Starting /dee2/code/volunteer_pipeline.sh SRR10225136 current disk space = 3052623114240 free memory = 1404609836 SRR10225136 SRAfilesize 077a3c9918e6a6f4087e6e104986fa55 SRR10225136.sra SRR10225136.sra file validated SRR10225136 is paired end SRR10225136 is conventional basespace SRR10225136 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR10225136_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.829 34.0 31.0 34.0 31.0 34.0 2 33.06125 34.0 33.0 34.0 31.0 34.0 3 33.1 34.0 33.0 34.0 31.0 34.0 4 36.45975 37.0 37.0 37.0 35.0 37.0 5 36.44 37.0 37.0 37.0 35.0 37.0 6 36.33275 37.0 37.0 37.0 35.0 37.0 7 36.42925 37.0 37.0 37.0 35.0 37.0 8 36.39025 37.0 37.0 37.0 35.0 37.0 9 38.26575 39.0 39.0 39.0 37.0 39.0 10-11 38.1905 39.0 39.0 39.0 37.0 39.0 12-13 38.205125 39.0 39.0 39.0 37.0 39.0 14-15 39.808499999999995 41.0 40.0 41.0 38.0 41.0 16-17 39.707750000000004 41.0 40.0 41.0 37.0 41.0 18-19 39.65875 41.0 40.0 41.0 37.0 41.0 20-21 39.666624999999996 41.0 40.0 41.0 37.0 41.0 22-23 39.59725 41.0 40.0 41.0 37.0 41.0 24-25 39.601625 41.0 40.0 41.0 37.0 41.0 26-27 39.433875 41.0 39.5 41.0 36.0 41.0 28-29 39.318124999999995 41.0 39.0 41.0 36.0 41.0 30-31 39.241 41.0 39.0 41.0 36.0 41.0 32-33 39.018125 40.0 39.0 41.0 35.0 41.0 34-35 38.923500000000004 40.0 38.5 41.0 35.0 41.0 36-37 38.727625 40.0 38.0 41.0 35.0 41.0 38-39 38.644625000000005 40.0 38.0 41.0 35.0 41.0 40-41 38.53975 40.0 38.0 41.0 35.0 41.0 42-43 38.042125 40.0 38.0 41.0 33.0 41.0 44-45 38.498374999999996 40.0 38.0 41.0 34.5 41.0 46-47 38.564750000000004 40.0 38.0 41.0 35.0 41.0 48-49 38.466625 40.0 38.0 41.0 34.0 41.0 50-51 38.361000000000004 40.0 38.0 41.0 34.0 41.0 52-53 38.220124999999996 40.0 38.0 41.0 33.5 41.0 54-55 37.848375000000004 40.0 37.0 41.0 33.0 41.0 56-57 37.835499999999996 40.0 37.0 41.0 33.0 41.0 58-59 37.392125 39.5 36.0 41.0 32.5 41.0 60-61 37.211375000000004 39.0 36.0 41.0 33.0 41.0 62-63 36.8895 39.0 35.0 41.0 32.0 41.0 64-65 36.562375 38.0 35.0 40.5 31.5 41.0 66-67 36.20125 37.0 35.0 40.0 32.0 41.0 68-69 35.849625 37.0 35.0 39.0 31.5 41.0 70-71 35.497125 36.0 35.0 39.0 31.5 41.0 72-73 35.008875 36.0 35.0 39.0 31.0 40.0 74-75 33.793 35.5 34.5 37.0 29.0 39.0 76-77 33.32575 35.0 34.0 37.0 28.5 39.0 78-79 33.061875 35.0 34.0 36.5 28.5 38.5 80-81 32.70525 35.0 34.0 36.0 27.5 37.0 82-83 32.53125 35.0 34.0 36.0 28.0 37.0 84-85 32.337125 35.0 34.0 35.0 28.0 36.5 86-87 32.173125 35.0 34.0 35.0 27.0 36.0 88-89 32.039 35.0 34.0 35.0 27.0 36.0 90-91 31.930500000000002 35.0 34.0 35.0 27.0 36.0 92-93 31.77825 35.0 34.0 35.0 26.0 35.5 94-95 31.536875000000002 35.0 34.0 35.0 25.0 35.0 96-97 31.415875 35.0 33.5 35.0 24.5 35.0 98-99 31.236 35.0 33.5 35.0 23.5 35.0 100 31.18875 35.0 34.0 35.0 23.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 3.0 9 2.0 10 1.0 11 4.0 12 5.0 13 6.0 14 7.0 15 4.0 16 3.0 17 5.0 18 4.0 19 11.0 20 4.0 21 11.0 22 9.0 23 18.0 24 11.0 25 16.0 26 27.0 27 40.0 28 98.0 29 59.0 30 37.0 31 69.0 32 69.0 33 79.0 34 123.0 35 207.0 36 351.0 37 843.0 38 1540.0 39 333.