Starting /dee2/code/volunteer_pipeline.sh ERR4131605 current disk space = 3051745558528 free memory = 1062734768 ERR4131605 SRAfilesize 4118bcbd256ff7c2f1ac703964877999 ERR4131605.sra ERR4131605.sra file validated ERR4131605 is single end ERR4131605 is conventional basespace ERR4131605 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR4131605_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.61825 32.0 32.0 32.0 32.0 32.0 2 31.68 32.0 32.0 32.0 32.0 32.0 3 31.70925 32.0 32.0 32.0 32.0 32.0 4 31.687 32.0 32.0 32.0 32.0 32.0 5 31.74325 32.0 32.0 32.0 32.0 32.0 6 35.133 36.0 36.0 36.0 36.0 36.0 7 35.428 36.0 36.0 36.0 36.0 36.0 8 35.4895 36.0 36.0 36.0 36.0 36.0 9 35.42425 36.0 36.0 36.0 36.0 36.0 10-11 35.4475 36.0 36.0 36.0 36.0 36.0 12-13 35.456625 36.0 36.0 36.0 36.0 36.0 14-15 35.44525 36.0 36.0 36.0 36.0 36.0 16-17 35.406375 36.0 36.0 36.0 36.0 36.0 18-19 35.346000000000004 36.0 36.0 36.0 36.0 36.0 20-21 35.40575 36.0 36.0 36.0 36.0 36.0 22-23 35.349125 36.0 36.0 36.0 36.0 36.0 24-25 35.36925 36.0 36.0 36.0 36.0 36.0 26-27 35.303125 36.0 36.0 36.0 36.0 36.0 28-29 35.296625 36.0 36.0 36.0 36.0 36.0 30-31 35.200125 36.0 36.0 36.0 36.0 36.0 32-33 35.1395 36.0 36.0 36.0 36.0 36.0 34-35 35.136875 36.0 36.0 36.0 36.0 36.0 36-37 35.078433825369025 36.0 36.0 36.0 36.0 36.0 38-39 35.129254254254256 36.0 36.0 36.0 36.0 36.0 40-41 35.047682977094745 36.0 36.0 36.0 36.0 36.0 42-43 35.08485607008761 36.0 36.0 36.0 36.0 36.0 44-45 35.12816020025031 36.0 36.0 36.0 36.0 36.0 46-47 35.15948923385078 36.0 36.0 36.0 36.0 36.0 48-49 35.117205108940645 36.0 36.0 36.0 36.0 36.0 50-51 34.985971943887776 36.0 36.0 36.0 36.0 36.0 52-53 34.841279589999345 36.0 36.0 36.0 36.0 36.0 54-55 34.82081955703591 36.0 36.0 36.0 36.0 36.0 56-57 34.81804511278196 36.0 36.0 36.0 36.0 36.0 58-59 34.70415676855127 36.0 36.0 36.0 34.0 36.0 60-61 34.764684660529404 36.0 36.0 36.0 32.0 36.0 62-63 34.676832329317264 36.0 36.0 36.0 32.0 36.0 64-65 34.66980589781811 36.0 36.0 36.0 32.0 36.0 66-67 34.71415922464284 36.0 36.0 36.0 32.0 36.0 68-69 34.75635220125786 36.0 36.0 36.0 32.0 36.0 70-71 34.595583015543596 36.0 36.0 36.0 32.0 36.0 72-73 34.5158317988408 36.0 36.0 36.0 32.0 36.0 74-75 34.41628350058164 36.0 36.0 36.0 32.0 36.0 76 33.7590454195535 36.0 32.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 3.0 23 1.0 24 6.0 25 7.0 26 17.0 27 30.0 28 35.0 29 33.0 30 75.0 31 86.0 32 110.0 33 175.0 34 426.0 35 2992.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.05354015511634 13.284963722792096 16.737553164873656 31.923942957217914 2 26.695021265949464 24.168126094570926 26.51988991743808 22.61696272204153 3 26.09457092819615 27.495621716287218 20.965724293219914 25.444083062296723 4 27.045283962972228 34.52589442081561 18.088566424818612 20.340255191393545 5 25.769326995246434 36.85263947960971 20.21516137102827 17.162872154115586 6 17.519536173430804 37.660700781446934 24.905470128560626 19.91429291656163 7 17.463097322992244 20.41531148361271 41.33099824868651 20.79059294470853 8 19.88991743807856 23.417563172379285 29.372029021766327 27.32049036777583 9 20.240180135101326 21.09081811358519 32.44933700275207 26.21966474856142 10-11 23.8804103077308 32.88716537403052 21.453590192644484 21.778834125594194 12-13 21.603702777082813 25.906930197648236 28.884163122341754 23.605203902927197 14-15 22.566925193895422 27.145359019264447 27.24543407555667 23.042281711283465 16-17 22.71703777833375 26.55741806354766 27.032774580935705 23.692769577182887 18-19 22.291718789091817 27.545659244433324 27.395546659994995 22.76707530647986 20-21 22.191643732799598 28.071053289967473 27.408056042031525 22.329246935201404 22-23 23.029772329246935 28.083562672004003 26.319739804853644 22.566925193895422 24-25 22.091568676507382 27.845884413309985 26.870152614460846 23.19239429572179 26-27 21.57868401300976 26.857643232424316 27.1703777833375 24.39329497122842 