Starting /dee2/code/volunteer_pipeline.sh SRR10225134 current disk space = 3052377264128 free memory = 1579203372 SRR10225134 SRAfilesize c261d5a6813daca08a1a0283f1e9ab98 SRR10225134.sra SRR10225134.sra file validated SRR10225134 is paired end SRR10225134 is conventional basespace SRR10225134 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR10225134_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82075 34.0 33.0 34.0 31.0 34.0 2 33.0315 34.0 33.0 34.0 31.0 34.0 3 33.138 34.0 33.0 34.0 31.0 34.0 4 36.46575 37.0 37.0 37.0 35.0 37.0 5 36.38475 37.0 37.0 37.0 35.0 37.0 6 36.387 37.0 37.0 37.0 35.0 37.0 7 36.41925 37.0 37.0 37.0 35.0 37.0 8 36.424 37.0 37.0 37.0 35.0 37.0 9 38.295 39.0 39.0 39.0 37.0 39.0 10-11 38.231 39.0 39.0 39.0 37.0 39.0 12-13 38.179500000000004 39.0 39.0 39.0 37.0 39.0 14-15 39.826875 41.0 40.0 41.0 37.5 41.0 16-17 39.70125 41.0 40.0 41.0 37.0 41.0 18-19 39.74275 41.0 40.0 41.0 37.5 41.0 20-21 39.69825 41.0 40.0 41.0 37.0 41.0 22-23 39.66975 41.0 40.0 41.0 37.0 41.0 24-25 39.634874999999994 41.0 40.0 41.0 37.0 41.0 26-27 39.522999999999996 41.0 40.0 41.0 37.0 41.0 28-29 39.4105 41.0 39.5 41.0 36.5 41.0 30-31 39.321 41.0 39.0 41.0 36.0 41.0 32-33 39.066 41.0 39.0 41.0 35.5 41.0 34-35 39.11475 40.5 39.0 41.0 36.0 41.0 36-37 38.907375 40.0 39.0 41.0 35.0 41.0 38-39 38.785 40.0 38.0 41.0 35.0 41.0 40-41 38.637 40.0 38.0 41.0 35.0 41.0 42-43 38.357124999999996 40.0 38.0 41.0 34.0 41.0 44-45 38.77275 40.0 38.0 41.0 35.0 41.0 46-47 38.861375 40.0 39.0 41.0 35.0 41.0 48-49 38.70425 41.0 38.5 41.0 35.0 41.0 50-51 38.6345 40.5 38.0 41.0 35.0 41.0 52-53 38.566375 40.0 38.0 41.0 34.5 41.0 54-55 38.305625 40.0 38.0 41.0 34.0 41.0 56-57 38.16 40.0 37.0 41.0 34.0 41.0 58-59 37.71475 40.0 36.5 41.0 33.0 41.0 60-61 37.581 39.0 36.0 41.0 33.0 41.0 62-63 37.279375 39.0 36.0 41.0 33.0 41.0 64-65 36.853750000000005 38.5 35.0 40.5 32.0 41.0 66-67 36.578625 37.5 35.0 40.0 32.0 41.0 68-69 36.204499999999996 37.0 35.0 39.0 32.0 41.0 70-71 35.80375 36.5 35.0 39.0 32.0 41.0 72-73 35.357749999999996 36.0 35.0 39.0 32.0 40.5 74-75 34.35725 35.5 35.0 37.0 30.5 39.0 76-77 33.873 35.0 35.0 37.0 30.0 39.0 78-79 33.62625 35.0 34.5 36.5 30.0 38.5 80-81 33.298874999999995 35.0 34.0 36.0 29.5 37.0 82-83 33.128375000000005 35.0 34.0 36.0 29.5 37.0 84-85 32.934625 35.0 34.0 35.0 30.0 36.5 86-87 32.76325 35.0 34.0 35.0 29.0 36.0 88-89 32.66875 35.0 34.0 35.0 29.0 36.0 90-91 32.52975 35.0 34.0 35.0 29.0 36.0 92-93 32.437125 35.0 34.0 35.0 29.5 35.5 94-95 32.347 35.0 34.0 35.0 29.0 35.0 96-97 32.187875 35.0 34.0 35.0 29.0 35.0 98-99 32.053875000000005 35.0 34.0 35.0 29.0 35.0 100 31.9845 35.0 34.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 4.0 9 0.0 10 1.0 11 1.0 12 5.0 13 2.0 14 2.0 15 3.0 16 7.0 17 5.0 18 4.0 19 3.0 20 11.0 21 7.0 22 5.0 23 12.0 24 7.0 25 22.0 26 20.0 27 26.0 28 46.0 29 79.0 30 37.0 31 49.0 32 68.0 33 77.0 34 125.0 35 175.0 36 360.0 37 956.0 38 1566.0 39 315.