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.05123053741838 37.01657458563536 22.476142641888497 12.45605223505776 2 35.525 29.775000000000002 19.175 15.525 3 30.8 32.800000000000004 22.35 14.05 4 28.275 28.425 25.900000000000002 17.4 5 27.150000000000002 27.450000000000003 23.974999999999998 21.425 6 34.2 26.375 22.650000000000002 16.775000000000002 7 30.475 26.85 24.925 17.75 8 22.975 32.4 27.500000000000004 17.125 9 23.599999999999998 32.4 26.924999999999997 17.075000000000003 10-11 25.224999999999998 30.3875 25.75 18.637500000000003 12-13 24.4875 28.0875 25.9875 21.4375 14-15 23.3875 29.1125 26.487500000000004 21.0125 16-17 23.05 29.512500000000003 25.5 21.9375 18-19 24.65 27.425 28.375 19.55 20-21 23.4875 27.6875 27.8125 21.0125 22-23 25.575 29.275000000000002 26.400000000000002 18.75 24-25 23.0625 28.9875 25.8 22.15 26-27 23.25 26.8625 28.1625 21.725 28-29 23.0875 29.525000000000002 25.687500000000004 21.7 30-31 24.4 27.6875 28.1125 19.8 32-33 22.5125 29.7875 26.7125 20.9875 34-35 24.825 27.075 26.6625 21.4375 36-37 23.6875 27.275 26.6 22.4375 38-39 22.4625 30.412499999999998 27.474999999999998 19.650000000000002 40-41 22.8 29.225 25.525 22.45 42-43 22.8875 27.525 28.212500000000002 21.375 44-45 22.7375 25.95 28.3625 22.95 46-47 24.8 28.025 27.3625 19.8125 48-49 22.725 29.425 27.450000000000003 20.4 50-51 24.6125 27.5125 26.325 21.55 52-53 24.587500000000002 26.775 26.474999999999998 22.162499999999998 54-55 22.537499999999998 27.175 28.6125 21.675 56-57 21.8 28.1375 30.225 19.8375 58-59 22.7375 26.3625 29.025000000000002 21.875 60-61 25.162499999999998 27.900000000000002 25.587500000000002 21.349999999999998 62-63 22.15 27.85 29.562500000000004 20.4375 64-65 24.85 28.3375 26.424999999999997 20.3875 66-67 22.3125 30.837500000000002 25.837500000000002 21.0125 68-69 23.1875 30.25 26.150000000000002 20.4125 70-71 22.61815453863466 30.57014253563391 26.806701675418854 20.005001250312578 72-73 22.5 31.424999999999997 25.9875 20.0875 74-75 23.150000000000002 29.925 26.825 20.1 76-77 23.75 29.4875 26.55 20.2125 78-79 23.7875 28.5625 27.3625 20.2875 80-81 23.1278909863733 28.2410301287661 27.890986373296663 20.740092511563944 82-83 23.5 27.925 27.6875 20.8875 84-85 22.675 27.6875 28.000000000000004 21.637500000000003 86-87 22.787499999999998 29.325000000000003 27.4125 20.474999999999998 88-89 23.150000000000002 28.7 26.575 21.575 90-91 23.215401925240656 28.166020752594072 27.903487935992 20.715089386173272 92-93 24.2 27.3 27.437499999999996 21.0625 94-95 23.4875 28.3875 28.537499999999998 19.5875 96-97 24.2 28.4375 26.900000000000002 20.4625 98-99 23.95 27.8625 27.525 20.6625 100 24.075 28.65 27.250000000000004 20.025000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.5 12 1.0 13 1.5 14 1.0 15 0.0 16 0.5 17 0.5 18 1.0 19 2.5 20 3.0 21 2.5 22 3.5 23 4.0 24 4.5 25 7.0 26 8.0 27 9.5 28 8.0 29 13.0 30 17.5 31 19.5 32 26.0 33 30.0 34 40.0 35 64.0 36 80.5 37 101.0 38 136.0 39 163.5 40 181.5 41 229.0 42 267.5 43 265.5 44 256.0 45 272.0 46 263.5 47 219.5 48 211.0 49 186.0 50 143.0 51 126.0 52 118.0 53 97.5 54 77.0 55 62.0 56 49.0 57 40.5 58 29.5 59 20.0 60 22.0 61 21.0 62 17.0 63 13.5 64 10.5 65 9.0 66 7.0 67 7.0 68 5.0 69 3.0 70 4.0 71 4.0 72 3.0 73 1.0 74 1.0 75 1.5 76 1.