Starting /dee2/code/volunteer_pipeline.sh ERR4131603 current disk space = 3051674386432 free memory = 1583346952 ERR4131603 SRAfilesize 490c47db81257f1e484963fe68798e92 ERR4131603.sra ERR4131603.sra file validated ERR4131603 is single end ERR4131603 is conventional basespace ERR4131603 read1 length is 47-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR4131603_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 47-76 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.673 32.0 32.0 32.0 32.0 32.0 2 31.66825 32.0 32.0 32.0 32.0 32.0 3 31.705 32.0 32.0 32.0 32.0 32.0 4 31.7225 32.0 32.0 32.0 32.0 32.0 5 31.7285 32.0 32.0 32.0 32.0 32.0 6 35.1305 36.0 36.0 36.0 36.0 36.0 7 35.5275 36.0 36.0 36.0 36.0 36.0 8 35.3755 36.0 36.0 36.0 36.0 36.0 9 35.3915 36.0 36.0 36.0 36.0 36.0 10-11 35.463375 36.0 36.0 36.0 36.0 36.0 12-13 35.487125 36.0 36.0 36.0 36.0 36.0 14-15 35.418875 36.0 36.0 36.0 36.0 36.0 16-17 35.399625 36.0 36.0 36.0 36.0 36.0 18-19 35.423625 36.0 36.0 36.0 36.0 36.0 20-21 35.370375 36.0 36.0 36.0 36.0 36.0 22-23 35.39175 36.0 36.0 36.0 36.0 36.0 24-25 35.35575 36.0 36.0 36.0 36.0 36.0 26-27 35.276375 36.0 36.0 36.0 36.0 36.0 28-29 35.307249999999996 36.0 36.0 36.0 36.0 36.0 30-31 35.198875 36.0 36.0 36.0 36.0 36.0 32-33 35.161874999999995 36.0 36.0 36.0 36.0 36.0 34-35 35.1125 36.0 36.0 36.0 36.0 36.0 36-37 35.180125000000004 36.0 36.0 36.0 36.0 36.0 38-39 35.15675 36.0 36.0 36.0 36.0 36.0 40-41 35.1445 36.0 36.0 36.0 36.0 36.0 42-43 35.144625000000005 36.0 36.0 36.0 36.0 36.0 44-45 35.1515 36.0 36.0 36.0 36.0 36.0 46-47 35.08925 36.0 36.0 36.0 36.0 36.0 48-49 35.187046761690425 36.0 36.0 36.0 36.0 36.0 50-51 34.972730047785966 36.0 36.0 36.0 36.0 36.0 52-53 34.91103603603604 36.0 36.0 36.0 36.0 36.0 54-55 34.884009009009006 36.0 36.0 36.0 36.0 36.0 56-57 34.90185277916875 36.0 36.0 36.0 36.0 36.0 58-59 34.778167250876315 36.0 36.0 36.0 34.0 36.0 60-61 34.79969954932399 36.0 36.0 36.0 32.0 36.0 62-63 34.81793137991485 36.0 36.0 36.0 32.0 36.0 64-65 34.83224755700326 36.0 36.0 36.0 34.0 36.0 66-67 34.76910548734653 36.0 36.0 36.0 32.0 36.0 68-69 34.81301630096647 36.0 36.0 36.0 34.0 36.0 70-71 34.59289307964033 36.0 36.0 36.0 32.0 36.0 72-73 34.51422977566557 36.0 36.0 36.0 32.0 36.0 74-75 34.38909612166737 36.0 36.0 36.0 32.0 36.0 76 33.5843701399689 36.0 32.0 36.0 32.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 3.0 24 8.0 25 4.0 26 21.0 27 28.0 28 43.0 29 47.0 30 59.0 31 66.0 32 101.0 33 163.0 34 429.0 35 3026.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.925 13.525 16.5 30.049999999999997 2 25.825 23.5 28.65 22.025 3 24.8 28.125 22.125 24.95 4 27.224999999999998 35.075 17.349999999999998 20.349999999999998 5 25.8 35.8 20.1 18.3 6 17.959697732997483 38.86649874055416 25.012594458438286 18.161209068010077 7 17.150000000000002 19.525000000000002 41.425 21.9 8 20.3 22.375 30.599999999999998 26.724999999999998 9 21.325 20.674999999999997 30.675 27.325 10-11 23.7125 32.5125 22.537499999999998 21.2375 12-13 21.3625 25.674999999999997 29.175 23.7875 14-15 21.3125 26.9125 28.0875 23.6875 16-17 23.724999999999998 26.674999999999997 26.424999999999997 23.175 18-19 21.775 26.474999999999998 28.549999999999997 23.200000000000003 20-21 23.365420677584698 26.403300412551566 26.553319164895612 23.67795974496812 22-23 22.6125 28.175 26.6625 22.55 24-25 22.45 28.212500000000002 26.3125 23.025000000000002 26-27 22.8 27.8125 26.487500000000004 22.900000000000002 28-29 22.39869934967484 28.376688344172084 26.688344172086044 22.536268134067033 30-31 