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.368871008297713 35.9316067387478 20.593412119688207 14.10611013326628 2 34.875 30.85 18.4 15.875 3 30.2 32.074999999999996 21.475 16.25 4 27.150000000000002 30.3 23.75 18.8 5 26.1 30.075000000000003 22.875 20.95 6 29.525000000000002 29.099999999999998 22.475 18.9 7 28.249999999999996 28.175 23.925 19.650000000000002 8 22.525000000000002 32.425 27.55 17.5 9 24.474999999999998 32.025 25.124999999999996 18.375 10-11 24.712500000000002 30.099999999999998 25.887500000000003 19.3 12-13 23.5375 28.6375 26.0125 21.8125 14-15 22.475 30.162499999999998 25.4 21.9625 16-17 22.45 30.2 25.937500000000004 21.4125 18-19 24.1625 27.025 26.974999999999998 21.837500000000002 20-21 23.1625 28.175 27.487499999999997 21.175 22-23 25.35 29.4375 25.025 20.1875 24-25 22.287499999999998 29.1875 24.9 23.625 26-27 22.5625 28.6375 26.7625 22.037499999999998 28-29 22.8375 29.849999999999998 25.55 21.762500000000003 30-31 25.15 26.875 26.974999999999998 21.0 32-33 21.8125 29.1875 26.137500000000003 22.8625 34-35 22.3875 28.0625 25.6125 23.9375 36-37 22.45 27.950000000000003 28.4375 21.1625 38-39 24.975 27.700000000000003 26.4125 20.9125 40-41 22.25 30.2875 26.200000000000003 21.2625 42-43 23.45 27.750000000000004 27.1625 21.637500000000003 44-45 22.2125 27.3125 27.1125 23.3625 46-47 23.8375 27.700000000000003 27.3375 21.125 48-49 22.8125 28.1875 27.55 21.45 50-51 23.4125 27.375 26.6125 22.6 52-53 24.0125 28.025 26.375 21.587500000000002 54-55 22.625 26.5 28.037499999999998 22.8375 56-57 22.375 26.674999999999997 29.2375 21.712500000000002 58-59 23.0 27.3 27.212500000000002 22.4875 60-61 23.575 26.3625 27.1625 22.900000000000002 62-63 22.3375 27.0 30.162499999999998 20.5 64-65 23.5625 29.012500000000003 26.75 20.674999999999997 66-67 22.0875 30.2625 27.6375 20.0125 68-69 23.0625 29.7125 26.437500000000004 20.7875 70-71 21.958234337876704 30.54895585844692 27.172689758659494 20.320120045016882 72-73 22.9875 30.275000000000002 25.912499999999998 20.825 74-75 23.3375 29.1875 26.937499999999996 20.5375 76-77 23.4625 28.8625 26.7625 20.9125 78-79 23.3875 29.5375 26.6625 20.4125 80-81 23.22790348793599 28.27853481685211 26.190773846730842 22.30278784848106 82-83 22.287499999999998 28.287499999999998 27.0125 22.412499999999998 84-85 23.3875 28.7375 26.4625 21.4125 86-87 22.9875 29.525000000000002 26.737499999999997 20.75 88-89 22.8 27.6 26.875 22.725 90-91 23.265408176022003 28.528566070758842 26.59082385298162 21.61520190023753 92-93 22.8 28.000000000000004 27.800000000000004 21.4 94-95 23.125 27.5875 28.0875 21.2 96-97 23.3875 28.537499999999998 26.6625 21.4125 98-99 23.25 26.637499999999996 28.299999999999997 21.8125 100 24.275 27.35 26.8 21.575 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 2.0 17 3.0 18 2.5 19 1.0 20 2.5 21 3.0 22 1.0 23 1.0 24 0.5 25 3.0 26 5.0 27 2.5 28 5.5 29 9.5 30 12.5 31 18.0 32 22.5 33 29.5 34 36.5 35 49.5 36 74.0 37 105.0 38 130.5 39 153.5 40 193.5 41 233.0 42 253.0 43 260.5 44 273.0 45 281.5 46 247.0 47 215.0 48 206.0 49 191.0 50 168.0 51 136.5 52 118.5 53 103.0 54 95.0 55 82.0 56 61.5 57 48.5 58 32.5 59 22.0 60 20.5 61 18.0 62 10.0 63 11.0 64 10.5 65 6.5 66 4.0 67 2.0 68 4.0 69 4.0 70 2.5 71 1.5 72 1.5 73 2.5 74 1.5 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0375 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0125 