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.44999999999999996 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.025 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0125 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0125 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.875 #Duplication Level Percentage of deduplicated Percentage of total 1 98.76152832674572 93.7 2 1.0013175230566536 1.9 3 0.13175230566534915 0.375 4 0.026350461133069828 0.1 5 0.0 0.0 6 0.0 0.0 7 0.026350461133069828 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.026350461133069828 0.27499999999999997 >50 0.0 0.0 >100 0.026350461133069828 3.4750000000000005 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCTACATCTCGTATG 139 3.4750000000000005 TruSeq Adapter, Index 11 (100% over 49bp) CAACACGGGGAAACTTACCAGGTCCAGACATAGTAAGGATTGACAGACTG 11 0.27499999999999997 No Hit TACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCC 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 4.125 0.0 0.0 0.0 0.0 2 4.125 0.0 0.0 0.0 0.0 3 4.125 0.0 0.0 0.0 0.0 4 4.125 0.0 0.0 0.0 0.0 5 4.125 0.0 0.0 0.0 0.0 6 4.125 0.0 0.0 0.0 0.0 7 4.15 0.0 0.0 0.0 0.0 8 4.15 0.0 0.0 0.0 0.0 9 4.15 0.0 0.0 0.0 0.0 10-11 4.175 0.0 0.0 0.0 0.0 12-13 4.175 0.0 0.0 0.0 0.0 14-15 4.1875 0.0 0.0 0.0 0.0 16-17 4.225 0.0 0.0 0.0 0.0 18-19 4.25 0.0 0.0 0.0 0.0 20-21 4.275 0.0 0.0 0.0 0.0 22-23 4.2875 0.0 0.0 0.0 0.0 24-25 4.3375 0.0 0.0 0.0 0.0 26-27 4.35 0.0 0.0 0.0 0.0 28-29 4.3625 0.0 0.0 0.0 0.0 30-31 4.375 0.0 0.0 0.0 0.0 32-33 4.3875 0.0 0.0 0.0 0.0 34-35 4.4 0.0 0.0 0.0 0.0 36-37 4.4125 0.0 0.0 0.0 0.0 38-39 4.425 0.0 0.0 0.0 0.0 40-41 4.425 0.0 0.0 0.0 0.0 42-43 4.425 0.0 0.0 0.0 0.0 44-45 4.425 0.0 0.0 0.0 0.0 46-47 4.425 0.0 0.0 0.0 0.0 48-49 4.425 0.0 0.0 0.0 0.0 50-51 4.425 0.0 0.0 0.0 0.0 52-53 4.425 0.0 0.0 0.0 0.0 54-55 4.4375 0.0 0.0 0.0 0.0 56-57 4.45 0.0 0.0 0.0 0.0 58-59 4.4625 0.0 0.0 0.0 0.0 60-61 4.475 0.0 0.0 0.0 0.0 62-63 4.4875 0.0 0.0 0.0 0.0 64-65 4.5 0.0 0.0 0.0 0.0 66-67 4.5 0.0 0.0 0.0 0.0 68-69 4.5 0.0 0.0 0.0 0.0 70-71 4.5 0.0 0.0 0.0 0.0 72-73 4.5 0.0 0.0 0.0 0.0 74-75 4.525 0.0 0.0 0.0 0.0 76-77 4.5375 0.0 0.0 0.0 0.0 78-79 4.55 0.0 0.0 0.0 0.0 80-81 4.5625 0.0 0.0 0.0 0.0 82-83 4.6125 0.0 0.0 0.0 0.0 84-85 4.6875 0.0 0.0 0.0 0.0 86-87 4.762499999999999 0.0 0.0 0.0 0.0 88 4.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGAAAC 15 6.409497E-4 93.9875 8 GGAAACT 15 6.409497E-4 93.9875 9 CGGGGAA 20 0.002009417 70.49062 6 GGGGAAA 20 0.002009417 70.49062 7 TTAGTTG 20 0.002009417 70.49062 94 AGATCGG 40 6.1813007E-6 59.48576 1 GATCGGA 40 6.6764005E-6 58.742184 2 ATCGGAA 40 6.6764005E-6 58.742184 3 TCGGAAG 35 2.5988763E-4 53.707146 4 CGGAAGA 35 2.5988763E-4 53.707146 5 AGAGCAC 35 2.5988763E-4 53.707146 9 GGAAGAG 40 5.025033E-4 46.993748 6 AAGAGCA 50 0.0015082634 37.594997 8 GAAGAGC 50 0.0015082634 37.594997 7 TTGAAAA 30 0.0039235605 31.329168 62-63 CACACGT 40 4.3778887E-4 29.371092 12-13 CACGTCT 40 4.3778887E-4 29.371092 14-15 AGCACAC 40 4.3778887E-4 29.371092 10-11 CGTCTGA 40 4.3778887E-4 29.371092 16-17 GAGCACA 35 