22.71021021021021 26.33883883883884 27.2022022022022 23.74874874874875 32-33 21.504568782075353 28.564275879334083 26.94955563900363 22.981599699586933 34-35 22.22222222222222 27.965465465465467 26.826826826826828 22.985485485485484 36-37 22.369573376704615 27.023645689978732 26.773426748404855 23.833354184911798 38-39 22.28199674715376 27.761791567621668 27.211309896159143 22.744901789065434 40-41 22.37928446334751 27.745809357017766 27.645734300725543 22.22917187890918 42-43 22.490311288911112 28.153519189898734 26.26578322290286 23.090386298287285 44-45 22.15 26.6625 28.125 23.0625 46-47 23.3125 27.425 27.325 21.9375 48-49 22.780695173793447 28.257064266066518 26.70667666916729 22.255563890972745 50-51 22.70053810536854 27.355775247153048 27.968965085721436 21.974721561756976 52-53 22.532565130260522 26.102204408817638 27.83066132264529 23.534569138276552 54-55 23.509519038076153 27.580160320641284 26.452905811623246 22.45741482965932 56-57 23.032581453634084 26.553884711779446 26.453634085213036 23.959899749373434 58-59 22.83602655643242 27.959413754227736 26.243266942252287 22.961292747087562 60-61 23.02491548766746 28.33354200575936 27.28183297859021 21.35970952798297 62-63 22.063611319809667 26.3335837716003 27.973954420235415 23.628850488354622 64-65 23.841142570784264 26.37183663242295 27.411676271611125 22.37534452518166 66-67 21.899273365071412 26.72262590829366 27.273866198947633 24.104234527687296 68-69 22.05513784461153 26.704260651629074 27.819548872180448 23.42105263157895 70-71 22.824178580386256 27.48934035615751 26.54878354652621 23.13769751693002 72-73 22.426378051849987 27.5610369997483 26.856279889252455 23.156305059149258 74-75 22.467078742273582 24.18704649287826 27.586670249932816 25.759204514915346 76 23.337222870478413 0.0 41.1901983663944 35.47257876312719 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.0 22 1.5 23 5.5 24 7.0 25 5.0 26 5.5 27 9.5 28 17.0 29 22.0 30 27.5 31 35.5 32 41.5 33 50.0 34 71.0 35 89.5 36 98.5 37 115.0 38 144.0 39 180.5 40 223.5 41 260.0 42 277.0 43 278.5 44 292.5 45 309.0 46 298.5 47 296.5 48 296.5 49 275.0 50 258.5 51 219.0 52 176.5 53 155.0 54 136.5 55 115.0 56 96.5 57 85.0 58 72.0 59 59.0 60 46.0 61 31.0 62 17.5 63 19.5 64 14.5 65 8.5 66 8.0 67 5.5 68 8.0 69 9.0 70 5.0 71 3.5 72 5.0 73 6.5 74 5.0 75 4.5 76 3.0 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.75 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0125 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.05 30-31 0.1 32-33 0.13749999999999998 34-35 0.1 36-37 0.08750000000000001 38-39 0.08750000000000001 40-41 0.075 42-43 0.0125 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.050031269543464665 52-53 0.10010010010010009 54-55 0.10010010010010009 56-57 0.10015022533800699 58-59 0.06259389083625438 60-61 0.012518778167250874 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.038880248833592534 >>END_MODULE >>Sequence Length Distribution warn #Length Count 47 1.0 48 0.0 49 1.0 50 1.0 51 1.0 52 0.0 53 0.0 54 0.0 55 2.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 1.0 62 0.0 63 2.0 64 0.0 65 0.0 66 0.0 67 0.0 68 2.0 69 1.0 70 2.0 71 4.0 72 18.0 73 88.0 74 310.0 75 994.0 76 2572.