Starting /dee2/code/volunteer_pipeline.sh ERR4131604 current disk space = 3051682820096 free memory = 1418511448 ERR4131604 SRAfilesize cd186bf70e45274391cf55bf94a8659a ERR4131604.sra ERR4131604.sra file validated ERR4131604 is single end ERR4131604 is conventional basespace ERR4131604 read1 length is 53-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR4131604_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 53-76 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.68375 32.0 32.0 32.0 32.0 32.0 2 31.69325 32.0 32.0 32.0 32.0 32.0 3 31.731 32.0 32.0 32.0 32.0 32.0 4 31.75375 32.0 32.0 32.0 32.0 32.0 5 31.79475 32.0 32.0 32.0 32.0 32.0 6 35.243 36.0 36.0 36.0 36.0 36.0 7 35.55975 36.0 36.0 36.0 36.0 36.0 8 35.4035 36.0 36.0 36.0 36.0 36.0 9 35.4745 36.0 36.0 36.0 36.0 36.0 10-11 35.457750000000004 36.0 36.0 36.0 36.0 36.0 12-13 35.51625 36.0 36.0 36.0 36.0 36.0 14-15 35.461375000000004 36.0 36.0 36.0 36.0 36.0 16-17 35.466 36.0 36.0 36.0 36.0 36.0 18-19 35.39775 36.0 36.0 36.0 36.0 36.0 20-21 35.397375 36.0 36.0 36.0 36.0 36.0 22-23 35.29325 36.0 36.0 36.0 36.0 36.0 24-25 35.286875 36.0 36.0 36.0 36.0 36.0 26-27 35.35975 36.0 36.0 36.0 36.0 36.0 28-29 35.238875 36.0 36.0 36.0 36.0 36.0 30-31 35.226749999999996 36.0 36.0 36.0 36.0 36.0 32-33 35.171625000000006 36.0 36.0 36.0 36.0 36.0 34-35 35.168000000000006 36.0 36.0 36.0 36.0 36.0 36-37 35.17775 36.0 36.0 36.0 36.0 36.0 38-39 35.145125 36.0 36.0 36.0 36.0 36.0 40-41 35.10525 36.0 36.0 36.0 36.0 36.0 42-43 35.082375 36.0 36.0 36.0 36.0 36.0 44-45 35.110125 36.0 36.0 36.0 36.0 36.0 46-47 35.092375000000004 36.0 36.0 36.0 36.0 36.0 48-49 35.074375 36.0 36.0 36.0 36.0 36.0 50-51 35.0075 36.0 36.0 36.0 36.0 36.0 52-53 34.840125 36.0 36.0 36.0 36.0 36.0 54-55 34.790947736934235 36.0 36.0 36.0 36.0 36.0 56-57 34.898224556139034 36.0 36.0 36.0 36.0 36.0 58-59 34.73143285821455 36.0 36.0 36.0 34.0 36.0 60-61 34.68551420621539 36.0 36.0 36.0 32.0 36.0 62-63 34.73105377763957 36.0 36.0 36.0 32.0 36.0 64-65 34.72922922922923 36.0 36.0 36.0 32.0 36.0 66-67 34.67637117164095 36.0 36.0 36.0 32.0 36.0 68-69 34.71786519669256 36.0 36.0 36.0 32.0 36.0 70-71 34.608243547982966 36.0 36.0 36.0 32.0 36.0 72-73 34.47920209417207 36.0 36.0 36.0 32.0 36.0 74-75 34.376556715582375 36.0 36.0 36.0 32.0 36.0 76 33.593098217671596 36.0 32.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 2.0 24 4.0 25 12.0 26 21.0 27 31.0 28 33.0 29 38.0 30 67.0 31 77.0 32 116.0 33 154.0 34 448.0 35 2996.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.7 13.450000000000001 15.6 31.25 2 24.975 21.349999999999998 28.975 24.7 3 24.725 27.6 23.175 24.5 4 27.6 33.75 17.8 20.849999999999998 5 25.825 36.875 20.225 17.075000000000003 6 18.525044047319405 37.477976340297005 24.515479486534105 19.481500125849486 7 18.025 18.875 40.9 22.2 8 20.1 22.55 29.175 28.175 9 21.05 21.224999999999998 31.05 26.674999999999997 10-11 23.4625 31.662499999999998 22.725 22.15 12-13 21.95 25.8125 28.599999999999998 23.6375 14-15 22.5625 26.3 27.450000000000003 23.6875 16-17 22.650000000000002 27.325 26.724999999999998 23.3 18-19 22.625 26.974999999999998 26.55 23.849999999999998 20-21 23.0875 26.825 26.575 23.5125 22-23 22.6125 27.950000000000003 26.137500000000003 23.3 24-25 23.1 27.775 26.150000000000002 22.975 26-27 22.675 27.6375 26.637499999999996 23.05 28-29 23.0875 27.250000000000004 25.912499999999998 