0.00833628 26.853573 10-11 >>END_MODULE SRR10225136 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR10225136_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.23425 34.0 31.0 34.0 30.0 34.0 2 32.38875 34.0 31.0 34.0 31.0 34.0 3 32.32425 34.0 31.0 34.0 30.0 34.0 4 35.8005 37.0 37.0 37.0 35.0 37.0 5 35.736 37.0 37.0 37.0 35.0 37.0 6 35.62775 37.0 35.0 37.0 35.0 37.0 7 35.6555 37.0 37.0 37.0 35.0 37.0 8 35.67275 37.0 36.0 37.0 35.0 37.0 9 37.43575 39.0 39.0 39.0 35.0 39.0 10-11 37.445499999999996 39.0 38.5 39.0 35.0 39.0 12-13 37.399125 39.0 38.0 39.0 35.0 39.0 14-15 38.847 41.0 39.0 41.0 35.5 41.0 16-17 38.783500000000004 41.0 40.0 41.0 35.5 41.0 18-19 38.619625 41.0 39.0 41.0 34.5 41.0 20-21 38.406625 41.0 39.0 41.0 34.0 41.0 22-23 38.2995 41.0 39.0 41.0 34.0 41.0 24-25 38.229 41.0 39.0 41.0 34.0 41.0 26-27 38.160624999999996 41.0 39.0 41.0 34.0 41.0 28-29 38.071 40.0 38.5 41.0 34.0 41.0 30-31 37.780125 40.0 38.0 41.0 32.0 41.0 32-33 37.626625000000004 40.0 38.0 41.0 32.5 41.0 34-35 37.505875 40.0 38.0 41.0 32.5 41.0 36-37 37.51075 40.0 38.0 41.0 32.5 41.0 38-39 37.44075 40.0 38.0 41.0 32.5 41.0 40-41 37.40625 40.0 38.0 41.0 32.5 41.0 42-43 37.19125 40.0 38.0 41.0 31.5 41.0 44-45 37.239999999999995 40.0 38.0 41.0 32.0 41.0 46-47 37.398875000000004 40.0 38.0 41.0 32.0 41.0 48-49 37.307500000000005 40.0 38.0 41.0 32.0 41.0 50-51 37.266125 40.0 38.0 41.0 32.0 41.0 52-53 37.047875 40.0 37.0 41.0 31.5 41.0 54-55 36.90475 40.0 37.0 41.0 31.0 41.0 56-57 36.796 40.0 36.0 41.0 31.0 41.0 58-59 36.584374999999994 40.0 36.0 41.0 31.0 41.0 60-61 36.2715 39.0 35.0 41.0 31.0 41.0 62-63 36.116749999999996 39.0 35.0 41.0 31.0 41.0 64-65 35.52225 38.5 35.0 41.0 29.0 41.0 66-67 34.777375 37.5 35.0 40.0 27.0 41.0 68-69 34.065875 37.0 35.0 39.5 24.5 41.0 70-71 33.637625 36.5 34.5 39.0 24.0 41.0 72-73 33.2235 36.0 34.0 39.0 22.5 40.5 74-75 32.881375 35.5 34.0 37.5 21.5 40.0 76-77 32.556250000000006 35.0 34.0 37.0 22.5 39.0 78-79 32.245000000000005 35.0 34.0 37.0 21.5 39.0 80-81 31.95325 35.0 34.0 36.0 20.5 37.5 82-83 31.632375 35.0 33.5 36.0 20.5 37.0 84-85 31.322 35.0 33.0 35.5 18.0 37.0 86-87 31.105625 35.0 33.0 35.0 16.0 36.0 88-89 30.972250000000003 35.0 33.0 35.0 12.5 36.0 90-91 30.738500000000002 35.0 33.0 35.0 4.5 36.0 92-93 30.438875000000003 35.0 33.0 35.0 2.0 35.5 94-95 30.263875 35.0 33.0 35.0 2.0 35.0 96-97 30.139 35.0 32.5 35.0 2.0 35.0 98-99 30.060875000000003 35.0 33.0 35.0 2.0 35.0 100 29.94625 35.0 32.0 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 40.0 3 12.0 4 5.0 5 5.0 6 4.0 7 20.0 8 15.0 9 5.0 10 5.0 11 7.0 12 9.0 13 7.0 14 9.0 15 6.0 16 11.0 17 3.0 18 10.0 19 8.0 20 15.0 21 12.0 22 15.0 23 30.0 24 50.0 25 74.0 26 30.0 27 26.0 28 28.0 29 46.0 30 35.0 31 63.0 32 52.0 33 83.0 34 135.0 35 168.0 36 323.0 37 731.0 38 1499.0 39 404.