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0125 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16839916839916 95.39999999999999 2 0.5977130977130978 1.15 3 0.07796257796257797 0.22499999999999998 4 0.02598752598752599 0.1 5 0.05197505197505198 0.25 6 0.0 0.0 7 0.0 0.0 8 0.02598752598752599 0.2 9 0.0 0.0 >10 0.02598752598752599 0.375 >50 0.02598752598752599 2.3 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATG 92 2.3 TruSeq Adapter, Index 12 (100% over 49bp) CAACACGGGGAAACTTACCAGGTCCAGACATAGTAAGGATTGACAGACTG 15 0.375 No Hit TACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCC 8 0.2 No Hit GATCCTGAGTTGAGTTAGGCTTGAGCAGATTCATTCGCCAACTAACCCTT 5 0.125 No Hit AACACGGACCAAGGAGTCTGACATGTGTGCGAGTCAACGGGCGAGTAAAC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 2.9 0.0 0.0 0.0 0.0 2 2.9 0.0 0.0 0.0 0.0 3 2.9 0.0 0.0 0.0 0.0 4 2.9 0.0 0.0 0.0 0.0 5 2.9 0.0 0.0 0.0 0.0 6 2.9 0.0 0.0 0.0 0.0 7 2.925 0.0 0.0 0.0 0.0 8 2.925 0.0 0.0 0.0 0.0 9 2.925 0.0 0.0 0.0 0.0 10-11 2.925 0.0 0.0 0.0 0.0 12-13 2.925 0.0 0.0 0.0 0.0 14-15 2.925 0.0 0.0 0.0 0.0 16-17 2.925 0.0 0.0 0.0 0.0 18-19 2.925 0.0 0.0 0.0 0.0 20-21 2.925 0.0 0.0 0.0 0.0 22-23 2.925 0.0 0.0 0.0 0.0 24-25 2.95 0.0 0.0 0.0 0.0 26-27 2.95 0.0 0.0 0.0 0.0 28-29 2.95 0.0 0.0 0.0 0.0 30-31 2.95 0.0 0.0 0.0 0.0 32-33 2.975 0.0 0.0 0.0 0.0 34-35 2.975 0.0 0.0 0.0 0.0 36-37 2.975 0.0 0.0 0.0 0.0 38-39 2.975 0.0 0.0 0.0 0.0 40-41 3.0 0.0 0.0 0.0 0.0 42-43 3.0 0.0 0.0 0.0 0.0 44-45 3.0 0.0 0.0 0.0 0.0 46-47 3.0 0.0 0.0 0.0 0.0 48-49 3.025 0.0 0.0 0.0 0.0 50-51 3.025 0.0 0.0 0.0 0.0 52-53 3.025 0.0 0.0 0.0 0.0 54-55 3.025 0.0 0.0 0.0 0.0 56-57 3.025 0.0 0.0 0.0 0.0 58-59 3.025 0.0 0.0 0.0 0.0 60-61 3.025 0.0 0.0 0.0 0.0 62-63 3.025 0.0 0.0 0.0 0.0 64-65 3.025 0.0 0.0 0.0 0.0 66-67 3.025 0.0 0.0 0.0 0.0 68-69 3.0374999999999996 0.0 0.0 0.0 0.0 70-71 3.05 0.0 0.0 0.0 0.0 72-73 3.0625 0.0 0.0 0.0 0.0 74-75 3.075 0.0 0.0 0.0 0.0 76-77 3.0875000000000004 0.0 0.0 0.0 0.0 78-79 3.1 0.0 0.0 0.0 0.0 80-81 3.1 0.0 0.0 0.0 0.0 82-83 3.1 0.0 0.0 0.0 0.0 84-85 3.125 0.0 0.0 0.0 0.0 86-87 3.15 0.0 0.0 0.0 0.0 88 3.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGAGC 25 4.100857E-7 93.9125 7 TCGGAAG 25 4.100857E-7 93.9125 4 CGGAAGA 25 4.100857E-7 93.9125 5 AGAGCAC 25 4.100857E-7 93.9125 9 ATCGGAA 25 4.100857E-7 93.9125 3 GGAAGAG 25 4.100857E-7 93.9125 6 AAGAGCA 30 1.2142173E-6 78.260414 8 AGATCGG 30 1.2142173E-6 78.260414 1 GATCGGA 35 3.0360734E-6 67.08036 2 GTATGCC 25 2.7633092E-5 46.95625 46-47 AATCTCG 25 2.7633092E-5 46.95625 40-41 ATCTCGT 25 2.7633092E-5 46.95625 40-41 ACGTCTG 25 2.7633092E-5 46.95625 16-17 TGCCGTC 25 2.7633092E-5 46.95625 48-49 TATGCCG 25 2.7633092E-5 46.95625 46-47 TTCTGCT 25 2.7633092E-5 46.95625 56-57 CCTTGTA 25 2.7633092E-5 46.95625 34-35 CCGTCTT 25 2.7633092E-5 46.95625 50-51 ACTCCAG 25 2.7633092E-5 46.95625 24-25 GTCTGAA 25 2.7633092E-5 46.95625 18-19 >>END_MODULE SRR10225134 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR10225134_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2375 34.0 31.0 34.0 30.0 34.0 2 32.406 34.0 31.0 34.0 31.0 34.0 3 32.394 34.0 31.0 34.0 30.0 34.0 4 35.83775 37.0 37.0 37.0 35.0 37.0 5 35.66525 37.0 