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06234161175874 97.725 2 0.912316269640142 1.7999999999999998 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025342118601115054 0.475 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTCATTATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA 19 0.475 TruSeq Adapter, Index 2 (97% over 37bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1253408 READS because READLEN < 1 Read 1253408 spots for ERR4131603.sra Written 1253408 spots for ERR4131603.sra Rejected 1253408 READS because READLEN < 1 Read 1253408 spots for ERR4131603.sra Written 1253408 spots for ERR4131603.sra Rejected 1253408 READS because READLEN < 1 Read 1253408 spots for ERR4131603.sra Written 1253408 spots for ERR4131603.sra Rejected 1253408 READS because READLEN < 1 Read 1253408 spots for ERR4131603.sra Written 1253408 spots for ERR4131603.sra Rejected 1253408 READS because READLEN < 1 Read 1253408 spots for ERR4131603.sra Written 1253408 spots for ERR4131603.sra Rejected 1253408 READS because READLEN < 1 Read 1253408 spots for ERR4131603.sra Written 1253408 spots for ERR4131603.sra Rejected 1253408 READS because READLEN < 1 Read 1253408 spots for ERR4131603.sra Written 1253408 spots for ERR4131603.sra Rejected 1253415 READS because READLEN < 1 Read 1253415 spots for ERR4131603.sra Written 1253415 spots for ERR4131603.sra Rejected 1253408 READS because READLEN < 1 Read 1253408 spots for ERR4131603.sra Written 1253408 spots for ERR4131603.sra Rejected 1253408 READS because READLEN < 1 Read 1253408 spots for ERR4131603.sra Written 1253408 spots for ERR4131603.sra Rejected 1253408 READS because READLEN < 1 Read 1253408 spots for ERR4131603.sra Written 1253408 spots for ERR4131603.sra Rejected 1253408 READS because READLEN < 1 Read 1253408 spots for ERR4131603.sra Written 1253408 spots for ERR4131603.sra Rejected 1253408 READS because READLEN < 1 Read 1253408 spots for ERR4131603.sra Written 1253408 spots for ERR4131603.sra Rejected 1253408 READS because READLEN < 1 Read 1253408 spots for ERR4131603.sra Written 1253408 spots for ERR4131603.sra Rejected 1253408 READS because READLEN < 1 Read 1253408 spots for ERR4131603.sra Written 1253408 spots for ERR4131603.sra Rejected 1253408 READS because READLEN < 1 Read 1253408 spots for ERR4131603.sra Written 1253408 spots for ERR4131603.sra Rejected 1253408 READS because READLEN < 1 Read 1253408 spots for ERR4131603.sra Written 1253408 spots for ERR4131603.sra Rejected 1253408 READS because READLEN < 1 Read 1253408 spots for ERR4131603.sra Written 1253408 spots for ERR4131603.sra Rejected 1253408 READS because READLEN < 1 Read 1253408 spots for ERR4131603.sra Written 1253408 spots for ERR4131603.sra Rejected 1253408 READS because READLEN < 1 Read 1253408 spots for ERR4131603.sra Written 1253408 spots for ERR4131603.sra SRR ids: ['ERR4131603.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qw9ni5jz ERR4131603.sra spots: 25068167 blocks: [[1, 1253408], [1253409, 2506816], [2506817, 3760224], [3760225, 5013632], [5013633, 6267040], [6267041, 7520448], [7520449, 8773856], [8773857, 10027264], [10027265, 11280672], [11280673, 12534080], [12534081, 13787488], [13787489, 15040896], [15040897, 16294304], [16294305, 17547712], [17547713, 18801120], [18801121, 20054528], [20054529, 21307936], [21307937, 22561344], [22561345, 23814752], [23814753, 25068167]] ERR4131603 file size 4749866 ERR4131603 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR4131603 ERR4131603_1.fastq Input file: ERR4131603_1.fastq trimmed: ERR4131603-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 14:30:52 2025 >> started Wed Feb 12 14:31:04 2025 >> done (11.501s) 25068167 reads processed; of these: 210 ( 0.00%) short reads filtered out after trimming by size control 144789 ( 0.58%) empty reads filtered out after trimming by size control 24923168 (99.42%) reads available; of these: 2999 ( 0.01%) trimmed reads available after processing 24920169 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 5 0.00% 20 3 0.00% 21 7 0.00% 22 7 0.00% 23 13 0.00% 24 30 0.00% 25 24 0.00% 26 30 0.00% 27 45 0.00% 28 64 0.00% 29 71 0.00% 30 65 0.00% 31 82 0.00% 32 84 0.00% 33 71 0.00% 34 63 0.00% 35 711 0.00% 36 729 0.00% 37 788 0.00% 38 762 0.00% 39 842 0.00% 40 888 0.00% 41 892 0.00% 42 919 0.00% 43 952 0.00% 44 950 0.00% 45 967 0.00% 46 1039 0.00% 47 1032 0.00% 48 1017 0.00% 49 1111 0.00% 50 1162 0.00% 51 1290 0.01% 52 1422 0.01% 53 1492 0.01% 54 1676 0.01% 55 1850 0.01% 56 1993 0.01% 57 1888 0.01% 58 2127 0.01% 59 2230 0.01% 60 2446 0.01% 61 2550 0.01% 62 2812 0.01% 63 2955 0.01% 64 3347 0.01% 65 3850 0.02% 66 4774 0.02% 67 4271 0.02% 68 5381 0.02% 69 5588 0.02% 70 9363 0.04% 71 33280 0.13% 72 140716 0.56% 73 508527 2.04% 74 1726818 6.93% 75 6204456 24.89% 76 16230640 65.12% 24923168 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=22 prefix-density=0.26 prefix-fanout=2.0 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=13.98 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=2.0 sequence=CAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAACAATGACATTACTTCCATTGCAAGCAATGG Started job on | Feb 12 14:31:25 Started mapping on | Feb 12 14:31:25 Finished on | Feb 12 14:31:49 Mapping speed, Million of reads per hour | 3738.48 Number of input reads | 24923168 Average input read length | 75 UNIQUE READS: Uniquely mapped reads number | 21401280 Uniquely mapped reads % | 85.87% Average mapped length | 75.14 Number of splices: Total | 4733483 Number of splices: Annotated (sjdb) | 4670945 Number of splices: GT/AG | 4631150 Number of splices: GC/AG | 82521 Number of splices: AT/AC | 5813 Number of splices: Non-canonical | 13999 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.02% Deletion average length | 1.87 Insertion rate per base | 0.01% Insertion average length | 1.67 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1350188 % of reads mapped to multiple loci | 5.42% Number of reads mapped to too many loci | 1815608 % of reads mapped to too many loci | 7.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.42% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2171700 2171700 2171700 N_multimapping 1350188 1350188 1350188 N_noFeature 1200944 11156372 11299856 N_ambiguous 239029 48555 44680 UnstrandedReadsAssigned:19961307 PositiveStrandReadsAssigned:10196353 NegativeStrandReadsAssigned:10056744 Dataset is classified unstranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 ERR4131603 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: ERR4131603-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,923,168 reads, 22,479,035 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,064 rounds 52401 ERR4131603.ke.tsv 34699 ERR4131603.se.tsv 87100 total ==> ERR4131603.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 459 12.8446 Potri.005G024800.1.v4.1 1035 936 66 3.7866 Potri.004G059700.1.v4.1 961 862 34 2.11813 Potri.007G009000.2.v4.1 1416 1317 1 0.0407752 Potri.003G141000.2.v4.1 2943 2844 373.344 7.04954 Potri.016G087400.1.v4.1 270 171 461.656 144.979 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 5 0.160397 Potri.012G127500.1.v4.1 977 878 888 54.3125 ==> ERR4131603.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 16 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 164 Potri.001G212900.v4.1 196 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 12 Potri.001G452600.v4.1 7 ERR4131603 completed mapping pipeline successfully