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.074999999999996 18.375 15.475 28.075 2 31.3 8.35 18.425 41.925000000000004 3 19.075 11.375 19.475 50.075 4 21.349999999999998 8.175 22.125 48.35 5 24.55 12.049999999999999 21.925 41.475 6 33.6 12.375 25.074999999999996 28.95 7 20.525 29.049999999999997 31.474999999999998 18.95 8 14.649999999999999 34.1 32.4 18.85 9 14.875 35.15 31.4 18.575 10-11 18.3625 32.45 29.4125 19.775000000000002 12-13 18.075 29.775000000000002 29.8875 22.2625 14-15 18.0625 28.812500000000004 32.425 20.7 16-17 19.075 28.975 29.275000000000002 22.675 18-19 20.4 28.95 30.925000000000004 19.725 20-21 17.825 31.574999999999996 29.8875 20.7125 22-23 22.112499999999997 29.4875 26.900000000000002 21.5 24-25 19.6375 31.85 27.474999999999998 21.0375 26-27 17.8125 33.5 27.6 21.087500000000002 28-29 20.4875 32.1625 26.5875 20.7625 30-31 20.0375 30.112499999999997 29.299999999999997 20.549999999999997 32-33 20.4875 29.4125 28.012500000000003 22.0875 34-35 20.3375 31.612499999999997 25.85 22.2 36-37 18.0625 31.4875 28.575 21.875 38-39 18.2 29.512500000000003 28.787499999999998 23.5 40-41 20.1125 30.2875 26.724999999999998 22.875 42-43 20.5125 29.5375 28.1625 21.7875 44-45 22.4625 29.625 26.237500000000004 21.675 46-47 18.8 29.762499999999996 27.487499999999997 23.95 48-49 21.337500000000002 29.562500000000004 26.0 23.1 50-51 21.6 28.7375 26.325 23.3375 52-53 18.787499999999998 32.25 28.050000000000004 20.9125 54-55 19.325 28.7375 28.8375 23.1 56-57 18.6125 31.5 28.6625 21.224999999999998 58-59 19.5875 30.925000000000004 28.012500000000003 21.475 60-61 18.8375 33.2375 26.05 21.875 62-63 17.8125 33.900000000000006 26.474999999999998 21.8125 64-65 18.587500000000002 33.3375 26.35 21.725 66-67 18.2875 32.6875 26.5625 22.4625 68-69 18.512500000000003 33.887499999999996 25.324999999999996 22.275 70-71 18.8875 31.4625 26.875 22.775000000000002 72-73 20.025000000000002 30.3 27.6375 22.037499999999998 74-75 19.8375 29.8875 27.150000000000002 23.125 76-77 19.3875 30.45 27.3625 22.8 78-79 19.6125 29.95 27.224999999999998 23.2125 80-81 20.125 29.362500000000004 28.125 22.3875 82-83 20.0625 29.75 26.1125 24.075 84-85 20.3875 30.775000000000002 26.275 22.5625 86-87 19.950000000000003 30.8125 26.700000000000003 22.537499999999998 88-89 19.2 30.862499999999997 26.375 23.5625 90-91 19.225 30.875000000000004 26.3625 23.5375 92-93 20.849999999999998 29.262500000000003 26.650000000000002 23.2375 94-95 20.7625 29.9625 26.575 22.7 96-97 20.2625 30.049999999999997 27.4125 22.275 98-99 20.7375 29.9375 27.0625 22.2625 100 21.55 29.45 25.825 23.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 1.5 17 2.0 18 1.5 19 2.0 20 2.5 21 3.5 22 3.0 23 4.0 24 9.5 25 9.0 26 11.5 27 20.0 28 23.0 29 29.0 30 36.5 31 49.5 32 71.5 33 82.0 34 98.5 35 120.0 36 134.5 37 150.0 38 165.5 39 186.5 40 206.5 41 217.5 42 209.5 43 210.0 44 215.0 45 215.5 46 204.5 47 181.0 48 167.0 49 142.0 50 117.5 51 100.0 52 79.5 53 69.0 54 61.0 55 54.0 56 52.0 57 39.5 58 35.5 59 38.0 60 32.5 61 26.0 62 18.0 63 15.0 64 11.0 65 6.5 66 7.5 67 7.0 68 6.0 69 4.0 70 3.5 71 5.0 72 5.5 73 6.5 74 6.0 75 3.0 76 0.5 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.55 #Duplication Level Percentage of deduplicated Percentage of total 1 98.28133262823903 92.925 2 1.2956107879428873 2.45 3 0.23796932839767318 0.675 4 0.10576414595452141 0.4 5 0.026441036488630353 0.125 6 0.026441036488630353 