23.75 30-31 22.643160790197552 26.994248562140534 26.281570392598148 24.081020255063766 32-33 22.63631815907954 26.538269134567283 27.501250625312657 23.32416208104052 34-35 23.393348337084273 26.84421105276319 26.069017254313575 23.69342335583896 36-37 22.615326915864483 27.953494186773348 26.790848856107015 22.640330041255158 38-39 23.07788473559195 27.028378547318415 26.665833229153645 23.22790348793599 40-41 22.6125 27.212500000000002 27.287499999999998 22.8875 42-43 23.0125 27.474999999999998 26.8 22.7125 44-45 23.125 27.55 26.8375 22.4875 46-47 23.6375 26.987499999999997 26.087500000000002 23.2875 48-49 23.3625 26.25 27.3 23.0875 50-51 22.162499999999998 27.525 27.9125 22.400000000000002 52-53 23.827978497312163 27.21590198774847 26.24078009751219 22.715339417427177 54-55 23.54927463731866 27.75137568784392 26.3631815907954 22.336168084042022 56-57 22.24584219082156 27.64786795048143 27.597849193447544 22.50844066524947 58-59 23.793448362090523 26.63165791447862 26.36909227306827 23.20580145036259 60-61 24.73427535325747 26.35988495685882 26.13480055020633 22.77103913967738 62-63 22.804603452589443 27.733299974981236 26.35726795096322 23.1048286214661 64-65 23.24824824824825 27.815315315315313 26.076076076076077 22.86036036036036 66-67 23.98246712586099 26.80025046963056 26.136505948653728 23.080776455854725 68-69 22.475570032573287 27.900275620145326 26.396893009270862 23.227261338010525 70-71 23.11450764219494 27.286394387371587 25.770483588073162 23.82861438236031 72-73 23.50797838924488 27.516019600452317 26.18419399422038 22.791808016082424 74-75 22.926113630301415 23.72632702053881 28.15417444651907 25.1933849026407 76 24.080394387561626 0.0 41.714069017823284 34.2055365946151 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.5 17 1.5 18 0.5 19 0.5 20 1.0 21 1.0 22 2.0 23 3.5 24 6.5 25 9.5 26 12.5 27 14.5 28 15.5 29 18.0 30 21.0 31 32.0 32 47.0 33 54.0 34 67.0 35 90.5 36 108.0 37 111.0 38 126.5 39 162.0 40 187.5 41 231.5 42 273.0 43 278.0 44 284.5 45 302.5 46 318.0 47 310.0 48 274.0 49 239.0 50 224.5 51 200.5 52 164.0 53 145.0 54 139.0 55 130.0 56 118.5 57 106.5 58 94.5 59 78.5 60 57.0 61 43.5 62 36.5 63 27.0 64 18.5 65 13.0 66 11.0 67 12.0 68 10.5 69 10.5 70 10.5 71 9.0 72 7.5 73 7.5 74 9.5 75 10.5 76 9.0 77 6.0 78 2.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.675 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.025 32-33 0.05 34-35 0.025 36-37 0.0125 38-39 0.0125 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0125 54-55 0.025006251562890724 56-57 0.012503125781445362 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 53 1.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 1.0 61 0.0 62 2.0 63 0.0 64 0.0 65 2.0 66 3.0 67 0.0 68 0.0 69 0.0 70 0.0 71 2.0 72 19.0 73 74.0 74 294.0 75 965.0 76 2637.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.60193187595323 96.975 2 1.1184544992374175 2.1999999999999997 3 0.27961362480935437 0.8250000000000001 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1255778 READS because READLEN < 1 Read 1255778 spots for ERR4131604.sra Written 1255778 spots for ERR4131604.sra Rejected 1255778 READS because READLEN < 1 Read 1255778 spots for ERR4131604.sra Written 1255778 spots for ERR4131604.sra Rejected 1255778 READS because READLEN < 1 Read 1255778 spots for ERR4131604.sra Written 1255778 spots for ERR4131604.sra Rejected 