35.0 37.0 35.0 37.0 6 35.62 37.0 35.0 37.0 35.0 37.0 7 35.5025 37.0 35.0 37.0 35.0 37.0 8 35.5825 37.0 37.0 37.0 35.0 37.0 9 37.4615 39.0 39.0 39.0 35.0 39.0 10-11 37.4185 39.0 39.0 39.0 35.0 39.0 12-13 37.369875 39.0 39.0 39.0 35.0 39.0 14-15 38.81725 41.0 39.0 41.0 35.5 41.0 16-17 38.778375 41.0 39.5 41.0 35.5 41.0 18-19 38.530125 41.0 39.0 41.0 34.5 41.0 20-21 38.412875 41.0 39.0 41.0 34.0 41.0 22-23 38.31125 41.0 39.0 41.0 34.0 41.0 24-25 38.24850000000001 41.0 39.0 41.0 34.0 41.0 26-27 38.136250000000004 41.0 39.0 41.0 34.0 41.0 28-29 37.932249999999996 40.5 38.5 41.0 33.5 41.0 30-31 37.658500000000004 40.0 38.0 41.0 32.5 41.0 32-33 37.608375 40.0 38.0 41.0 32.5 41.0 34-35 37.5275 40.0 38.0 41.0 32.5 41.0 36-37 37.43325 40.0 38.0 41.0 32.0 41.0 38-39 37.317625 40.0 38.0 41.0 31.5 41.0 40-41 37.259375 40.0 38.0 41.0 31.5 41.0 42-43 37.11225 40.0 37.5 41.0 31.5 41.0 44-45 37.071625 40.0 37.5 41.0 31.5 41.0 46-47 37.319125 40.0 38.0 41.0 32.0 41.0 48-49 37.176249999999996 40.0 38.0 41.0 31.5 41.0 50-51 37.1495 40.0 37.0 41.0 31.5 41.0 52-53 36.878875 40.0 37.0 41.0 31.0 41.0 54-55 36.68725 40.0 36.5 41.0 31.0 41.0 56-57 36.52525 40.0 36.0 41.0 30.5 41.0 58-59 36.310625 39.5 35.5 41.0 30.5 41.0 60-61 36.034375 39.0 35.0 41.0 30.0 41.0 62-63 35.78675 39.0 35.0 41.0 29.5 41.0 64-65 35.262125 38.0 35.0 40.5 28.5 41.0 66-67 34.622 37.0 35.0 40.0 26.0 41.0 68-69 33.975 37.0 34.5 40.0 24.0 41.0 70-71 33.55175 36.0 34.0 39.0 22.5 41.0 72-73 33.136375 36.0 34.0 39.0 21.0 40.5 74-75 32.709 35.0 34.0 37.5 20.0 39.5 76-77 32.429500000000004 35.0 34.0 37.0 21.0 39.0 78-79 32.128375 35.0 34.0 37.0 20.0 39.0 80-81 31.734875000000002 35.0 34.0 36.0 17.5 37.5 82-83 31.501125000000002 35.0 34.0 36.0 18.5 37.0 84-85 31.16325 35.0 33.0 35.5 15.0 37.0 86-87 30.984 35.0 33.0 35.0 10.0 36.0 88-89 30.83475 35.0 33.0 35.0 7.0 36.0 90-91 30.5925 35.0 33.0 35.0 2.0 36.0 92-93 30.348 35.0 33.0 35.0 2.0 35.5 94-95 30.11 35.0 32.5 35.0 2.0 35.0 96-97 29.9415 35.0 32.0 35.0 2.0 35.0 98-99 29.822375 35.0 32.0 35.0 2.0 35.0 100 29.7675 35.0 32.0 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 42.0 3 7.0 4 12.0 5 7.0 6 13.0 7 12.0 8 7.0 9 12.0 10 8.0 11 4.0 12 8.0 13 8.0 14 13.0 15 8.0 16 5.0 17 8.0 18 11.0 19 14.0 20 15.0 21 15.0 22 14.0 23 27.0 24 33.0 25 60.0 26 46.0 27 25.0 28 42.0 29 37.0 30 48.0 31 50.0 32 69.0 33 100.0 34 134.0 35 184.0 36 332.0 37 706.0 38 1458.0 39 406.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.425 16.650000000000002 15.475 27.450000000000003 2 31.85 6.325 18.65 43.175000000000004 3 20.1 9.049999999999999 19.875 50.975 4 23.35 7.375 22.025 47.25 5 24.05 11.5 22.625 41.825 6 33.983495873968494 12.05301325331333 26.531632908227053 27.431857964491122 7 21.325 27.075 32.125 19.475 8 15.7 30.225 34.275 19.8 9 17.075000000000003 32.824999999999996 31.374999999999996 18.725 10-11 19.35 30.5375 30.6875 19.425 12-13 19.8875 28.825 30.3875 20.9 14-15 19.9375 27.375 31.7125 20.974999999999998 16-17 20.225 27.487499999999997 29.975 22.3125 18-19 20.3375 28.5875 30.575000000000003 20.5 20-21 20.075000000000003 30.4375 29.475 20.0125 22-23 22.662499999999998 29.0875 27.0875 21.1625 24-25 21.175 