28-29 22.949793414298234 27.13158883185176 27.094027795167147 22.824589958682857 30-31 21.63076152304609 27.429859719438877 28.39428857715431 22.54509018036072 32-33 22.325231771485843 27.875219243297416 27.0107742420446 22.788774743172137 34-35 22.607715430861724 28.1187374749499 27.004008016032067 22.26953907815631 36-37 22.031563126252504 28.243987975951907 27.21693386773547 22.50751503006012 38-39 22.848553175497933 27.395715896279594 27.558561944131277 22.197168984091196 40-41 22.137308945126534 27.536958155850666 27.248809822099723 23.076923076923077 42-43 23.056702966579046 27.725622731255477 26.711728626861937 22.505945675303543 44-45 22.753441802252816 27.434292866082604 27.396745932415516 22.415519399249064 46-47 22.69654481722584 27.065598397596396 26.71507260891337 23.5227841762644 48-49 22.101177059854745 27.435512146255945 27.197595792637113 23.26571500125219 50-51 21.81704260651629 27.969924812030072 27.167919799498748 23.045112781954888 52-53 23.065345541201555 26.865671641791046 26.85312931142606 23.21585350558134 54-55 22.995859992472713 27.424413498933635 27.04804917827123 22.53167733032242 56-57 22.59723964868256 27.741530740276033 26.86323713927227 22.797992471769135 58-59 23.06823883592574 27.458605117912693 26.204214751630705 23.26894129453086 60-61 23.0431510286001 26.354741595584546 27.333166081284492 23.26894129453086 62-63 23.55672690763052 26.53112449799197 27.798694779116467 22.113453815261046 64-65 23.301946013810422 26.390458254865035 27.972379158819837 22.335216572504706 66-67 22.51539138082674 27.453197637894206 27.541148385475562 22.490262595803493 68-69 22.50314465408805 27.144654088050313 26.930817610062892 23.42138364779874 70-71 22.87367891293407 26.685958731756415 27.516356316054353 22.92400603925516 72-73 22.049532474096537 27.811473338387664 26.952236542835482 23.186757644680313 74-75 22.244569589702333 25.39554840439796 28.58675248055779 23.773129525341915 76 24.55735180908391 0.0 41.10854503464203 34.33410315627406 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 3.0 23 4.0 24 3.5 25 7.0 26 8.0 27 9.0 28 20.0 29 28.0 30 26.0 31 26.0 32 33.0 33 47.0 34 65.0 35 95.0 36 123.5 37 127.5 38 148.0 39 184.0 40 206.5 41 251.5 42 289.0 43 298.0 44 294.5 45 316.5 46 339.5 47 332.5 48 303.0 49 256.5 50 232.5 51 200.0 52 162.0 53 137.0 54 123.0 55 119.0 56 105.0 57 82.0 58 69.5 59 53.0 60 38.0 61 31.5 62 24.0 63 19.0 64 12.5 65 8.0 66 9.5 67 11.5 68 9.5 69 6.5 70 5.0 71 5.0 72 3.5 73 4.0 74 5.0 75 3.5 76 3.5 77 3.5 78 1.5 79 0.0 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.075 3 0.075 4 0.075 5 0.075 6 0.8250000000000001 7 0.075 8 0.075 9 0.075 10-11 0.075 12-13 0.075 14-15 0.075 16-17 0.075 18-19 0.075 20-21 0.075 22-23 0.075 24-25 0.075 26-27 0.075 28-29 0.1625 30-31 0.2 32-33 0.22499999999999998 34-35 0.2 36-37 0.12509382036527394 38-39 0.11261261261261261 40-41 0.11262670504317357 42-43 0.012515644555694618 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0501002004008016 52-53 0.1252661906551422 54-55 0.1252975817566721 56-57 0.12531328320802004 58-59 0.0752068187515668 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 3.0 36 0.0 37 1.0 38 0.0 39 0.0 40 1.0 41 0.0 42 0.0 43 0.0 44 0.0 45 1.0 46 0.0 47 1.0 48 0.0 49 1.0 50 0.0 51 0.0 52 1.0 53 0.0 54 1.0 55 0.0 56 0.0 57 0.0 58 2.0 59 1.0 60 2.0 61 1.0 62 0.0 63 1.0 64 1.0 65 1.0 66 3.0 67 3.0 68 0.0 69 0.0 70 2.0 71 5.0 72 22.0 73 77.0 74 280.0 75 991.0 76 2598.