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.026441036488630353 3.2750000000000004 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCC 131 3.2750000000000004 Illumina Single End PCR Primer 1 (100% over 50bp) CCCCTCTTCGGCCTTCAAAGTTCTCATTTGAATATTTGCTACTACCACCA 6 0.15 No Hit CTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 3.75 0.0 0.0 0.0 0.0 2 3.75 0.0 0.0 0.0 0.0 3 3.75 0.0 0.0 0.0 0.0 4 3.75 0.0 0.0 0.0 0.0 5 3.75 0.0 0.0 0.0 0.0 6 3.75 0.0 0.0 0.0 0.0 7 3.775 0.0 0.0 0.0 0.0 8 3.775 0.0 0.0 0.0 0.0 9 3.775 0.0 0.0 0.0 0.0 10-11 3.8125 0.0 0.0 0.0 0.0 12-13 3.825 0.0 0.0 0.0 0.0 14-15 3.8375000000000004 0.0 0.0 0.0 0.0 16-17 3.8875 0.0 0.0 0.0 0.0 18-19 3.9625000000000004 0.0 0.0 0.0 0.0 20-21 3.9875 0.0 0.0 0.0 0.0 22-23 4.0125 0.0 0.0 0.0 0.0 24-25 4.1125 0.0 0.0 0.0 0.0 26-27 4.15 0.0 0.0 0.0 0.0 28-29 4.175000000000001 0.0 0.0 0.0 0.0 30-31 4.2125 0.0 0.0 0.0 0.0 32-33 4.2375 0.0 0.0 0.0 0.0 34-35 4.25 0.0 0.0 0.0 0.0 36-37 4.2625 0.0 0.0 0.0 0.0 38-39 4.275 0.0 0.0 0.0 0.0 40-41 4.275 0.0 0.0 0.0 0.0 42-43 4.275 0.0 0.0 0.0 0.0 44-45 4.275 0.0 0.0 0.0 0.0 46-47 4.275 0.0 0.0 0.0 0.0 48-49 4.275 0.0 0.0 0.0 0.0 50-51 4.275 0.0 0.0 0.0 0.0 52-53 4.275 0.0 0.0 0.0 0.0 54-55 4.275 0.0 0.0 0.0 0.0 56-57 4.275 0.0 0.0 0.0 0.0 58-59 4.2875 0.0 0.0 0.0 0.0 60-61 4.3 0.0 0.0 0.0 0.0 62-63 4.3125 0.0 0.0 0.0 0.0 64-65 4.325 0.0 0.0 0.0 0.0 66-67 4.325 0.0 0.0 0.0 0.0 68-69 4.325 0.0 0.0 0.0 0.0 70-71 4.325 0.0 0.0 0.0 0.0 72-73 4.325 0.0 0.0 0.0 0.0 74-75 4.35 0.0 0.0 0.0 0.0 76-77 4.3625 0.0 0.0 0.0 0.0 78-79 4.375 0.0 0.0 0.0 0.0 80-81 4.3875 0.0 0.0 0.0 0.0 82-83 4.449999999999999 0.0 0.0 0.0 0.0 84-85 4.5125 0.0 0.0 0.0 0.0 86-87 4.5875 0.0 0.0 0.0 0.0 88 4.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 305 0.001679424 7.7049184 6 >>END_MODULE Read 3767552 spots for SRR10225136.sra Written 3767552 spots for SRR10225136.sra Read 3767552 spots for SRR10225136.sra Written 3767552 spots for SRR10225136.sra Read 3767552 spots for SRR10225136.sra Written 3767552 spots for SRR10225136.sra Read 3767552 spots for SRR10225136.sra Written 3767552 spots for SRR10225136.sra Read 3767552 spots for SRR10225136.sra Written 3767552 spots for SRR10225136.sra Read 3767552 spots for SRR10225136.sra Written 3767552 spots for SRR10225136.sra Read 3767552 spots for SRR10225136.sra Written 3767552 spots for SRR10225136.sra Read 3767552 spots for SRR10225136.sra Written 3767552 spots for SRR10225136.sra Read 3767552 spots for SRR10225136.sra Written 3767552 spots for SRR10225136.sra Read 3767552 spots for SRR10225136.sra Written 3767552 spots for SRR10225136.sra Read 3767552 spots for SRR10225136.sra Written 3767552 spots for SRR10225136.sra Read 3767563 spots for SRR10225136.sra Written 3767563 spots for SRR10225136.sra Read 3767552 spots for SRR10225136.sra Written 3767552 spots for SRR10225136.sra Read 3767552 spots for SRR10225136.sra Written 3767552 spots for SRR10225136.sra Read 3767552 spots for SRR10225136.sra Written 3767552 spots for SRR10225136.sra Read 3767552 spots for SRR10225136.sra Written 3767552 spots for SRR10225136.sra Read 3767552 spots for SRR10225136.sra Written 3767552 spots for SRR10225136.sra Read 3767552 spots for SRR10225136.sra Written 3767552 spots for SRR10225136.sra Read 3767552 spots for SRR10225136.sra Written 3767552 spots for SRR10225136.sra Read 3767552 spots for SRR10225136.sra Written 3767552 spots for SRR10225136.sra SRR ids: ['SRR10225136.