30.049999999999997 27.3875 21.3875 26-27 19.3 31.0 27.325 22.375 28-29 21.512500000000003 29.9875 26.7625 21.7375 30-31 20.25 28.537499999999998 29.1625 22.05 32-33 20.424999999999997 28.812500000000004 27.8875 22.875 34-35 20.962500000000002 30.125 26.875 22.037499999999998 36-37 20.674999999999997 29.1875 27.8625 22.275 38-39 20.0625 28.262500000000003 28.237499999999997 23.4375 40-41 21.712500000000002 28.475 26.887499999999996 22.925 42-43 21.9375 29.049999999999997 28.499999999999996 20.5125 44-45 23.1125 28.825 25.874999999999996 22.1875 46-47 19.650000000000002 28.3875 27.825 24.1375 48-49 21.512500000000003 28.1875 27.0125 23.2875 50-51 21.525 28.15 26.787499999999998 23.5375 52-53 20.375 30.6375 27.650000000000002 21.337500000000002 54-55 19.25 28.499999999999996 29.0875 23.1625 56-57 19.7375 29.9625 29.275000000000002 21.025 58-59 20.5625 29.475 28.375 21.587500000000002 60-61 20.150000000000002 29.849999999999998 28.299999999999997 21.7 62-63 20.7375 30.612499999999997 26.650000000000002 22.0 64-65 20.8125 30.587500000000002 26.937499999999996 21.6625 66-67 20.125 30.7375 26.8125 22.325 68-69 20.474999999999998 31.974999999999998 25.874999999999996 21.675 70-71 20.5375 29.9625 27.487499999999997 22.0125 72-73 20.7375 29.9625 27.3375 21.9625 74-75 21.2625 28.275 27.500000000000004 22.9625 76-77 20.7375 29.225 27.5625 22.475 78-79 21.0375 29.4 26.875 22.6875 80-81 21.2875 28.0625 27.1 23.549999999999997 82-83 21.712500000000002 27.987499999999997 26.8375 23.4625 84-85 21.575 29.012500000000003 26.8625 22.55 86-87 21.3625 30.1375 25.837500000000002 22.662499999999998 88-89 21.6 27.925 27.4125 23.0625 90-91 21.337500000000002 29.875 26.1125 22.675 92-93 21.837500000000002 28.275 27.400000000000002 22.4875 94-95 21.7 29.212500000000002 27.212500000000002 21.875 96-97 20.9375 28.849999999999998 27.275 22.9375 98-99 20.9 29.4125 27.950000000000003 21.7375 100 22.35 28.325 26.700000000000003 22.625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 0.5 11 0.5 12 1.0 13 1.5 14 2.0 15 2.5 16 1.5 17 1.5 18 2.0 19 1.5 20 3.0 21 3.0 22 4.5 23 6.5 24 7.0 25 9.5 26 9.0 27 16.0 28 21.5 29 21.0 30 25.0 31 32.0 32 50.0 33 60.5 34 66.0 35 91.0 36 105.5 37 107.5 38 123.0 39 155.5 40 195.5 41 212.5 42 217.0 43 225.5 44 214.0 45 202.5 46 217.0 47 215.5 48 183.5 49 152.5 50 137.5 51 128.5 52 110.5 53 99.5 54 87.0 55 78.5 56 67.5 57 51.5 58 50.0 59 47.5 60 35.5 61 29.0 62 22.5 63 14.0 64 16.0 65 12.5 66 9.0 67 6.0 68 2.5 69 3.5 70 3.5 71 2.0 72 4.5 73 5.5 74 3.5 75 2.0 76 0.5 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.0 #Duplication Level Percentage of deduplicated Percentage of total 1 98.54166666666667 94.6 2 1.25 2.4 3 0.078125 0.22499999999999998 4 0.078125 0.3 5 0.0 0.0 6 0.026041666666666668 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.026041666666666668 2.325 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCC 93 2.325 Illumina Single End PCR Primer 1 (100% over 50bp) CCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 2.6 0.0 0.0 0.0 0.0 2 2.6 0.0 0.0 0.0 0.0 3 2.6 0.0 0.0 0.0 0.0 4 2.6 0.0 0.0 0.0 0.0 5 2.6 0.0 0.0 0.0 0.0 6 2.6 0.0 0.0 0.0 0.0 7 2.6 0.0 0.0 0.0 