Rejected 1356658 READS because READLEN < 1 Read 1356658 spots for ERR4131602.sra Written 1356658 spots for ERR4131602.sra Rejected 1356658 READS because READLEN < 1 Read 1356658 spots for ERR4131602.sra Written 1356658 spots for ERR4131602.sra Rejected 1356658 READS because READLEN < 1 Read 1356658 spots for ERR4131602.sra Written 1356658 spots for ERR4131602.sra Rejected 1356658 READS because READLEN < 1 Read 1356658 spots for ERR4131602.sra Written 1356658 spots for ERR4131602.sra Rejected 1356658 READS because READLEN < 1 Read 1356658 spots for ERR4131602.sra Written 1356658 spots for ERR4131602.sra Rejected 1356658 READS because READLEN < 1 Read 1356658 spots for ERR4131602.sra Written 1356658 spots for ERR4131602.sra Rejected 1356658 READS because READLEN < 1 Read 1356658 spots for ERR4131602.sra Written 1356658 spots for ERR4131602.sra Rejected 1356658 READS because READLEN < 1 Read 1356658 spots for ERR4131602.sra Written 1356658 spots for ERR4131602.sra Rejected 1356658 READS because READLEN < 1 Read 1356658 spots for ERR4131602.sra Written 1356658 spots for ERR4131602.sra SRR ids: ['ERR4131602.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3wtkmj_5 ERR4131602.sra spots: 27133163 blocks: [[1, 1356658], [1356659, 2713316], [2713317, 4069974], [4069975, 5426632], [5426633, 6783290], [6783291, 8139948], [8139949, 9496606], [9496607, 10853264], [10853265, 12209922], [12209923, 13566580], [13566581, 14923238], [14923239, 16279896], [16279897, 17636554], [17636555, 18993212], [18993213, 20349870], [20349871, 21706528], [21706529, 23063186], [23063187, 24419844], [24419845, 25776502], [25776503, 27133163]] ERR4131602 file size 5142084 ERR4131602 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR4131602 ERR4131602_1.fastq Input file: ERR4131602_1.fastq trimmed: ERR4131602-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 15:16:21 2025 >> started Wed Feb 12 15:16:33 2025 >> done (12.220s) 27133163 reads processed; of these: 226 ( 0.00%) short reads filtered out after trimming by size control 155279 ( 0.57%) empty reads filtered out after trimming by size control 26977658 (99.43%) reads available; of these: 3193 ( 0.01%) trimmed reads available after processing 26974465 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 4 0.00% 21 3 0.00% 22 14 0.00% 23 22 0.00% 24 28 0.00% 25 46 0.00% 26 50 0.00% 27 46 0.00% 28 56 0.00% 29 69 0.00% 30 75 0.00% 31 67 0.00% 32 90 0.00% 33 65 0.00% 34 89 0.00% 35 831 0.00% 36 872 0.00% 37 826 0.00% 38 983 0.00% 39 991 0.00% 40 1089 0.00% 41 1148 0.00% 42 1138 0.00% 43 1173 0.00% 44 1141 0.00% 45 1198 0.00% 46 1430 0.01% 47 1330 0.00% 48 1514 0.01% 49 1523 0.01% 50 1628 0.01% 51 1915 0.01% 52 2008 0.01% 53 2169 0.01% 54 2417 0.01% 55 2596 0.01% 56 2832 0.01% 57 2955 0.01% 58 3245 0.01% 59 3516 0.01% 60 3933 0.01% 61 4260 0.02% 62 4729 0.02% 63 5531 0.02% 64 5799 0.02% 65 6965 0.03% 66 8378 0.03% 67 7873 0.03% 68 9572 0.04% 69 10403 0.04% 70 14510 0.05% 71 41758 0.15% 72 151677 0.56% 73 550662 2.04% 74 1852226 6.87% 75 6648451 24.64% 76 17607734 65.27% 26977658 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=33 prefix-density=0.20 prefix-fanout=1.9 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=40.08 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=2.1 sequence=GGGAGCAGCTCGAGCAGTCCACCGACAGCCGACGGGTTCGGGACTGGGACCCCCGAGCCCAGCCCTCAGAGCCAATCCTTTTCCCGAGGTTACGGATCCATTTTGCCGACTTCCCTTGCCTACATTGTTCCATCGACCAGAGGCTGTTCACCTTGGAGACCTGATGCGGTTATGAGTACGACCGGGCGTGGGAGGCACTCGGTCCTCCGGATTTTCAAGGGCCGCCGGGGGCGCACCGGACACCACGCGACGTGCGGTGCTCTTCCAGCCGCTGGACCCTACCTCCGACTAAGTCGTTTCCAGGGTGGGCGGGCTGTTAAACAGAAAAGATAACTCTTCCCGAGGCCCCCGCCGACGTCTCCGGACTCCCTAACGTTGCCGTCAGCCGCCACGTCCCGGTTCAGGAATTTTAACCCGATTCCCTTTCGAAGCTCGCGCGCGAACGCGCTGTCGGACGGGCTTCCCCCGTCTCTTAGGATCGACTAACCCATGTGCAAGTGCCGTTCACATG Started job on | Feb 12 15:16:48 Started mapping on | Feb 12 15:16:48 Finished on | Feb 12 15:17:19 Mapping speed, Million of reads per hour | 3132.89 Number of input reads | 26977658 Average input read length | 75 UNIQUE READS: Uniquely mapped reads number | 22254533 Uniquely mapped reads % | 82.49% Average mapped length | 75.12 Number of splices: Total | 4830307 Number of splices: Annotated (sjdb) | 4762590 Number of splices: GT/AG | 4729103 Number of splices: GC/AG | 80212 Number of splices: AT/AC | 6760 Number of splices: Non-canonical | 14232 Mismatch rate per base, % | 0.48% Deletion rate per base | 0.02% Deletion average length | 1.88 Insertion rate per base | 0.01% Insertion average length | 1.70 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1615871 % of reads mapped to multiple loci | 5.99% Number of reads mapped to too many loci | 2690151 % of reads mapped to too many loci | 9.97% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.54% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3107254 3107254 3107254 N_multimapping 1615871 1615871 1615871 N_noFeature 1364962 11705701 11768676 N_ambiguous 227449 41904 40617 UnstrandedReadsAssigned:20662122 PositiveStrandReadsAssigned:10506928 NegativeStrandReadsAssigned:10445240 Dataset is classified unstranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 ERR4131602 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: ERR4131602-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,977,658 reads, 24,083,741 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,108 rounds 52401 ERR4131602.ke.tsv 34699 ERR4131602.se.tsv 87100 total ==> ERR4131602.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 499 13.0471 Potri.005G024800.1.v4.1 1035 936 50 2.6803 Potri.004G059700.1.v4.1 961 862 29 1.68803 Potri.007G009000.2.v4.1 1416 1317 1 0.0380981 Potri.003G141000.2.v4.1 2943 2844 412.042 7.26944 Potri.016G087400.1.v4.1 270 171 532.668 156.296 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 11 0.329705 Potri.012G127500.1.v4.1 977 878 1150 65.7192 ==> ERR4131602.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 24 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 204 Potri.001G212900.v4.1 1993 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 19 Potri.001G452600.v4.1 0 ERR4131602 completed mapping pipeline successfully