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7vgse15d SRR10225136.sra spots: 75351051 blocks: [[1, 3767552], [3767553, 7535104], [7535105, 11302656], [11302657, 15070208], [15070209, 18837760], [18837761, 22605312], [22605313, 26372864], [26372865, 30140416], [30140417, 33907968], [33907969, 37675520], [37675521, 41443072], [41443073, 45210624], [45210625, 48978176], [48978177, 52745728], [52745729, 56513280], [56513281, 60280832], [60280833, 64048384], [64048385, 67815936], [67815937, 71583488], [71583489, 75351051]] SRR10225136 file size 20604048 SRR10225136 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR10225136 SRR10225136_1.fastq SRR10225136_2.fastq Input file: SRR10225136_1.fastq Paired file: SRR10225136_2.fastq trimmed: SRR10225136-trimmed-pair1.fastq, SRR10225136-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 22:58:39 2025 >> started Tue Feb 11 23:00:00 2025 >> done (81.009s) 75351051 read pairs processed; of these: 588716 ( 0.78%) short read pairs filtered out after trimming by size control 4191113 ( 5.56%) empty read pairs filtered out after trimming by size control 70571222 (93.66%) read pairs available; of these: 10509657 (14.89%) trimmed read pairs available after processing 60061565 (85.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 55380 0.08% 19 36793 0.05% 20 46302 0.07% 21 20641 0.03% 22 13378 0.02% 23 16251 0.02% 24 36211 0.05% 25 39361 0.06% 26 29205 0.04% 27 21945 0.03% 28 15381 0.02% 29 18823 0.03% 30 18787 0.03% 31 12452 0.02% 32 13089 0.02% 33 8781 0.01% 34 5986 0.01% 35 6222 0.01% 36 6490 0.01% 37 6846 0.01% 38 7395 0.01% 39 8032 0.01% 40 8770 0.01% 41 8721 0.01% 42 9225 0.01% 43 10099 0.01% 44 10472 0.01% 45 11491 0.02% 46 11211 0.02% 47 11439 0.02% 48 12466 0.02% 49 13489 0.02% 50 14380 0.02% 51 15343 0.02% 52 15841 0.02% 53 17022 0.02% 54 19051 0.03% 55 20985 0.03% 56 21367 0.03% 57 23090 0.03% 58 24391 0.03% 59 144287 0.20% 60 152689 0.22% 61 84906 0.12% 62 92226 0.13% 63 100315 0.14% 64 98874 0.14% 65 102704 0.15% 66 106302 0.15% 67 111611 0.16% 68 110323 0.16% 69 113530 0.16% 70 115471 0.16% 71 111868 0.16% 72 113082 0.16% 73 120783 0.17% 74 120557 0.17% 75 124834 0.18% 76 134205 0.19% 77 126485 0.18% 78 127054 0.18% 79 130639 0.19% 80 133563 0.19% 81 142960 0.20% 82 147158 0.21% 83 158615 0.22% 84 163109 0.23% 85 165275 0.23% 86 158741 0.22% 87 181356 0.26% 88 190905 0.27% 89 212409 0.30% 90 251935 0.36% 91 367689 0.52% 92 255744 0.36% 93 300298 0.43% 94 311813 0.44% 95 1301419 1.84% 96 401478 0.57% 97 521388 0.74% 98 742622 1.05% 99 1235831 1.75% 100 60061565 85.11% 70571222 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.71 fanout-score-rank=32 prefix-density=0.02 prefix-fanout=2.7 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCTACATCTCGTATGCCGTCTTCTGCTTGAAAAAAA