0.0 8 2.6 0.0 0.0 0.0 0.0 9 2.6 0.0 0.0 0.0 0.0 10-11 2.6 0.0 0.0 0.0 0.0 12-13 2.6 0.0 0.0 0.0 0.0 14-15 2.6 0.0 0.0 0.0 0.0 16-17 2.6125 0.0 0.0 0.0 0.0 18-19 2.65 0.0 0.0 0.0 0.0 20-21 2.65 0.0 0.0 0.0 0.0 22-23 2.65 0.0 0.0 0.0 0.0 24-25 2.6875 0.0 0.0 0.0 0.0 26-27 2.7375 0.0 0.0 0.0 0.0 28-29 2.775 0.0 0.0 0.0 0.0 30-31 2.775 0.0 0.0 0.0 0.0 32-33 2.8 0.0 0.0 0.0 0.0 34-35 2.8 0.0 0.0 0.0 0.0 36-37 2.8 0.0 0.0 0.0 0.0 38-39 2.8 0.0 0.0 0.0 0.0 40-41 2.8 0.0 0.0 0.0 0.0 42-43 2.8 0.0 0.0 0.0 0.0 44-45 2.8 0.0 0.0 0.0 0.0 46-47 2.8 0.0 0.0 0.0 0.0 48-49 2.825 0.0 0.0 0.0 0.0 50-51 2.825 0.0 0.0 0.0 0.0 52-53 2.825 0.0 0.0 0.0 0.0 54-55 2.825 0.0 0.0 0.0 0.0 56-57 2.825 0.0 0.0 0.0 0.0 58-59 2.825 0.0 0.0 0.0 0.0 60-61 2.825 0.0 0.0 0.0 0.0 62-63 2.825 0.0 0.0 0.0 0.0 64-65 2.825 0.0 0.0 0.0 0.0 66-67 2.825 0.0 0.0 0.0 0.0 68-69 2.8375000000000004 0.0 0.0 0.0 0.0 70-71 2.85 0.0 0.0 0.0 0.0 72-73 2.8625 0.0 0.0 0.0 0.0 74-75 2.875 0.0 0.0 0.0 0.0 76-77 2.8875 0.0 0.0 0.0 0.0 78-79 2.9 0.0 0.0 0.0 0.0 80-81 2.9 0.0 0.0 0.0 0.0 82-83 2.9 0.0 0.0 0.0 0.0 84-85 2.925 0.0 0.0 0.0 0.0 86-87 2.95 0.0 0.0 0.0 0.0 88 2.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGAGCG 25 4.078156E-7 94.00001 8 GAAGAGC 25 4.078156E-7 94.00001 7 TCGGAAG 25 4.078156E-7 94.00001 4 CGGAAGA 25 4.078156E-7 94.00001 5 AGAGCGT 25 4.078156E-7 94.00001 9 GATCGGA 30 1.2075088E-6 78.333336 2 ATCGGAA 30 1.2075088E-6 78.333336 3 GGAAGAG 30 1.2075088E-6 78.333336 6 AGATCGG 30 1.2075088E-6 78.333336 1 GTAGATC 25 2.748136E-5 47.000004 32-33 GAGCGTC 25 2.748136E-5 47.000004 10-11 GAGTGTA 25 2.748136E-5 47.000004 28-29 GTCGTGT 25 2.748136E-5 47.000004 14-15 GTGTAGG 25 2.748136E-5 47.000004 16-17 GTGTAGA 25 2.748136E-5 47.000004 30-31 TCGGTGG 25 2.748136E-5 47.000004 38-39 AAGAGTG 25 2.748136E-5 47.000004 26-27 GTATCAT 25 2.748136E-5 47.000004 50-51 TCGTGTA 25 2.748136E-5 47.000004 14-15 CCGTATC 25 2.748136E-5 47.000004 48-49 >>END_MODULE Read 5935753 spots for SRR10225134.sra Written 5935753 spots for SRR10225134.sra Read 5935753 spots for SRR10225134.sra Written 5935753 spots for SRR10225134.sra Read 5935753 spots for SRR10225134.sra Written 5935753 spots for SRR10225134.sra Read 5935753 spots for SRR10225134.sra Written 5935753 spots for SRR10225134.sra Read 5935753 spots for SRR10225134.sra Written 5935753 spots for SRR10225134.sra Read 5935753 spots for SRR10225134.sra Written 5935753 spots for SRR10225134.sra Read 5935753 spots for SRR10225134.sra Written 5935753 spots for SRR10225134.sra Read 5935753 spots for SRR10225134.sra Written 5935753 spots for SRR10225134.sra Read 5935753 spots for SRR10225134.sra Written 5935753 spots for SRR10225134.sra Read 5935753 spots for SRR10225134.sra Written 5935753 spots for SRR10225134.sra Read 5935753 spots for SRR10225134.sra Written 5935753 spots for SRR10225134.sra Read 5935753 spots for SRR10225134.sra Written 5935753 spots for SRR10225134.sra Read 5935753 spots for SRR10225134.sra Written 5935753 spots for SRR10225134.sra Read 5935753 spots for SRR10225134.sra Written 5935753 spots for SRR10225134.sra Read 5935753 spots for SRR10225134.sra Written 5935753 spots for SRR10225134.sra Read 5935753 spots for SRR10225134.sra Written 5935753 spots for SRR10225134.sra Read 5935753 spots for SRR10225134.sra Written 5935753 spots for SRR10225134.sra Read 5935753 spots for SRR10225134.sra Written 5935753 spots for SRR10225134.sra Read 5935755 spots for SRR10225134.sra Written 5935755 spots for SRR10225134.sra Read 5935753 spots for SRR10225134.sra Written 5935753 spots for SRR10225134.sra SRR ids: ['SRR10225134.