1255778 READS because READLEN < 1 Read 1255778 spots for ERR4131604.sra Written 1255778 spots for ERR4131604.sra Rejected 1255778 READS because READLEN < 1 Read 1255778 spots for ERR4131604.sra Written 1255778 spots for ERR4131604.sra Rejected 1255778 READS because READLEN < 1 Read 1255778 spots for ERR4131604.sra Written 1255778 spots for ERR4131604.sra Rejected 1255778 READS because READLEN < 1 Read 1255778 spots for ERR4131604.sra Written 1255778 spots for ERR4131604.sra Rejected 1255778 READS because READLEN < 1 Read 1255778 spots for ERR4131604.sra Written 1255778 spots for ERR4131604.sra Rejected 1255778 READS because READLEN < 1 Read 1255778 spots for ERR4131604.sra Written 1255778 spots for ERR4131604.sra Rejected 1255778 READS because READLEN < 1 Read 1255778 spots for ERR4131604.sra Written 1255778 spots for ERR4131604.sra Rejected 1255778 READS because READLEN < 1 Read 1255778 spots for ERR4131604.sra Written 1255778 spots for ERR4131604.sra Rejected 1255778 READS because READLEN < 1 Read 1255778 spots for ERR4131604.sra Written 1255778 spots for ERR4131604.sra Rejected 1255778 READS because READLEN < 1 Read 1255778 spots for ERR4131604.sra Written 1255778 spots for ERR4131604.sra Rejected 1255778 READS because READLEN < 1 Read 1255778 spots for ERR4131604.sra Written 1255778 spots for ERR4131604.sra Rejected 1255778 READS because READLEN < 1 Read 1255778 spots for ERR4131604.sra Written 1255778 spots for ERR4131604.sra Rejected 1255778 READS because READLEN < 1 Read 1255778 spots for ERR4131604.sra Written 1255778 spots for ERR4131604.sra Rejected 1255778 READS because READLEN < 1 Read 1255778 spots for ERR4131604.sra Written 1255778 spots for ERR4131604.sra Rejected 1255785 READS because READLEN < 1 Read 1255785 spots for ERR4131604.sra Written 1255785 spots for ERR4131604.sra Rejected 1255778 READS because READLEN < 1 Read 1255778 spots for ERR4131604.sra Written 1255778 spots for ERR4131604.sra Rejected 1255778 READS because READLEN < 1 Read 1255778 spots for ERR4131604.sra Written 1255778 spots for ERR4131604.sra SRR ids: ['ERR4131604.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_buvcrmtl ERR4131604.sra spots: 25115567 blocks: [[1, 1255778], [1255779, 2511556], [2511557, 3767334], [3767335, 5023112], [5023113, 6278890], [6278891, 7534668], [7534669, 8790446], [8790447, 10046224], [10046225, 11302002], [11302003, 12557780], [12557781, 13813558], [13813559, 15069336], [15069337, 16325114], [16325115, 17580892], [17580893, 18836670], [18836671, 20092448], [20092449, 21348226], [21348227, 22604004], [22604005, 23859782], [23859783, 25115567]] ERR4131604 file size 4758985 ERR4131604 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR4131604 ERR4131604_1.fastq Input file: ERR4131604_1.fastq trimmed: ERR4131604-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 14:34:21 2025 >> started Wed Feb 12 14:34:41 2025 >> done (20.153s) 25115567 reads processed; of these: 180 ( 0.00%) short reads filtered out after trimming by size control 134855 ( 0.54%) empty reads filtered out after trimming by size control 24980532 (99.46%) reads available; of these: 2734 ( 0.01%) trimmed reads available after processing 24977798 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 3 0.00% 21 9 0.00% 22 9 0.00% 23 15 0.00% 24 21 0.00% 25 31 0.00% 26 33 0.00% 27 43 0.00% 28 47 0.00% 29 47 0.00% 30 