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.41904521343774 98.4 2 0.5051780752715332 1.0 3 0.050517807527153326 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025258903763576663 0.44999999999999996 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGATTCCATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA 18 0.44999999999999996 TruSeq Adapter, Index 7 (97% over 38bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCACGA 15 0.002152995 69.275 29 CACACGT 15 0.002152995 69.275 12 ACGTCTG 15 0.002152995 69.275 15 TGCCGTC 15 0.002152995 69.275 50 CACGTCT 15 0.002152995 69.275 14 TATGCCG 15 0.002152995 69.275 48 CATCTCG 15 0.002152995 69.275 41 AAGAGCA 15 0.002152995 69.275 7 CTCCAGT 15 0.002152995 69.275 24 TTCTGCT 15 0.002152995 69.275 57 GATCGGA 15 0.002152995 69.275 1 CCGTCTT 15 0.002152995 69.275 52 CACGAGA 15 0.002152995 69.275 31 ACTCCAG 15 0.002152995 69.275 23 TCCAGTC 15 0.002152995 69.275 25 GAAGAGC 15 0.002152995 69.275 6 TCGGAAG 15 0.002152995 69.275 3 TCTCGTA 15 0.002152995 69.275 43 TCACGAG 15 0.002152995 69.275 30 AGAGCAC 15 0.002152995 69.275 8 >>END_MODULE Rejected 1289029 READS because READLEN < 1 Read 1289029 spots for ERR4131605.sra Written 1289029 spots for ERR4131605.sra Rejected 1289029 READS because READLEN < 1 Read 1289029 spots for ERR4131605.sra Written 1289029 spots for ERR4131605.sra Rejected 1289029 READS because READLEN < 1 Read 1289029 spots for ERR4131605.sra Written 1289029 spots for ERR4131605.sra Rejected 1289029 READS because READLEN < 1 Read 1289029 spots for ERR4131605.sra Written 1289029 spots for ERR4131605.sra Rejected 1289029 READS because READLEN < 1 Read 1289029 spots for ERR4131605.sra Written 1289029 spots for ERR4131605.sra Rejected 1289029 READS because READLEN < 1 Read 1289029 spots for ERR4131605.sra Written 1289029 spots for ERR4131605.sra Rejected 1289029 READS because READLEN < 1 Read 1289029 spots for ERR4131605.sra Written 1289029 spots for ERR4131605.sra Rejected 1289029 READS because READLEN < 1 Read 1289029 spots for ERR4131605.sra Written 1289029 spots for ERR4131605.sra Rejected 1289048 READS because READLEN < 1 Read 1289048 spots for ERR4131605.sra Written 1289048 spots for ERR4131605.sra Rejected 1289029 READS because READLEN < 1 Read 1289029 spots for ERR4131605.sra Written 1289029 spots for ERR4131605.sra Rejected 1289029 READS because READLEN < 1 Read 1289029 spots for ERR4131605.sra Written 1289029 spots for ERR4131605.sra Rejected 1289029 READS because READLEN < 1 Read 1289029 spots for ERR4131605.sra Written 1289029 spots for ERR4131605.sra Rejected 1289029 READS because READLEN < 1 Read 1289029 spots for ERR4131605.sra Written 1289029 spots for ERR4131605.sra Rejected 1289029 READS because READLEN < 1 Read 1289029 spots for ERR4131605.sra Written 1289029 spots for ERR4131605.sra Rejected 1289029 READS because READLEN < 1 Read 1289029 spots for ERR4131605.sra Written 1289029 spots for ERR4131605.sra Rejected 1289029 READS because READLEN < 1 Read 1289029 spots for ERR4131605.sra Written 1289029 spots for ERR4131605.sra Rejected 1289029 READS because READLEN < 1 Read 1289029 spots for ERR4131605.sra Written 1289029 spots for ERR4131605.sra Rejected 1289029 READS because READLEN < 1 Read 1289029 spots for ERR4131605.sra Written 1289029 spots for ERR4131605.sra Rejected 1289029 READS because READLEN < 1 Read 1289029 spots for ERR4131605.sra Written 1289029 spots for ERR4131605.sra Rejected 1289029 READS because READLEN < 1 Read 1289029 spots for ERR4131605.sra Written 1289029 spots for ERR4131605.sra SRR ids: ['ERR4131605.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bykpl2jz ERR4131605.sra spots: 25780599 blocks: [[1, 1289029], [1289030, 2578058], [2578059, 3867087], [3867088, 5156116], [5156117, 6445145], [6445146, 7734174], [7734175, 9023203], [9023204, 10312232], [10312233, 11601261], [11601262, 12890290], [12890291, 14179319], [14179320, 15468348], [15468349, 16757377], [16757378, 18046406], [18046407, 19335435], [19335436, 20624464], [20624465, 21913493], [21913494, 23202522], [23202523, 24491551], [24491552, 25780599]] ERR4131605 file size 4883733 ERR4131605 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR4131605 ERR4131605_1.fastq Input file: ERR4131605_1.fastq trimmed: ERR4131605-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 14:45:42 2025 >> started Wed Feb 12 14:45:56 2025 >> done (14.287s) 25780599 reads processed; of these: 196 ( 0.00%) short reads filtered out after trimming by size control 137079 ( 0.53%) empty reads filtered out after trimming by size control 25643324 (99.47%) reads available; of these: 3703 ( 0.01%) trimmed reads available after processing 25639621 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 7 0.00% 21 11 0.00% 22 26 0.00% 23 25 0.00% 24 42 0.00% 25 53 0.00% 26 76 0.00% 27 95 0.00% 28 107 0.00% 29 86 0.00% 30 110 0.00% 31 113 0.00% 32 111 0.00% 33 102 0.00% 34 116 0.00% 35 1035 0.00% 36 1203 0.00% 37 1226 0.00% 38 1216 0.00% 39 1303 0.01% 40 1336 0.01% 41 1426 0.01% 42 1524 0.01% 43 1426 0.01% 44 1502 0.01% 45 1505 0.01% 46 1658 0.01% 47 1557 0.01% 48 1713 0.01% 49 1813 0.01% 50 1910 0.01% 51 2020 0.01% 52 2093 0.01% 53 2420 0.01% 54 2650 0.01% 55 2852 0.01% 56 3063 0.01% 57 3063 0.01% 58 3445 0.01% 59 3594 0.01% 60 4005 0.02% 61 4258 0.02% 62 4708 0.02% 63 5310 0.02% 64 5843 0.02% 65 6382 0.02% 66 7884 0.03% 67 7646 0.03% 68 8810 0.03% 69 9854 0.04% 70 13566 0.05% 71 39837 0.16% 72 150839 0.59% 73 537565 2.10% 74 1782537 6.95% 75 6375468 24.86% 76 16629175 64.85% 25643324 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=26 prefix-density=0.24 prefix-fanout=2.0 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=18.14 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=2.3 sequence=CAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAACAATGACATTACTTCCATTGCAAGCAATGGCGGAAGAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATT Started job on | Feb 12 14:46:16 Started mapping on | Feb 12 14:46:16 Finished on | Feb 12 14:46:43 Mapping speed, Million of reads per hour | 3419.11 Number of input reads | 25643324 Average input read length | 75 UNIQUE READS: Uniquely mapped reads number | 22375730 Uniquely mapped reads % | 87.26% Average mapped length | 75.11 Number of splices: Total | 5047293 Number of splices: Annotated (sjdb) | 4978815 Number of splices: GT/AG | 4940375 Number of splices: GC/AG | 86964 Number of splices: AT/AC | 5560 Number of splices: Non-canonical | 14394 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.02% Deletion average length | 1.88 Insertion rate per base | 0.01% Insertion average length | 1.72 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1336817 % of reads mapped to multiple loci | 5.21% Number of reads mapped to too many loci | 1578626 % of reads mapped to too many loci | 6.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.37% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1930777 1930777 1930777 N_multimapping 1336817 1336817 1336817 N_noFeature 1038831 11607095 11668311 N_ambiguous 232284 48795 44553 UnstrandedReadsAssigned:21104615 PositiveStrandReadsAssigned:10719840 NegativeStrandReadsAssigned:10662866 Dataset is classified unstranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 ERR4131605 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: ERR4131605-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,643,324 reads, 23,418,682 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,165 rounds 52401 ERR4131605.ke.tsv 34699 ERR4131605.se.tsv 87100 total ==> ERR4131605.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 447 12.4895 Potri.005G024800.1.v4.1 1035 936 70 4.00991 Potri.004G059700.1.v4.1 961 862 29 1.80386 Potri.007G009000.2.v4.1 1416 1317 3 0.122137 Potri.003G141000.2.v4.1 2943 2844 425.769 8.02706 Potri.016G087400.1.v4.1 270 171 476.651 149.457 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 6 0.19218 Potri.012G127500.1.v4.1 977 878 955 58.3205 ==> ERR4131605.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 19 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 193 Potri.001G212900.v4.1 253 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 11 Potri.001G452600.v4.1 2 ERR4131605 completed mapping pipeline successfully