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lglc5x3e SRR10225134.sra spots: 118715062 blocks: [[1, 5935753], [5935754, 11871506], [11871507, 17807259], [17807260, 23743012], [23743013, 29678765], [29678766, 35614518], [35614519, 41550271], [41550272, 47486024], [47486025, 53421777], [53421778, 59357530], [59357531, 65293283], [65293284, 71229036], [71229037, 77164789], [77164790, 83100542], [83100543, 89036295], [89036296, 94972048], [94972049, 100907801], [100907802, 106843554], [106843555, 112779307], [112779308, 118715062]] SRR10225134 file size 32485954 SRR10225134 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR10225134 SRR10225134_1.fastq SRR10225134_2.fastq Input file: SRR10225134_1.fastq Paired file: SRR10225134_2.fastq trimmed: SRR10225134-trimmed-pair1.fastq, SRR10225134-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 23:39:36 2025 >> started Tue Feb 11 23:41:27 2025 >> done (110.862s) 118715062 read pairs processed; of these: 790606 ( 0.67%) short read pairs filtered out after trimming by size control 4709155 ( 3.97%) empty read pairs filtered out after trimming by size control 113215301 (95.37%) read pairs available; of these: 16433018 (14.51%) trimmed read pairs available after processing 96782283 (85.49%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 35766 0.03% 19 23575 0.02% 20 29158 0.03% 21 13948 0.01% 22 8520 0.01% 23 10255 0.01% 24 22826 0.02% 25 23536 0.02% 26 18991 0.02% 27 13440 0.01% 28 9098 0.01% 29 11113 0.01% 30 11518 0.01% 31 8526 0.01% 32 9121 0.01% 33 6672 0.01% 34 5760 0.01% 35 6427 0.01% 36 6575 0.01% 37 7462 0.01% 38 8187 0.01% 39 9015 0.01% 40 10109 0.01% 41 10647 0.01% 42 11269 0.01% 43 12705 0.01% 44 13519 0.01% 45 14533 0.01% 46 15019 0.01% 47 15932 0.01% 48 17351 0.02% 49 18830 0.02% 50 20215 0.02% 51 21920 0.02% 52 23096 0.02% 53 25242 0.02% 54 27625 0.02% 55 30944 0.03% 56 31784 0.03% 57 33869 0.03% 58 35814 0.03% 59 198720 0.18% 60 203754 0.18% 61 121161 0.11% 62 128216 0.11% 63 136763 0.12% 64 139783 0.12% 65 145987 0.13% 66 153039 0.14% 67 166279 0.15% 68 166456 0.15% 69 169354 0.15% 70 173192 0.15% 71 167646 0.15% 72 174765 0.15% 73 188474 0.17% 74 189065 0.17% 75 205443 0.18% 76 221232 0.20% 77 202997 0.18% 78 207500 0.18% 79 218412 0.19% 80 220349 0.19% 81 246130 0.22% 82 259923 0.23% 83 272451 0.24% 84 297190 0.26% 85 294920 0.26% 86 274512 0.24% 87 315287 0.28% 88 321139 0.28% 89 346987 0.31% 90 411152 0.36% 91 593462 0.52% 92 427448 0.38% 93 503628 0.44% 94 510991 0.45% 95 2018917 1.78% 96 665182 0.59% 97 863552 0.76% 98 1195247 1.06% 99 2026401 1.79% 100 96782283 85.49% 113215301 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=29 prefix-density=0.38 prefix-fanout=2.1 sequence=TTACAAGTACAAGTCTCC