criterion=fanout-score sequence-density=0.10 sequence-density-rank=13 fanout-score=205.92 fanout-score-rank=1 prefix-density=0.90 prefix-fanout=23.1 sequence=AAGAAGAAGAAA criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.79 fanout-score-rank=25 prefix-density=0.18 prefix-fanout=2.7 sequence=AGATGTTTCAGTTCGCTAAGTTTGAAAAGTCCAAAGAGCGCAGACTCGCCACGGAGCTTGGAGACGGTTTCCCGATCGGAGATC criterion=fanout-score sequence-density=0.11 sequence-density-rank=12 fanout-score=132.08 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=20.0 sequence=CTTCTTCTTTTT SRR10225136 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 23:01:49 Started mapping on | Feb 11 23:01:49 Finished on | Feb 11 23:08:15 Mapping speed, Million of reads per hour | 658.18 Number of input reads | 70571222 Average input read length | 190 UNIQUE READS: Uniquely mapped reads number | 58618296 Uniquely mapped reads % | 83.06% Average mapped length | 189.67 Number of splices: Total | 21603290 Number of splices: Annotated (sjdb) | 20800909 Number of splices: GT/AG | 21027402 Number of splices: GC/AG | 333970 Number of splices: AT/AC | 38832 Number of splices: Non-canonical | 203086 Mismatch rate per base, % | 0.50% Deletion rate per base | 0.05% Deletion average length | 2.32 Insertion rate per base | 0.04% Insertion average length | 2.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2660283 % of reads mapped to multiple loci | 3.77% Number of reads mapped to too many loci | 4151254 % of reads mapped to too many loci | 5.88% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.66% % of reads unmapped: other | 0.62% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 9669260 9669260 9669260 N_multimapping 2660283 2660283 2660283 N_noFeature 3030855 3608459 57487867 N_ambiguous 1001014 439469 12942 UnstrandedReadsAssigned:54586427 PositiveStrandReadsAssigned:54570368 NegativeStrandReadsAssigned:1117487 Dataset is classified positive stranded MeadianReadLen=96 20thPercentileLength=96 echo kmer=91 SRR10225136 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR10225136-trimmed-pair1.fastq SRR10225136-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 70,571,222 reads, 57,932,638 reads pseudoaligned [quant] estimated average fragment length: 242.263 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,307 rounds 52401 SRR10225136.ke.tsv 34699 SRR10225136.se.tsv 87100 total ==> SRR10225136.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.74 11081.5 76.0458 Potri.005G024800.1.v4.1 1035 793.737 2757.04 42.3513 Potri.004G059700.1.v4.1 961 719.745 693 11.7397 Potri.007G009000.2.v4.1 1416 1174.74 0 0 Potri.003G141000.2.v4.1 2943 2701.74 2264.33 10.2188 Potri.016G087400.1.v4.1 270 67.7407 4775.91 859.622 Potri.015G069301.1.v4.1 564 323.058 0 0 Potri.010G195200.1.v4.1 1773 1531.74 1251 9.95804 Potri.012G127500.1.v4.1 977 735.745 18562 307.609 ==> SRR10225136.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 34 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 1496 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1192 SRR10225136 completed mapping pipeline successfully