55 0.00% 31 66 0.00% 32 74 0.00% 33 72 0.00% 34 52 0.00% 35 699 0.00% 36 689 0.00% 37 780 0.00% 38 759 0.00% 39 897 0.00% 40 927 0.00% 41 945 0.00% 42 994 0.00% 43 991 0.00% 44 1001 0.00% 45 1027 0.00% 46 1156 0.00% 47 1160 0.00% 48 1248 0.00% 49 1291 0.01% 50 1376 0.01% 51 1506 0.01% 52 1570 0.01% 53 1883 0.01% 54 2012 0.01% 55 2149 0.01% 56 2343 0.01% 57 2363 0.01% 58 2607 0.01% 59 2725 0.01% 60 3062 0.01% 61 3242 0.01% 62 3582 0.01% 63 4033 0.02% 64 4426 0.02% 65 4934 0.02% 66 6412 0.03% 67 5924 0.02% 68 7110 0.03% 69 7673 0.03% 70 11134 0.04% 71 34640 0.14% 72 135223 0.54% 73 498515 2.00% 74 1708471 6.84% 75 6131103 24.54% 76 16375368 65.55% 24980532 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=1.92 fanout-score-rank=33 prefix-density=0.20 prefix-fanout=1.9 sequence=CCGGCGATGCGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=23.56 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=1.9 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCTGGGCATTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCT Started job on | Feb 12 14:35:04 Started mapping on | Feb 12 14:35:05 Finished on | Feb 12 14:35:42 Mapping speed, Million of reads per hour | 2430.54 Number of input reads | 24980532 Average input read length | 75 UNIQUE READS: Uniquely mapped reads number | 20033711 Uniquely mapped reads % | 80.20% Average mapped length | 75.12 Number of splices: Total | 4321975 Number of splices: Annotated (sjdb) | 4261604 Number of splices: GT/AG | 4229204 Number of splices: GC/AG | 72673 Number of splices: AT/AC | 7122 Number of splices: Non-canonical | 12976 Mismatch rate per base, % | 0.49% Deletion rate per base | 0.02% Deletion average length | 1.90 Insertion rate per base | 0.01% Insertion average length | 1.66 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1495588 % of reads mapped to multiple loci | 5.99% Number of reads mapped to too many loci | 3081575 % of reads mapped to too many loci | 12.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.47% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3451233 3451233 3451233 N_multimapping 1495588 1495588 1495588 N_noFeature 1425649 10620565 10702335 N_ambiguous 217129 41204 39651 UnstrandedReadsAssigned:18390933 PositiveStrandReadsAssigned:9371942 NegativeStrandReadsAssigned:9291725 Dataset is classified unstranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 ERR4131604 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: ERR4131604-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,980,532 reads, 22,044,790 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,257 rounds 52401 ERR4131604.ke.tsv 34699 ERR4131604.se.tsv 87100 total ==> ERR4131604.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 411 11.4041 Potri.005G024800.1.v4.1 1035 936 64 3.64081 Potri.004G059700.1.v4.1 961 862 25 1.54428 Potri.007G009000.2.v4.1 1416 1317 1 0.0404304 Potri.003G141000.2.v4.1 2943 2844 374.315 7.00812 Potri.016G087400.1.v4.1 270 171 492.633 153.399 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 4 0.127233 Potri.012G127500.1.v4.1 977 878 684 41.4816 ==> ERR4131604.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 14 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 169 Potri.001G212900.v4.1 836 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 14 Potri.001G452600.v4.1 3 ERR4131604 completed mapping pipeline successfully