criterion=fanout-score sequence-density=0.10 sequence-density-rank=16 fanout-score=229.94 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=26.0 sequence=AAGAAGAAGAAA criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=3.25 fanout-score-rank=26 prefix-density=0.50 prefix-fanout=2.7 sequence=GGAGACTTGTACTTGTAAGGGTGCGTTGGTGGTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=111.44 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=14.4 sequence=CCAAAACAAAAATCAGAGTCAATTGTTTATTTTAAATTCCAAACTTCGCACATCATCTAAAGCCTTGTACTCGTAAACCACAAAATCGAAAAAAAAGCGCCTCAATTCATCATCTCCATGCTTCAGCTTCAAGCTT SRR10225134 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 23:42:04 Started mapping on | Feb 11 23:42:04 Finished on | Feb 11 23:50:25 Mapping speed, Million of reads per hour | 813.52 Number of input reads | 113215301 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 98651481 Uniquely mapped reads % | 87.14% Average mapped length | 194.86 Number of splices: Total | 42104950 Number of splices: Annotated (sjdb) | 40788064 Number of splices: GT/AG | 41158690 Number of splices: GC/AG | 577146 Number of splices: AT/AC | 62705 Number of splices: Non-canonical | 306409 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.04% Deletion average length | 2.58 Insertion rate per base | 0.03% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 4999876 % of reads mapped to multiple loci | 4.42% Number of reads mapped to too many loci | 5538644 % of reads mapped to too many loci | 4.89% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.20% % of reads unmapped: other | 0.36% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 10110076 10110076 10110076 N_multimapping 4999876 4999876 4999876 N_noFeature 4163548 5204697 96667188 N_ambiguous 1724577 766914 21258 UnstrandedReadsAssigned:92763356 PositiveStrandReadsAssigned:92679870 NegativeStrandReadsAssigned:1963035 Dataset is classified positive stranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR10225134 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR10225134-trimmed-pair1.fastq SRR10225134-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 113,215,301 reads, 98,119,715 reads pseudoaligned [quant] estimated average fragment length: 248.768 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,183 rounds 52401 SRR10225134.ke.tsv 34699 SRR10225134.se.tsv 87100 total ==> SRR10225134.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1770.23 14613.8 58.9779 Potri.005G024800.1.v4.1 1035 787.232 4294 38.9688 Potri.004G059700.1.v4.1 961 713.239 2597 26.0132 Potri.007G009000.2.v4.1 1416 1168.23 0 0 Potri.003G141000.2.v4.1 2943 2695.23 3636 9.63796 Potri.016G087400.1.v4.1 270 65.2234 7796.98 854.043 Potri.015G069301.1.v4.1 564 316.619 0 0 Potri.010G195200.1.v4.1 1773 1525.23 1172.75 5.49322 Potri.012G127500.1.v4.1 977 729.236 56109 549.695 ==> SRR10225134.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 235 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 3391 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 14 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1712 SRR10225134 completed mapping pipeline successfully